Search Results

Search found 13788 results on 552 pages for 'instance caging'.

Page 462/552 | < Previous Page | 458 459 460 461 462 463 464 465 466 467 468 469  | Next Page >

  • ASP.NET MVC (VB) error when publishing to test server

    - by Colin
    I have an ASP.NET MVC project that works fine on my local machine (no build errors, server errors or anything). However, when I publish the project to a test server, I get an "Object reference not set to an instance of an object" error on a For Each I have in my view. I have a function within a model that returns a DataRowCollection. I'm calling that function in my controller and passing the DataRowCollection to my View, which then iterates over the rows and displays the necessary information: In the Controller I have: Function Index() As ActionResult Dim MyModel As New Model ViewData("MyDataRowCollection") = MyModel.GetDataRowCollection() Return View() End Function And then in the View, which is throwing the error: <%@ Page Language="VB" MasterPageFile="~/Views/Shared/Site.Master" Inherits="System.Web.Mvc.ViewPage" %> <asp:Content ID="indexTitle" ContentPlaceHolderID="TitleContent" runat="server"> My Page Title </asp:Content> <asp:Content ID="indexContent" ContentPlaceHolderID="MainContent" runat="server"> <% For Each MyDataRow In ViewData("MyDataRowCollection") ' do stuff with each MyDataRow Next %> I'm pretty new to ASP.NET MVC so I'm sure there might be a better way to do what I'm doing (I'd be happy to hear if there is), but my main concern is why this works fine on my local machine but throws an error on the For Each on the test server? Please let me know if I can clarify any of the above, and thanks in advance for any information.

    Read the article

  • Adding li element only if it not already there?

    - by Legend
    I am constructing an <li> element like this: var element = $("<li></li>") .html(mHTML) .attr('id', "elemid"); I am trying to add this element to a <ul> element only if it doesn't already exist. Any ideas on how to do this? Am I supposed to use contains() to see if the ul element contain the html and then decide? For instance, <ul id="elemul"> <li id="elemli1">Element 1</li> <li id="elemli2">Element 2</li> <li id="elemli3">Element 3</li> </ul> If I try adding Element 1, it should not add it. What should I do if its a longer string (not really long but about 150 characters). Note: I cannot rely on IDs to determine the uniqueness. i.e. I might end up forming something like: <li id="elemli3">Element 1</li> Do I go about using hashmaps?

    Read the article

  • Method having an abstract class as a parameter

    - by Ferhat
    I have an abstract class A, where I have derived the classes B and C. Class A provides an abstract method DoJOB(), which is implemented by both derived classes. There is a class X which has methods inside, which need to call DoJOB(). The class X may not contain any code like B.DoJOB() or C.DoJOB(). Example: public class X { private A foo; public X(A concrete) { foo = concrete; } public FunnyMethod() { foo.DoJOB(); } } While instantiating class X I want to decide which derived class (B or C) must be used. I thought about passing an instance of B or C using the constructor of X. X kewl = new X(new C()); kewl.FunnyMethod(); //calls C.DoJOB() kewl = new X(new B()); kewl.FunnyMethod(); // calls B.DoJOB() My test showed that declaring a method with a parameter A is not working. Am I missing something? How can I implement this correctly? (A is abstract, it cannot be instantiated)

    Read the article

  • transmit a java.lang.reflect.Proxy over a network

    - by panzi
    Is there a convenient way to transmit an object including its code (the class) over a network (not just the instance data)? Don't ask me why I want to do this. It's in an assignment. I asked several times if that is really what they meant and the didn't rephrase their answer so I guess they really want us to transmit code (not just the field data) over a network. To be honest I have no clue why we need a Proxy in this assignment anyway, just writing a simple class would do IMO. The assignment says that we should instantiate the proxy on the server and transmit it to the client (and yes, they talk about a java.lang.reflect.Proxy, they name this class). Because there is no class file for a proxy I can't deploy that. I guess I would have to somehow read out the bytecode of the generated Proxy, transmit it to the client and then load it. Which makes absolutely no sense at all, but this seems what they want us to do. I don't get why.

