Search Results

Search found 51790 results on 2072 pages for 'long running'.

Page 455/2072 | < Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >

  • [hibernate - jpa] @OneToOne annotoation problem (i think...)

    - by blow
    Hi all, im new in hibernate and JPA and i have some problems with annotations. My target is to create this table in db (PERSON_TABLE with personal-details) ID ADDRESS NAME SURNAME MUNICIPALITY_ID First of all, i have a MUNICIPALITY table in db containing all municipality of my country. I mapped this table in this ENTITY: @Entity public class Municipality implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String country; private String province; private String name; @Column(name="cod_catasto") private String codCatastale; private String cap; public Municipality() { } ... Then i make an EMBEDDABLE class Address containing fields that realize a simple address... @Embeddable public class Address implements Serializable { @OneToOne(cascade=CascadeType.ALL) @JoinColumn(name="id_municipality") private Municipality municipality; @Column(length=45) private String address; public Address() { } ... Finally i embedded this class into Person ENTITY @Entity public class Person implements Serializable { @Id @GeneratedValue(strategy=GenerationType.IDENTITY) private Long id; private String name; private String surname; @Embedded private Address address; public Person() { } ... All works good when i have to save a new Person record, in fact hibernate creates a PERSON_TABLE as i want, but if i try to retrieve a Person record i have an exception. HQL is simply "from Person" The excpetion is (Entities is the package containing all classes above-mentioned): org.hibernate.AnnotationException: @OneToOne or @ManyToOne on Entities.Person.address.municipality references an unknown entity: Entities.Municipality Is the @OneToOne annotation the problem? Thanks.

    Read the article

  • Is there a way to retrieve the Computer Name of a Xenapp client?

    - by mlusby
    What options exist for identifying the client name of a particular client from within the process running on Citrix Presentation 4.0, or Xenapp 5, and are there any important differences in retrieving this information in either scenario? Currently my software is a client that connects to a service on a server, and the primary means of identification are computer name and IP Address. When installed on a Citrix Presentation server, all running instances currently show the same Computer Name and IP Address, which are those of the server. My application is written in VB 6.0, however I am looking to implement the new feature in C# .NET. Any help or clarification on the question itself would be appreciated, as I am not experienced with developing for Citrix thin clients.

    Read the article

  • Xcode: How-to bind a key that triggers application to appear (background daemon)

    - by Shyam
    Hi, I am struggling to create a certain kind of application my Mac, using Xcode and Interface Builder (RubyCocoa). As I am a nuby (but understand some Ruby), I would like to know how I could let my interface appear only if a key is pushed (a toggle), while the program is running in the background. Similar behavior like when I'd press the F4-key to show Dashboard. Really neat would be if the program wouldn't be showing as running in the Dock, but as a funky icon in the top bar, like well "Growl". Thank you so much for your help, comments and feedback!

    Read the article

  • Return latitude/longitude based on entered address

    - by Don
    I'm building a php based application for a client to enter in addresses for their customers' buildings. They'd like the ability to view the location on a map (either as individuals or grouped in a city search). What I'm trying to accomplish is a lookup once the address is entered into a form that populates the database, so after they enter in the addresss, city, state, zip (these are all US locations) they could click a "get lat/long info" link/button that would check to make sure the data is complete, then would lookup the address and return the latitude/longitude into the appropriate form fields. Then the form could be submitted to store the info, and I could later just pull the lat/long when plotting on a map. 1) Does this make sense, or would I be better off just doing the lookup when it's time to plot it? 2) Does anyone have any pointers to solve this problem? I've seen some of the Google/Yahoo API's but it looks like this is more based on the plotting a point part. I may be able to modify it to suit my needs, but I'm just trying to cut some research time posting here with the hopes one of you may have a more direct route. I'll RTFM if I have to... Thanks, D.

