Search Results

Search found 36624 results on 1465 pages for 'open world'.

Page 463/1465 | < Previous Page | 459 460 461 462 463 464 465 466 467 468 469 470  | Next Page >

  • glassfish v3.0 hangs no app is ever deployed and no error is ever shown

    - by Samuel Lopez
    I have a web app that uses JSF 2.0 with richFaces and primeFaces, hibernate and java and I use NetBeans 7.1.2 as the IDE when I run the app the glassfish server is started and the log shows this: Launching GlassFish on Felix platform Información: Running GlassFish Version: GlassFish Server Open Source Edition 3.1.2 (build 23) Información: Grizzly Framework 1.9.46 started in: 20ms - bound to [0.0.0.0:4848] Información: Grizzly Framework 1.9.46 started in: 32ms - bound to [0.0.0.0:8181] Información: Grizzly Framework 1.9.46 started in: 59ms - bound to [0.0.0.0:8080] Información: Grizzly Framework 1.9.46 started in: 32ms - bound to [0.0.0.0:3700] Información: Grizzly Framework 1.9.46 started in: 21ms - bound to [0.0.0.0:7676] Información: Registered org.glassfish.ha.store.adapter.cache.ShoalBackingStoreProxy for persistence-type = replicated in BackingStoreFactoryRegistry Información: SEC1002: Security Manager is OFF. Información: SEC1010: Entering Security Startup Service Información: SEC1143: Loading policy provider com.sun.enterprise.security.provider.PolicyWrapper. Información: SEC1115: Realm [admin-realm] of classtype [com.sun.enterprise.security.auth.realm.file.FileRealm] successfully created. Información: SEC1115: Realm [file] of classtype [com.sun.enterprise.security.auth.realm.file.FileRealm] successfully created. Información: SEC1115: Realm [certificate] of classtype [com.sun.enterprise.security.auth.realm.certificate.CertificateRealm] successfully created. Información: SEC1011: Security Service(s) Started Successfully Información: WEB0169: Created HTTP listener [http-listener-1] on host/port [0.0.0.0:8080] Información: WEB0169: Created HTTP listener [http-listener-2] on host/port [0.0.0.0:8181] Información: WEB0169: Created HTTP listener [admin-listener] on host/port [0.0.0.0:4848] Información: WEB0171: Created virtual server [server] Información: WEB0171: Created virtual server [__asadmin] Información: WEB0172: Virtual server [server] loaded default web module [] Información: Inicializando Mojarra 2.1.6 (SNAPSHOT 20111206) para el contexto '/test' Información: Hibernate Validator 4.2.0.Final Información: WEB0671: Loading application [test] at [/test] Información: CORE10010: Loading application test done in 4,885 ms Información: GlassFish Server Open Source Edition 3.1.2 (23) startup time : Felix (1,848ms), startup services(5,600ms), total(7,448ms) Información: JMX005: JMXStartupService had Started JMXConnector on JMXService URL service:jmx:rmi://SJ007:8686/jndi/rmi://SJ007:8686/jmxrmi Información: WEB0169: Created HTTP listener [http-listener-1] on host/port [0.0.0.0:8080] Información: Grizzly Framework 1.9.46 started in: 14ms - bound to [0.0.0.0:8080] Información: WEB0169: Created HTTP listener [http-listener-2] on host/port [0.0.0.0:8181] Información: Grizzly Framework 1.9.46 started in: 12ms - bound to [0.0.0.0:8181] but right there it hangs and the deploy bar keeps running but no more actions are shown, nothing else is logged either it just stays there until I stop the deploy Is there any other error log to debug glassfish server? Any thoughts? I have re installed glassfish and NetBeans but it all seems the same. I think this started happening after I had to force-restart my computer with NetBeans stil open and the app deployed, but it's hard to know for sure if this was the real catalyst. Any thoughts or help is appreciated thanks. Is it an app error? if so why no errors in the log are shown?

    Read the article

  • How do I upload an NSImage(NSData)to Twitpic with OAMutableURLRequest?