    Read the article

  • Search field using Ultraseek

    - by tony noriega
    So i realized today that using IE to do a search on my site, for instance the term "documents" returns the search results. if i use FireFox or Chrome the data in the input field is not recognized... now i looked at the code, and realized that there are no tags around the input fields... BUT if i put them, then IE does not work... what the heck do i do? <div class="searchbox" id="searchbox"> <script type="text/ecmascript"> function RunSearch() { window.location = "http://searcher.example.com:8765/query.html?ql=&amp;col=web1&amp;qt=" + document.getElementById("search").value; } </script> <div class="formSrchr"> <input type="text" size="20" name="qt" id="search" /> <input type="hidden" name="qlOld" id="qlOld" value="" /> <input type="hidden" name="colOld" id="colOld value="web1" /> <input type="image" name="imageField" src="/_images/search-mag.gif" width="20" height="20" onclick="RunSearch();" /> </div> </div> <!-- /searchbox -->

    Read the article

  • What should I do with an over-bloated select-box/drop-down

    - by Tristan Havelick
    All web developers run into this problem when the amount of data in their project grows, and I have yet to see a definitive, intuitive best practice for solving it. When you start a project, you often create forms with tags to help pick related objects for one-to-many relationships. For instance, I might have a system with Neighbors and each Neighbor belongs to a Neighborhood. In version 1 of the application I create an edit user form that has a drop down for selecting users, that simply lists the 5 possible neighborhoods in my geographically limited application. In the beginning, this works great. So long as I have maybe 100 records or less, my select box will load quickly, and be fairly easy to use. However, lets say my application takes off and goes national. Instead of 5 neighborhoods I have 10,000. Suddenly my little drop-down takes forever to load, and once it loads, its hard to find your neighborhood in the massive alphabetically sorted list. Now, in this particular situation, having hierarchical data, and letting users drill down using several dynamically generated drop downs would probably work okay. However, what is the best solution when the objects/records being selected are not hierarchical in nature? In the past, of done this with a popup with a search box, and a list, but this seems clunky and dated. In today's web 2.0 world, what is a good way to find one object amongst many for ones forms? I've considered using an Ajaxifed search box, but this seems to work best for free text, and falls apart a little when the data to be saved is just a reference to another object or record. Feel free to cite specific libraries with generic solutions to this problem, or simply share what you have done in your projects in a more general way

    Read the article

  • Storing a jpa entity where only the timestamp changes results in updates rather than inserts (desire

    - by David Schlenk
    I have a JPA entity that stores a fk id, a boolean and a timestamp: @Entity public class ChannelInUse implements Serializable { @Id @GeneratedValue private Long id; @ManyToOne @JoinColumn(nullable = false) private Channel channel; private boolean inUse = false; @Temporal(TemporalType.TIMESTAMP) private Date inUseAt = new Date(); ... } I want every new instance of this entity to result in a new row in the table. For whatever reason no matter what I do it always results in the row getting updated with a new timestamp value rather than creating a new row. Even tried to just use a native query to run an insert but channel's ID wasn't populated yet so I gave up on that. I've tried using an embedded id class consisting of channel.getId and inUseAt. My equals and hashcode for are: public boolean equals(Object obj){ if(this == obj) return true; if(!(obj instanceof ChannelInUse)) return false; ChannelInUse ciu = (ChannelInUse) obj; return ( (this.inUseAt == null ? ciu.inUseAt == null : this.inUseAt.equals(ciu.inUseAt)) && (this.inUse == ciu.inUse) && (this.channel == null ? ciu.channel == null : this.channel.equals(ciu.channel)) ); } /** * hashcode generated from at, channel and inUse properties. */ public int hashCode(){ int hash = 1; hash = hash * 31 + (this.inUseAt == null ? 0 : this.inUseAt.hashCode()); hash = hash * 31 + (this.channel == null ? 0 : this.channel.hashCode()); if(inUse) hash = hash * 31 + 1; else hash = hash * 31 + 0; return hash; } } I've tried using hibernate's Entity annotation with mutable=false. I'm probably just not understanding what makes an entity unique or something. Hit the google pretty hard but can't figure this one out.