    Read the article

  • How to flush data in php and disconnect user but keep the script alive

    - by Rodrigo
    This is a trick question, while developing a php+ajax application i felt into some long queries, nothing wrong with them, but they could be done in background. I know that there's a way to just send a reply to user while throwing the real processing to another process by exec(), however it dosen't feels right for me, this might generate exploits and it's not pratical on making it compatible with virtual servers and cross platform. PHP offers the ob_* functions although they help on flushing the cache, but the user will keep connected until the script is running. I'm wondering if there's an alternate to exec to keep a script running after sending data to user and closing connection/thread with apache, or a less "dirty" way to have processing data sent to another script.

    Read the article

  • Windows Service suddenly doing nothing

    - by TB
    Hi, My windows service is using a Thread (not a timer) which is always looping and sleeps for 1 second every loop using : evet.WaitOne(interval); When I start the service it works fine and I can see in the task manager that it is running, consuming and releasing memory, consuming processor ... etc that is all normal, but after a while (random amount of time) the service simply stops!! it is still there in the task manager but it is not consuming any processor work now and its consumption to the memory is not changing. it simply (died but still there in the task manager like a Zombie). I know that many exceptions might have happened during running the service (it is really doing many things) but all those exceptions are handled in Try catch blocks, so why is my "always looping" thread stops ??? This thread also logs every time he loops, when he is freezig in this way he is not logging anything (of course)

    Read the article

  • Why can't untrusted code change the log level under Java Logging?

    - by cdmckay
    I'm have a Java app that also runs as an applet. The app also happens to use a library called BasicPlayer to play .ogg files. BasicPlayer has a built-in logger that uses Apache Logging Commons to create a logger for BasicPlayer.class using the built-in Java logger. The only way that I know about to turn off the BasicPlayer logging is to run this code: Logger.getLogger(BasicPlayer.class.getName()).setLevel(Level.OFF); This works fine when running as a regular app. However, when running as an applet, this code will throw a SecurityException because for some reason applets can't change the log level of non-anonymous loggers (see here for a sorta-explanation). Why would they do this? Who cares if an applet changes the log level?

    Read the article

  • How to store unlimited characters in Oracle 11g?

    - by vicky21
    We have a table in Oracle 11g with a varchar2 column. We use a proprietary programming language where this column is defined as string. Maximum we can store 2000 characters (4000 bytes) in this column. Now the requirement is such that the column needs to store more than 2000 characters (in fact unlimited characters). The DBAs don't like BLOB or LONG datatypes for maintenance reasons. The solution that I can think of is to remove this column from the original table and have a separate table for this column and then store each character in a row, in order to get unlimited characters. This tble will be joined with the original table for queries. Is there any better solution to this problem? UPDATE: The proprietary programming language allows to define variables of type string and blob, there is no option of CLOB. I understand the responses given, but I cannot take on the DBAs. I understand that deviating from BLOB or LONG will be developers' nightmare, but still cannot help it.

    Read the article

  • Backing up my data causes my server to crash using Symantec Backup Exec 12, or How I Came to Loathe Irony

    - by Kyle Noland
    I have a Dell PowerEdge 2850 running Windows Server 2003. It is the primary file server for one of my clients. I have another server also running Windows Server 2003 that acts as the core media server for Symantec Backup Exec 12. I recently upgraded from Backup Exec 11d to 12. This upgrade was necessary because we also just upgraded from Exchange 2003 to Exchange 2007. After the upgrade I had to push-install the new version 12 Backup Exec Remote Agents to each of the servers I am backing up (about 6 total). 5 of my servers are doing just fine, faithfully completing backups every night. My file server routinely crashes. Observations: When the server crashes, it does not blue screen, it just locks up completely. Even the mouse is unresponsive. If you leave the server locked up long enough, it will eventually reboot itself and hang on the Windows splash screen. There is absolutely zero useful Event Viewer evidence of a problem. The logs go from routine logging to an Unexplained Shutdown Event the next morning when I have to hard reset the server to get it to boot. 90% of the time the server does not boot cleanly, it hangs on the Windows splash screen. I don't have any light to shed here. When the server hangs all I can do is hard reset it and try again. Even after a successful boot and chkdsk /r operation, if you reboot the machine, you have a 90% chance it won't back up again cleanly. The back story: This server started crashing during nightly backups about a month ago. I tried everything I could think of to troubleshoot the problem and eventually had to give up because I could not keep coming to the office at 4 AM to try to get the server back online. One Friday I got lucky and the server stayed up for its entire full backup. I took this opportunity to restore the full backup to a temporary server I set up and switched all my users to the temporary. Then I reloaded the ailing file server. I kept all my users on the temporary file server for about 3 weeks. I installed the same Backup Exec Remote Agent and Trend Micro A/V client on the temporary server that I was using on the regular file server. During this time, I had absolutely no problems backing up the temporary server. I tested the reloaded file server extensively. I rebooted the server once an hour every day for 3 weeks trying to make it fail. It never did. I felt confident that the reload was the answer to my problems. I moved all of the data from the temporary server back to the regular server. I got 3 nightly backups out of it before it locked up again and started the familiar failure to boot cleanly behavior. This weekend I decided to monitor the file server through the entire backup job. I RDPd into the file server and also into the server running Backup Exec. On the file server I opened the Task Manager so I could view the processes and watch CPU and memory usage. Everything was running smoothly for about 60GB worth of backup. Then I noticed that the byte count of the backup job in Backup Exec had stopped progressing. I looked back over at my RDP session into the file server, and I was getting real time updates about CPU and memory usage still - both nearly 0%, which is unusual. Backups usually hover around 40% usage for the duration of the backup job. Let me reiterate this point: The screen was refreshing and I was getting real time Task Manager updates - until I clicked on the Start menu. The screen went black and the server locked up. In truth, I think the server had already locked up, the video card just hadn't figured it out yet. I went back into my bag of trick: driving to the office and hard reseting the server over and over again when it hangs up at the Windows splash screen. I did this for 2 hours without getting a successful boot. I started panicking because I did not have a decent backup to use to get everything back onto the working temporary file server. Once I exhausted everything I knew to do, I took a deep breath, booted to the Windows Server 2003 CD and performed a repair installation of Windows. The server came back up fine, with all of my data intact. I can now reboot the server at will and it will come back up cleanly. The problem is that I'm afraid as soon as I try to back that data up again I will back at square one. So let me sum things up: Here is what I've done so far to troubleshoot this server: Deleted and recreated the RAID 5 sets. Initialized the drives. Reloaded the server with a fresh Server 2003 install. Confirmed with Dell that I have installed the latest, Dell approved BIOS and NIC drivers. Uninstalled / reinstalled the Backup Exec Remote Agent. Uninstalled the Trend Micro A/V client. Configured the server not to reboot itself after a blue screen so I can see any stop error. I used to think the server was blue screening, but since I enabled this setting I now know that the server just completely locks up. Run chkdsk /r from the Windows Recovery Console. Several errors were found and corrected, but did not help my problem. Help confirm or deny the following assumptions: There are two problems at work here. Why the server is locking up in the first place, and why the server won't boot cleanly after a lockup. This is ultimately a software problem. The server works fine and can be rebooted cleanly all day long - until the first lockup - following a fresh OS load or even a Repair installation. This is not a problem with Backup Exec in general. All of my other servers back up just fine. For the record, all of the other servers run Server 2003, and some of them house more data than the file server in question here. Any help is appreciated. The irony is almost too much to bear. Backing up my data is what is jeopardizing it.

    Read the article

  • How Do I get the current instance from an AppDomain?