    Read the article

  • Threshold of blurry image - part 2

    - by 1''
    How can I threshold this blurry image to make the digits as clear as possible? In a previous post, I tried adaptively thresholding a blurry image (left), which resulted in distorted and disconnected digits (right): Since then, I've tried using a morphological closing operation as described in this post to make the brightness of the image uniform: If I adaptively threshold this image, I don't get significantly better results. However, because the brightness is approximately uniform, I can now use an ordinary threshold: This is a lot better than before, but I have two problems: I had to manually choose the threshold value. Although the closing operation results in uniform brightness, the level of brightness might be different for other images. Different parts of the image would do better with slight variations in the threshold level. For instance, the 9 and 7 in the top left come out partially faded and should have a lower threshold, while some of the 6s have fused into 8s and should have a higher threshold. I thought that going back to an adaptive threshold, but with a very large block size (1/9th of the image) would solve both problems. Instead, I end up with a weird "halo effect" where the centre of the image is a lot brighter, but the edges are about the same as the normally-thresholded image: Edit: remi suggested morphologically opening the thresholded image at the top right of this post. This doesn't work too well. Using elliptical kernels, only a 3x3 is small enough to avoid obliterating the image entirely, and even then there are significant breakages in the digits:

    Read the article

  • CREATE VIEW called multiple times not creating all views

    - by theninepoundhammer
    Noticing strange behavior in SQL 2005, both Express and Enterprise Edition: In my code I need to loop through a series of values (about five in a row), and for each value, I need to insert the value into a table and dynamically create a new view using that value as part of the where clause and the name of the view. The code runs pretty quickly, but what I'm noticing is that all the values are inserted into the table correctly but only the LAST view is being created. Every time. For example, if the values I'm using are X1, X2, X3, X4, and X5, I'll run the process, open up Mgmt Studio, and see five rows in the table with the correct five values, but only one view named MyView_x5 that has the correct WHERE clause. At first, I had this loop in an SSIS package as part of a larger data flow. When I started noticing this behavior, I created a stored proc that would create the CREATE VIEW statement dynamically after the insert and called EXECUTE to create the view. Same result. Finally, I created some C# code using the Enterprise Library DAAB, and did the insert and CREATE VIEW statements from my DLL. Same result every time. Most recently, I turned on Profiler while running against the Enterprise Edition and was able to verify that the Batch Started and Batch Completed events were being fired off for each instance of the view. However, like I said, only the last view is actually being created. Does anyone have any idea why this might be happening? Or any suggestions about what else to check or profile? I've profiled for error messages, exceptions, etc. but don't see any in my trace file. My express edition is 9.00.1399.06. Not sure about the Enterprise edition but think it is SP2.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • JQuery Delegate and using traveral options in function

    - by Brian
    I am having trouble figuring out how to use the JQuery delegate function to do what I require. Basically, I need to allow users to add Panels (i.e. divs) to a form dynamically by selecting a button. Then when a user clicks a button within a given Panel, I want to be able to to something to that Panel (like change the color in this example). Unfortunately, it seems that references to the JQuery traversing functions don't work in this instance. Can anybody explain how to achieve this effect? Is there anyway to bind a different delegate to the each panel as its added. $('.addPanels').delegate('*', 'click', function() { $(this).parent.css('background-color', 'black'); $('.placeholder').append('Add item'); }); <div class="addPanels"> <div class="panel"> <a href="#" class="addLink">Add item</a> text</div> <div class="placeholder"/> </div> </div>