    - by Spanners
    Hi, I use the default appdomain (AD) which I use to create new appdomains (AD1) when required for running plugins in isolation. When creating the new domain I also wire up the AppDomainUnload event to allow me to call clean up code etc. The issue I seem to have is: 1) Create AD1 from AD 2) Run code in AD1 3) Call AD.Unload(AD1) The code switches to AD1 and calls the unloading event passing in a reference to the current AppDomain (AD1). At this point I'd like to get a reference to the current instance running in AD1 to call a shutdown method however there is no GetInstance on the AppDomain class. Any ideas how I can go about getting it?

    Read the article

  • Untrusted GPGPU code (OpenCL etc) - is it safe? What risks?

    - by Grzegorz Wierzowiecki
    There are many approaches when it goes about running untrusted code on typical CPU : sandboxes, fake-roots, virtualization... What about untrusted code for GPGPU (OpenCL,cuda or already compiled one) ? Assuming that memory on graphics card is cleared before running such third-party untrusted code, are there any security risks? What kind of risks? Any way to prevent them ? (Possible sandboxing on gpgpu or other technique?) P.S. I am more interested in gpu binary code level security rather than hight-level gpgpu programming language security (But those solutions are welcome as well). What I mean is that references to gpu opcodes (a.k.a machine code) are welcome.

    Read the article

  • Preferred Windows Java Development Environment

    - by JF
    I've been a Linux Java developer for years and have loved it. I just got a new laptop which is running Windows 7. I could wipe the drive and go back to my typical Linux dev setup: vim for editing, tabbed Bash windows running javac and java for smaller projects, ant for big projects That said, I'm really thinking it couldn't hurt to learn to develop in a new environment. So, with that in mind, are there any Windows-based Java devs out there? What setup do you like to use to get things done? It'd be interesting to hear both ways to emulate my Linux-based environment as well as completely different styles that I might benefit from trying.

    Read the article

  • setting a timeout for an InputStreamreader variable

    - by Noona
    I have a server running that accepts connections made through client sockets, I need to read the input from this client socket, now suppose the client opened a connection to my server without sending anything through the server's socket outputstream, in this case, while my server tried to read the input through the client socket's inputstream, an exception will be thrown, but before the exception is thrown i would like a timeout say of 5 sec, how can I do this? currently here's how my code looks like on the server side: try { InputStreamReader clientInputStream = new InputStreamReader(clientSocket.getInputStream()); int c; StringBuffer requestBuffer = new StringBuffer(); while ((c = clientInputStream.read()) != -1) { requestBuffer.append((char) c); if (requestBuffer.toString().endsWith(("\r\n\r\n"))) break; } request = new Request(requestBuffer.toString(), clientSocket); } catch (Exception e) // catch any possible exception in order to keep the thread running { try { if (clientSocket != null) clientSocket.close(); } catch (IOException ex) { ex.printStackTrace(); } System.err.println(e); //e.printStackTrace(); }

    Read the article

  • How can I get the type I want?

    - by Danny Chen
    There are a lot of such classes in my project (very old and stable code, I can't do many changes to them, maybe slight changes are OK) public class MyEntity { public long ID { get; set; } public string Name { get; set; } public decimal Salary { get; set; } public static GetMyEntity ( long ID ) { MyEntity e = new MyEntity(); // load data from DB and bind to this instance return e; } } For some reasons, now I need to do this: Type t = Type.GetType("XXX"); // XXX is one of the above classes' name MethodInfo staticM= t.GetMethods(BindingFlags.Public | BindingFlags.Static).FirstOrDefault();// I'm sure I can get the correct one var o = staticM.Invoke(...); //returns a object, but I want the type above! If I pass "MyEntity" at beginning, I hope I can get o as MyEntity! Please NOTE that I know the "name of the class" only. MyEntity e = staticM.Invoke(...) as MyEntity; can't be used here.