    Read the article

  • MapView EXC_BAD_ACCESS (SIGSEGV) and KERN_INVALID_ADDRESS

    - by user768113
    I'm having some 'issues' with my application... well, it crashes in an UIViewController that is presented modally, there the user enters information through UITextFields and his location is tracked by a MapView. Lets call this view controller "MapViewController" When the user submits the form, I call a different ViewController - modally again - that processes this info and a third one answers accordingly, then go back to a MenuVC using unwinding segues, which then calls MapViewController and so on. This sequence is repeated many times, but it always crashes in MapViewController. Looking at the crash log, I think that the MapView can be the problem of this or some element in the UI (because of the UIKit framework). I tried to use NSZombie in order to track a memory issue but it doesn't give me a clue about whats happening. Here is the crash log Hardware Model: iPad3,4 Process: MyApp [2253] OS Version: iOS 6.1.3 (10B329) Report Version: 104 Exception Type: EXC_BAD_ACCESS (SIGSEGV) Exception Codes: KERN_INVALID_ADDRESS at 0x00000044 Crashed Thread: 0 Thread 0 name: Dispatch queue: com.apple.main-thread Thread 0 Crashed: 0 IMGSGX554GLDriver 0x328b9be0 0x328ac000 + 56288 1 IMGSGX554GLDriver 0x328b9b8e 0x328ac000 + 56206deallocated instance 2 IMGSGX554GLDriver 0x328bc2f2 0x328ac000 + 66290 3 IMGSGX554GLDriver 0x328baf44 0x328ac000 + 61252 4 libGPUSupportMercury.dylib 0x370f86be 0x370f6000 + 9918 5 GLEngine 0x34ce8bd2 0x34c4f000 + 629714 6 GLEngine 0x34cea30e 0x34c4f000 + 635662 7 GLEngine 0x34c8498e 0x34c4f000 + 219534 8 GLEngine 0x34c81394 0x34c4f000 + 205716 9 VectorKit 0x3957f4de 0x394c7000 + 754910 10 VectorKit 0x3955552e 0x394c7000 + 582958 11 VectorKit 0x394d056e 0x394c7000 + 38254 12 VectorKit 0x394d0416 0x394c7000 + 37910 13 VectorKit 0x394cb7ca 0x394c7000 + 18378 14 VectorKit 0x394c9804 0x394c7000 + 10244 15 VectorKit 0x394c86a2 0x394c7000 + 5794 16 QuartzCore 0x354a07a4 0x35466000 + 239524 17 QuartzCore 0x354a06fc 0x35466000 + 239356 18 IOMobileFramebuffer 0x376f8fd4 0x376f4000 + 20436 19 IOKit 0x344935aa 0x34490000 + 13738 20 CoreFoundation 0x33875888 0x337e9000 + 575624 21 CoreFoundation 0x338803e4 0x337e9000 + 619492 22 CoreFoundation 0x33880386 0x337e9000 + 619398 23 CoreFoundation 0x3387f20a 0x337e9000 + 614922 24 CoreFoundation 0x337f2238 0x337e9000 + 37432 25 CoreFoundation 0x337f20c4 0x337e9000 + 37060 26 GraphicsServices 0x373ad336 0x373a8000 + 21302 27 UIKit 0x3570e2b4 0x356b7000 + 357044 28 MyApp 0x000ea12e 0xe9000 + 4398 29 MyApp 0x000ea0e4 0xe9000 + 4324 I think thats all, additionally, I would like to ask you: if you are using unwind segues then you are releasing view controllers from the memory heap, right? Meanwhile, performing segues let you instantiate those controllers. Technically, MenuVC should be the only VC alive in the heap during the app life cycle if you understand me.

    Read the article

  • Silverlight Binding - Binds when item is added but doesn't get updates.

    - by dw
    Hello, I'm sorta at a loss to why this doesn't work considering I got it from working code, just added a new level of code, but here's what I have. Basically, when I bind the ViewModel to a list, the binding picks up when Items are added to a collection. However, if an update occurs to the item that is bound, it doesn't get updated. Basically, I have an ObservableCollection that contains a custom class with a string value. When that string value gets updated I need it to update the List. Right now, when I debug, the list item does get updated correctly, but the UI doesn't reflect the change. If I set the bound item to a member variable and null it out then reset it to the right collection it will work, but not desired behavior. Here is a mockup of the code, hopefully someone can tell me where I am wrong. Also, I've tried implementing INofityPropertyChanged at every level in the code below. public class Class1 { public string ItemName; } public class Class2 { private Class2 _items; private Class2() //Singleton { _items = new ObservableCollection<Class1>(); } public ObservableCollection<Class1> Items { get { return _items; } internal set { _items = value; } } } public class Class3 { private Class2 _Class2Instnace; private Class3() { _Class2Instnace = Class2.Instance; } public ObservableCollection<Class1> Items2 { get {return _Class2Instnace.Items; } } } public class MyViewModel : INofityPropertyChanged { private Class3 _myClass3; private MyViewModel() { _myClass3 = new Class3(); } private BindingItems { get { return _myClass3.Items2; } // Binds when adding items but not when a Class1.ItemName gets updated. } }

    Read the article

  • pulling a value from NSMutableDictionary

    - by Jared Gross
    I have a dictionary array with a key:@"titleLabel". I am trying to load a pickerView with ONE instance of each @"titleLabel" key so that if there are multiple objects with the same @"titleLabel" only one title will be displayed. I've done some research on this forum and looked at apples docs but haven't been able to put the puzzle together. Below is my code but I am having trouble pulling the values. Right now when I run this code it throws an error Incompatible pointer types sending 'PFObject *' to parameter of type 'NSString' which i understand but am just not sure how to remedy. Cheers! else { // found messages! self.objectsArray = objects; NSMutableDictionary *dict = [[NSMutableDictionary alloc] init]; for(id obj in self.objectsArray){ PFObject *key = [self.objectsArray valueForKey:@"titleLabel"]; if(![dict objectForKey:@"titleLabel"]){ [dict setValue:obj forKey:key]; } } for (id key in dict) { NSLog(@"Objects array is %d", [self.objectsArray count]); NSLog(@"key: %@, value: %@ \n", key, [dict objectForKey:key]); } [self.pickerView reloadComponent:0]; } }];` Here is where I define the PFObject and keys: PFObject *image = [PFObject objectWithClassName:@"Images"]; [image setObject:file forKey:@"file"]; [image setObject:fileType forKey:@"fileType"]; [image setObject:title forKey:@"titleLabel"]; [image setObject:self.recipients forKey:@"recipientIds"]; [image setObject:[[PFUser currentUser] objectId] forKey:@"senderId"]; [image setObject:[[PFUser currentUser] username] forKey:@"senderName"]; [image saveInBackground];

    Read the article

  • Java: Tracking a user login session - Session EJBs vs HTTPSession

    - by bguiz
    If I want to keep track of a conversational state with each client using my web application, which is the better alternative - a Session Bean or a HTTP Session - to use? Using HTTP Session: //request is a variable of the class javax.servlet.http.HttpServletRequest //UserState is a POJO HttpSession session = request.getSession(true); UserState state = (UserState)(session.getAttribute("UserState")); if (state == null) { //create default value .. } String uid = state.getUID(); //now do things with the user id Using Session EJB: In the implementation of ServletContextListener registered as a Web Application Listener in WEB-INF/web.xml: //UserState NOT a POJO this this time, it is //the interface of the UserStateBean Stateful Session EJB @EJB private UserState userStateBean; public void contextInitialized(ServletContextEvent sce) { ServletContext servletContext = sce.getServletContext(); servletContext.setAttribute("UserState", userStateBean); ... In a JSP: public void jspInit() { UserState state = (UserState)(getServletContext().getAttribute("UserState")); ... } Elsewhere in the body of the same JSP: String uid = state.getUID(); //now do things with the user id It seems to me that the they are almost the same, with the main difference being that the UserState instance is being transported in the HttpRequest.HttpSession in the former, and in a ServletContext in the case of the latter. Which of the two methods is more robust, and why?