    Read the article

  • Identity.Name is disposed in a IIS7 Asp.NET MVC application Thread

    - by vIceBerg
    I have made the smallest demo project to illustrate my problem. You can download the sources Here Visual Studio 2008, .NET 3.5, IIS7, Windows 7 Ultimate 32 bits. The IIS Website is configured ONLY for Windows Authentication in an Integreated pipeline app pool (DefaultAppPool). Here's the problem. I have an Asp.NET MVC 2 application. In an action, I start a thread. The View returns. The thread is doing it's job... but it needs to access Thread.CurrentPrincipal.Identity.Name BANG The worker process of IIS7 stops. I have a window that says: "Visual Studio Just-In-Time Debugger An unhandled exception ('System.Object.DisposedException') occured in w3wp.exe [5524]" I checked with the debugger and the Thread.CurrentPrincipal.Identity is valid, but the Name property is disposed. If I put a long wait in the action before it returns the view, then the Thread can do it's job and the Identity.Name is not disposed. So I think the Name gets disposed when the view is returned. For the sake of the discussion, here's the code that the thread runs (but you can also download the demo project. The link is on top of this post): private void Run() { const int SECTOWAIT = 3; //wait SECTOWAIT seconds long end = DateTime.Now.Ticks + (TimeSpan.TicksPerSecond * SECTOWAIT); while (DateTime.Now.Ticks <= end) continue; //Check the currentprincipal. BANG!!!!!!!!!!!!! var userName = Thread.CurrentPrincipal.Identity.Name; } Here's the code that starts the thread public void Start() { Thread thread = new Thread(new ParameterizedThreadStart(ThreadProc)); thread.SetApartmentState(ApartmentState.MTA); thread.Name = "TestThread"; thread.Start(this); } static void ThreadProc(object o) { try { Builder builder = (Builder)o; builder.Run(); } catch (Exception ex) { throw; } } So... what am i doing wrong? Thanks

    Read the article

  • Using "wildcards" in a vlist array to delete rows in Excel

    - by KMinner
    Good Morning All, I'm trying to setup a vba macro to delete all user IDs out of a spreadsheet that do not start with designated prefixes (e.g. US, A1, VM, etc). The below block of code was found on the Code Library and looks to be what I need but there is one problem: When I enter in UserID prefixes into the vlist fields, it treats them as absolute rather then a part of the string that I want to keep. Is there a way to incorporate wildcards into a vlist? Sub Example1() Dim vList Dim lLastRow As Long, lCounter As Long Dim rngToCheck As Range, rngFound As Range, rngToDelete As Range Application.ScreenUpdating = False With Sheet1 lLastRow = Get_Last_Row(.Cells) If lLastRow > 1 Then vList = Array("US", "A1", "EG", "VM") 'we don't want to delete our header row With .Range("A2:A" & lLastRow) For lCounter = LBound(vList) To UBound(vList) Set rngFound = .Find( _ what:=vList(lCounter), _ lookat:=xlWhole, _ searchorder:=xlByRows, _ searchdirection:=xlNext, _ MatchCase:=True) 'check if we found a value we want to keep If rngFound Is Nothing Then 'there are no cells to keep with this value If rngToDelete Is Nothing Then Set rngToDelete = .Cells Else 'if there are no cells with a different value then 'we will get an error On Error Resume Next If rngToDelete Is Nothing Then Set rngToDelete = .ColumnDifferences(Comparison:=rngFound) Else Set rngToDelete = Intersect(rngToDelete, .ColumnDifferences(Comparison:=rngFound)) End If On Error GoTo 0 End If Next lCounter End With If Not rngToDelete Is Nothing Then rngToDelete.EntireRow.Delete End If End With Application.ScreenUpdating = True End Sub

    Read the article

  • Turn off depreciated errors php 5.3

    - by atwellpub
    Hello, My server is running php 5.3 and My wordpress install is spitting these errors out on me causing the my session_start() to break. Deprecated: Assigning the return value of new by reference is deprecated in /home//public_html/hub/wp-settings.php on line 647 Deprecated: Assigning the return value of new by reference is deprecated in /home//public_html/hub/wp-settings.php on line 662 Deprecated: Assigning the return value of new by reference is deprecated in /home//public_html/hub/wp-settings.php on line 669 Deprecated: Assigning the return value of new by reference is deprecated in /home//public_html/hub/wp-settings.php on line 676 Deprecated: Assigning the return value of new by reference is deprecated in /home//public_html/hub/wp-settings.php on line 712 This is annoying, but I do not want to turn off on screen error reporting. How do I disable these bothersome depreciated warnings? Running Wordpress 2.9.2. Gracious!

    Read the article

  • Android: onListItemClick not opening up the .xml file

    - by Capsud
    Hi, public void onListItemClick(ListView l, View v, int position, long id) { if(position == 0){ setContentView(R.layout.cuisine); } } I have an array of Strings and i'm using the above method to try and open up a new xml file called 'cuisine' when it is clicked. but it keeps failing! Have I done this right, or what am I doing wrong? Thanks. Ok from looking at similar problems on the web, people have said to get the onListItemClick() to start a new activity and using that new activity to then open up the new view? So what i've done is this... protected void onListItemClick(ListView l, View v, int position, long id) { Intent dundrumIntent = new Intent(v.getContext(), DundrumSelector.class); dundrumIntent.putExtra("position", position); startActivityForResult(dundrumIntent, 0); } and then import android.app.Activity; import android.os.Bundle; public class DundrumSelector extends Activity { @Override public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); int position = getIntent().getExtras().getInt("position"); if(position == 0){ setContentView(R.layout.cuisine); } } } Yet i'm still getting the same problem. The program crashes when I click on an item in the listView. And yes i've added the activity to the manifest. Does anyone have a resolution to this as alot of people seem to be having the same problem. Thanks alot.

    Read the article

  • array of structures, or structure of arrays?

    - by Jason S
    Hmmm. I have a table which is an array of structures I need to store in Java. The naive don't-worry-about-memory approach says do this: public class Record { final private int field1; final private int field2; final private long field3; /* constructor & accessors here */ } List<Record> records = new ArrayList<Record>(); If I end up using a large number ( 106 ) of records, where individual records are accessed occasionally, one at a time, how would I figure out how the preceding approach (an ArrayList) would compare with an optimized approach for storage costs: public class OptimizedRecordStore { final private int[] field1; final private int[] field2; final private long[] field3; Record getRecord(int i) { return new Record(field1[i],field2[i],field3[i]); } /* constructor and other accessors & methods */ } edit: assume the # of records is something that is changed infrequently or never I'm probably not going to use the OptimizedRecordStore approach, but I want to understand the storage cost issue so I can make that decision with confidence. obviously if I add/change the # of records in the OptimizedRecordStore approach above, I either have to replace the whole object with a new one, or remove the "final" keyword. kd304 brings up a good point that was in the back of my mind. In other situations similar to this, I need column access on the records, e.g. if field1 and field2 are "time" and "position", and it's important for me to get those values as an array for use with MATLAB, so I can graph/analyze them efficiently.

    Read the article

  • DNS Lookup in simple C#/asp.net ajax call is extremely slow

    - by Ryan
    I'm running this out of the VS 2008 debugger on Windows 7, running .Net 3.5. The idea was to make all ajax requests with jQuery only, rather than .net, following some tutorials online. Default.aspx - HTML page, jquery triggers method in Default.aspx.cs http://pastebin.com/pxBvKA2H Default.aspx.cs - C# Webform, just defines a GetDate fuction, which only returns a string for now (trying to eliminate any possible issues) (can only post one hyperlink...) pastebin.com/pnHn50hu The ajax query takes longer than it should. Profiling with firebug revealed that it took 1.03 ms. 1s DNS Lookup | 26ms Waiting | 1ms Receiving EDIT: It continues to take the same set of times if you continue to click and resubmit the request. Is there anything I can do to cut down on the DNS Lookup time / what did I do wrong? Thanks for any help.