    Read the article

  • Linq to SQL duplicating entry when referencing FK

    - by Oscar
    Hi! I am still facing some problems when using LINQ-to-SQL. I am also looking for answers by myself, but this problem is so akward that I am having problems to find the right keywords to look for it. I have this code here: public CustomTask SaveTask(string token, CustomTask task) { TrackingDataContext dataConext = new TrackingDataContext(); //Check the token for security if (SessionTokenBase.Instance.ExistsToken(Convert.ToInt32(token)) == null) return null; //Populates the Task - the "real" Linq to SQL object Task t = new Task(); t.Title = task.Title; t.Description = task.Description; //****The next 4 lines are important**** if (task.Severity != null) t.Severity = task.Severity; else t.SeverityID = task.SeverityID; t.StateID = task.StateID; if (task.TeamMember != null) t.TeamMember = task.TeamMember; else t.ReporterID = task.ReporterID; if (task.ReporterTeam != null) t.Team = task.ReporterTeam; else t.ReporterTeamID = task.ReporterTeamID; //Saves/Updates the task dataConext.Tasks.InsertOnSubmit(t); dataConext.SubmitChanges(); task.ID = t.ID; return task; } The problem is that I am sending the ID of the severity, and then, when I get this situation: DB State before calling the method: ID Name 1 high 2 medium 3 low Call the method selecting "medium" as severity DB State after calling the method: ID Name 1 high 2 medium 3 low 4 medium The point is: -It identified that the ID was related to the Medium entry (and for this reason it could populate the "Name" Column correctly), but if duplicated this entry. The problem is: Why?!! Some explanation about the code: CustomTask is almost the same as Task, but I was having problems regarding serialization as can be seen here I don't want to send the Severity property populated because I want my message to be as small as possible. Could anyone clear to my, why it recognize the entry, but creates a new entry in the DB?

    Read the article

  • Invoking a method overloaded where all arguments implement the same interface

    - by double07
    Hello, My starting point is the following: - I have a method, transform, which I overloaded to behave differently depending on the type of arguments that are passed in (see transform(A a1, A a2) and transform(A a1, B b) in my example below) - All these arguments implement the same interface, X I would like to apply that transform method on various objects all implementing the X interface. What I came up with was to implement transform(X x1, X x2), which checks for the instance of each object before applying the relevant variant of my transform. Though it works, the code seems ugly and I am also concerned of the performance overhead for evaluating these various instanceof and casting. Is that transform the best I can do in Java or is there a more elegant and/or efficient way of achieving the same behavior? Below is a trivial, working example printing out BA. I am looking for examples on how to improve that code. In my real code, I have naturally more implementations of 'transform' and none are trivial like below. public class A implements X { } public class B implements X { } interface X { } public A transform(A a1, A a2) { System.out.print("A"); return a2; } public A transform(A a1, B b) { System.out.print("B"); return a1; } // Isn't there something better than the code below??? public X transform(X x1, X x2) { if ((x1 instanceof A) && (x2 instanceof A)) { return transform((A) x1, (A) x2); } else if ((x1 instanceof A) && (x2 instanceof B)) { return transform((A) x1, (B) x2); } else { throw new RuntimeException("Transform not implemented for " + x1.getClass() + "," + x2.getClass()); } } @Test public void trivial() { X x1 = new A(); X x2 = new B(); X result = transform(x1, x2); transform(x1, result); }

    Read the article

  • Javascript private member on prototype...

    - by Wilq32
    Well I tried to figure out is this possible in any way. Here is code: a=function(text) { var b=text; if (!arguments.callee.prototype.get) arguments.callee.prototype.get=function() { return b; } else alert('already created!'); } var c=new a("test"); // creates prototype instance of getter var d=new a("ojoj"); // alerts already created alert(c.get()) // alerts test alert(d.get()) // alerts test from context of creating prototype function :( As you see I tried to create prototype getter. For what? Well if you write something like this: a=function(text) { var b=text; this.getText=function(){ return b} } ... everything should be fine.. but in fact every time I create object - i create getText function that uses memory. I would like to have one prototypical function lying in memory that would do the same... Any ideas? EDIT: I tried solution given by Christoph, and it seems that its only known solution for now. It need to remember id information to retrieve value from context, but whole idea is nice for me :) Id is only one thing to remember, everything else can be stored once in memory. In fact you could store a lot of private members this way, and use anytime only one id. Actually this is satisfying me :) (unless someone got better idea). someFunc = function() { var store = new Array(); var guid=0; var someFunc = function(text) { this.__guid=guid; store[guid++]=text; } someFunc.prototype.getValue=function() { return store[this.__guid]; } return someFunc; }() a=new someFunc("test"); b=new someFunc("test2"); alert(a.getValue()); alert(b.getValue());

    Read the article

  • Remote connection to SQL Server Express fails

    - by worlds-apart89
    I have two computers that share the same Internet IP address. Using one of the computers, I can remotely connect to a SQL Server database on the other. Here is my connection string: SqlConnection connection = new SqlConnection(@"Data Source=192.168.1.101\SQLEXPRESSNI,1433;Network Library=DBMSSOCN;Initial Catalog=FirstDB;Persist Security Info=True;User ID=username;Password=password;"); 192.168.1.101 is the server, SQLEXPRESSNI is the SQL Server instance name, and FirstDB is the name of the database. Now, I have another computer with a different Internet IP address. I want to connect to the server above using the third computer that does not belong to my local area network. I dont have access to that third computer at the moment, so I want to use (if possible) the client computer in LAN again. SqlConnection connection = new SqlConnection(@"Data Source=SharedInternetIP\SQLEXPRESSNI,1433;Network Library=DBMSSOCN;Initial Catalog=FirstDB;Persist Security Info=True;User ID=username;Password=password;"); Does not work Note that I am a beginner, so I am not quite sure what I am doing even though I know what I want to do. By passing the Internet IP to the SqlConnection object rather than the local IP address, how can I successfully connect to the server computer, using the client computer in the same network? Also note that my ultimate goal is to connect to the server with an external client, but I don't have access to that computer right now. I'd appreciate any help.

    Read the article

  • Django ManyToMany Membership errors making associations

    - by jmitchel3
    I'm trying to have a "member admin" in which they have hundreds of members in the group. These members can be in several groups. Admins can remove access for the member ideally in the view. I'm having trouble just creating the group. I used a ManytoManyField to get started. Ideally, the "member admin" would be able to either select existing Users OR it would be able to Add/Invite new ones via email address. Here's what I have: #views.py def membership(request): group = Group.objects.all().filter(user=request.user) GroupFormSet = modelformset_factory(Group, form=MembershipForm) if request.method == 'POST': formset = GroupFormSet(request.POST, request.FILES, queryset=group) if formset.is_valid(): formset.save(commit=False) for form in formset: form.instance.user = request.user formset.save() return render_to_response('formset.html', locals(), context_instance=RequestContext(request)) else: formset= GroupFormSet(queryset=group) return render_to_response('formset.html', locals(), context_instance=RequestContext(request)) #models.py class Group(models.Model): name = models.CharField(max_length=128) members = models.ManyToManyField(User, related_name='community_members', through='Membership') user = models.ForeignKey(User, related_name='community_creator', null=True) def __unicode__(self): return self.name class Membership(models.Model): member = models.ForeignKey(User, related_name='user_membership', blank=True, null=True) group = models.ForeignKey(Group, related_name='community_membership', blank=True, null=True) date_joined = models.DateField(auto_now=True, blank=True, null=True) class Meta: unique_together = ('member', 'group') Any ideas? Thank you for your help.

    Read the article

  • Perl regex which grabs ALL double letter occurances in a line

    - by phileas fogg
    Hi all, still plugging away at teaching myself Perl. I'm trying to write some code that will count the lines of a file that contain double letters and then place parentheses around those double letters. Now what I've come up with will find the first ocurrance of double letters, but not any other ones. For instance, if the line is: Amp, James Watt, Bob Transformer, etc. These pioneers conducted many My code will render this: 19 Amp, James Wa(tt), Bob Transformer, etc. These pioneers conducted many The "19" is the count (of lines containing double letters) and it gets the "tt" of "Watt" but misses the "ee" in "pioneers". Below is my code: $file = '/path/to/file/electricity.txt'; open(FH, $file) || die "Cannot open the file\n"; my $counter=0; while (<FH>) { chomp(); if (/(\w)\1/) { $counter += 1; s/$&/\($&\)/g; print "\n\n$counter $_\n\n"; } else { print "$_\n"; } } close(FH); What am I overlooking? TIA!

    Read the article

  • In what order should the Python concepts be explained to absolute beginners?