    Read the article

  • setting up a private network using linksys router

    - by user287745
    scenerio:- a database server running sql server 2005 and sql server management studio 2005 express editions a web server running IIS 5.0v using windows xp pro. two other computer having windows xp and windows 98 i have a linksys router which i use to access point for wireless (laptop) there are 5 sockets behind it four for clients and one for internet. i would like to setup a LAN- something like a private hosting area with two clients. would should i do? where to connect what and what would the changes in settnigs be. right now it uses dhcp or something to assign ips. where will the webserver be attached to the internet socket? where will the db server be attached? any guide, links, help thank you

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • MySQL PHP incompatibility.

    - by Evernoob
    Ok maybe I've overlooked something really simple here, but I can't seem to figure this out. I'm running WAMP locally, but connecting to a remote MySQL database. The local version of PHP is the latest 5.3.0. One of the remote databases, being version 5.0.45 works fine. However, the other remote database I'm trying to connect to, which is version 5.0.22 throws the following error before dying: Warning: mysql_connect() [function.mysql-connect]: OK packet 6 bytes shorter than expected. PID=5880 in ... Warning: mysql_connect() [function.mysql-connect]: mysqlnd cannot connect to MySQL 4.1+ using old authentication in ... WTF? UPDATE: Reverting to PHP 5.2.* i.e. anything lower than 5.3.0 resolves the problem completely. As long as I am not running 5.3.0 I can connect to both databases. I'm not sure what the explanation is for this weirdness.

    Read the article

  • java jdbc connection to mysql problem

    - by fatnjazzy
    Hi, I am trying to connect to mysql from java web application in eclipse. Connection con = null; try { //DriverManager.registerDriver(new com.mysql.jdbc.Driver()); Class.forName("com.mysql.jdbc.Driver"); con = DriverManager.getConnection("jdbc:mysql://localhost/db_name","root" ,""); if(!con.isClosed()) System.out.println("Successfully connected to " + "MySQL server using TCP/IP..."); } catch(Exception e) { System.err.println("Exception: " + e.getMessage()); } finally { try { if(con != null) con.close(); } catch(SQLException e) { System.out.println(e.toString()); } } I am always getting the Exception: com.mysql.jdbc.Driver I have downloaded this jar http://forums.mysql.com/read.php?39,218287,220327 import it to the "java build path/lib" the mysql version is 5.1.3 under. running: mysql 5.1.3 (db is up and running queries form PHP) windows XP java jee Thanks

    Read the article

  • How Can I Find a List of All Exceptions That a Given Library Function Throws in Python?

    - by b14ck
    Sorry for the long title, but it seems most descriptive for my question. Basically, I'm having a difficult time finding exception information in the official python documentation. For example, in one program I'm currently writing, I'm using the shutil libary's move function: from shutil import move move('somefile.txt', '/tmp/somefile.txt') That works fine, as long as I have write access to /tmp/, there is enough diskspace, and if all other requirements are satisfied. However, when writing generic code, it is often difficult to guarantee those factors, so one usually uses exceptions: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except: print 'Move failed for some reason.' I'd like to actually catch the appropriate exceptions thrown instead of just catching everything, but I simply can't find a list of exceptions thrown for most python modules. Is there a way for me to see which exceptions a given function can throw, and why? This way I can make appropriate cases for each exception, eg: from shutil import move try: move('somefile.txt', '/tmp/somefile.txt') except PermissionDenied: print 'No permission.' except DestinationDoesNotExist: print "/tmp/ doesn't exist" except NoDiskSpace: print 'No diskspace available.' Answer points go to whoever can either link me to some relevant documentation that I've somehow overlooked in the official docs, or provide a sure-fire way to figure out exactly which exceptions are thrown by which functions, and why. Thanks!

    Read the article

< Previous Page | 451 452 453 454 455 456 457 458 459 460 461 462  | Next Page >