    - by Tomaž Pisanski
    I am teaching Python to undergraduate math majors. I am interested in the optimal order in which students should be introduced to various Python concepts. In my view, at each stage the students should be able to solve a non-trivial programming problem using only the tools available at that time. Each new tool should enable a simpler solution to a familiar problem. A selection of numerous concepts available in Python is essential in order to keep students focused. They should also motivated and should appreciate each newly mastered tool without too much memorization. Here are some specific questions: For instance, my predecessor introduced lists before strings. I think the opposite is a better solution. Should function definitions be introduced at the very beginning or after mastering basic structured programming ideas, such as decisions (if) and loops (while)? Should sets be introduced before dictionaries? Is it better to introduce reading and writing files early in the course or should one use input and print for most of the course? Any suggestions with explanations are most welcome.

    Read the article

  • WPF ObservableCollection in xaml

    - by Cloverness
    Hi, I have created an ObservableCollection in the code behind of a user control. It is created when the window loads: private void UserControl_Loaded(object sender, RoutedEventArgs e) { Entities db = new Entities(); ObservableCollection<Image> _imageCollection = new ObservableCollection<Image>(); IEnumerable<library> libraryQuery = from c in db.ElectricalLibraries select c; foreach (ElectricalLibrary c in libraryQuery) { Image finalImage = new Image(); finalImage.Width = 80; BitmapImage logo = new BitmapImage(); logo.BeginInit(); logo.UriSource = new Uri(c.url); logo.EndInit(); finalImage.Source = logo; _imageCollection.Add(finalImage); } } I need to get the ObservableCollection of images which are created based on the url saved in a database. But I need a ListView or other ItemsControl to bind to it in XAML file like this: But I can't figure it out how to pass the ObservableCollection to the ItemsSource of that control. I tried to create a class and then create an instance of a class in xaml file but it did not work. Should I create a static resource somehow Any help will be greatly appreciated.

    Read the article

  • objective-c having issues with an NSDictioary object

    - by Mark
    I have a simple iPhone app that Im learning and I want to have an instance variable called urlLists which is an NSDictionary I have declared it like so: @interface MyViewController : UIViewController <UIPickerViewDataSource, UIPickerViewDelegate>{ IBOutlet UIPickerView *pickerView; NSMutableArray *categories; NSDictionary *urlLists; } @property(retain) NSDictionary *urlLists; @end and in the implementation: @implementation MyViewController @synthesize urlLists; ... - (void)viewDidLoad { [super viewDidLoad]; categories = [[NSMutableArray alloc] init]; [categories addObject:@"Sport"]; [categories addObject:@"Entertainment"]; [categories addObject:@"Technology"]; [categories addObject:@"Political"]; NSArray *objects = [NSArray arrayWithObjects:@"value1", @"value2", @"value3", @"value4", nil]; urlLists = [NSDictionary dictionaryWithObjects:objects forKeys:categories]; for (id key in urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } ... @end And, this all works up to here. I have added a UIPicker to my app, and when I select one of the items, I want to Log the one picked and its related entry in my dictionary. -(void) pickerView:(UIPickerView *)thePickerView didSelectRow:(NSInteger)row inComponent:(NSInteger) component { for (id key in self.urlLists) { NSLog(@"key: %@, value: %@", key, [urlLists objectForKey:key]); } } but I get the old EXC_BAD_ACCESS error... I know Im missing something small, but what? Thanks

    Read the article

  • When should I implement globalization and localization in C#?

    - by Geo Ego
    I am cleaning up some code in a C# app that I wrote and really trying to focus on best practices and coding style. As such, I am running my assembly through FXCop and trying to research each message it gives me to decide what should and shouldn't be changed. What I am currently focusing on are locale settings. For instance, the two errors that I have currently are that I should be specifying the IFormatProvider parameter for Convert.ToString(int), and setting the Dataset and Datatable locale. This is something that I've never done, and never put much thought into. I've always just left that overload out. The current app that I am working on is an internal app for a small company that will very likely never need to run in another country. As such, it is my opinion that I do not need to set these at all. On the other hand, doing so would not be such a big deal, but it seems like it is unneccessary and could hinder readability to a degree. I understand that Microsoft's contention is to use it if it's there, period. Well, I'm technically supposed to call Dispose() on every object that implements IDisposable, but I don't bother doing that with Datasets and Datatables, so I wonder what the practice is "in the wild."

    Read the article

< Previous Page | 458 459 460 461 462 463 464 465 466 467 468 469  | Next Page >