    - by timothy5216
    I'm using OAConsumer in my xAuth twitterEngine and i'm adding Twitpic OAuth Echo to it. But it won't POST the NSData. here is some of my code: //other file NSArray *reps = [[imageToUpload image] representations]; NSData *imageData = [NSBitmapImageRep representationOfImageRepsInArray:reps usingType:NSJPEGFileType properties:nil]; [twitter testUploadImageData:imageData withMessage:@"Hello WORLD!!" toURL:[NSURL URLWithString:uploadURL.stringValue]]; // - (void)testUploadImageData:(NSData *)data withMessage:(NSString *)message toURL:(NSURL *)url; { //url = @"http://api.twitpic.com/2/upload.xml" //message = @"Hello WORLD!!" NSAutoreleasePool *pool = [[NSAutoreleasePool alloc] init]; NSString *String = [[NSString alloc] initWithData:data encoding:NSASCIIStringEncoding]; NSLog(@"dataString: %@",String); OAMutableURLRequest *request = [[OAMutableURLRequest alloc] initWithURL:url consumer:self.consumer token:_accessToken realm:nil signatureProvider:nil]; // Setup POST body [request setHTTPMethod:@"POST"]; //NSString *stringBoundary = [NSString stringWithString:@"0xKhTmLbOuNdArY"]; //NSString *contentType = [NSString stringWithFormat:@"multipart/form-data; boundary=%@", stringBoundary]; // NSString *stringBoundarySeparator = [NSString stringWithFormat:@"\r\n--%@\r\n", stringBoundary]; /* NSMutableString *postString = [NSMutableString string]; [postString appendString:@"\r\n"]; [postString appendString:stringBoundarySeparator]; [postString appendString:[NSString stringWithFormat:@"Content-Disposition: form-data; name=\"message\"\r\n\r\n%@", message]]; [postString appendString:stringBoundarySeparator]; [postString appendString:[NSString stringWithFormat:@"Content-Disposition: form-data; name=\"media\"; filename=\"%@\"\r\n", @"file.jpg"]]; [postString appendString:@"Content-Type: image/jpg\r\n"]; [postString appendString:@"Content-Transfer-Encoding: binary\r\n\r\n"]; // Setting up the POST request's multipart/form-data body NSMutableData *postBody = [NSMutableData data]; [postBody appendData:[postString dataUsingEncoding:NSUTF8StringEncoding]]; [postBody appendData:data]; [request setHTTPBody:postBody]; */ [request setHTTPMethod:@"POST"]; NSString *thing = [[NSString alloc] initWithData:data encoding:NSASCIIStringEncoding]; NSLog(@"%@",thing); [request setParameters:[NSArray arrayWithObjects: [OARequestParameter requestParameterWithName:@"oauth_token" value:_accessToken.key], [OARequestParameter requestParameterWithName:@"X-Auth-Service-Provider" value:@"https://api.twitter.com/1/account/verify_credentials.json"], [OARequestParameter requestParameterWithName:@"key" value:@"my-key-here :P"], [OARequestParameter requestParameterWithName:@"message" value:message], //iv'e changed this many times. I was just trying this to see if it works [OARequestParameter requestParameterWithName:@"media" value:thing], nil]]; OAAsynchronousDataFetcher *dataFetcher = [[OAAsynchronousDataFetcher alloc] init]; [dataFetcher initWithRequest:request delegate:self didFinishSelector:@selector(uploadDidUpload:withData:) didFailSelector:@selector(uploadDidFail:withData:)]; [dataFetcher start]; [dataFetcher release]; [request release]; [pool drain]; } I'm authenticated but it still won't POST the data :(

    Read the article

  • sqlite - any improvements for this attach code (running multiple sql commands transactionally in sql

    - by Greg
    Hi, Is this code solid? I've tried to use "using" etc. Basically a method to pass as sequenced list of SQL commands to be run against a Sqlite database. I assume it is true that in sqlite by default all commands run in a single connection are handled transactionally? Is this true? i.e. I should not have to (and haven't got in the code at the moment) a BeginTransaction, or CommitTransaction. It's using http://sqlite.phxsoftware.com/ as the sqlite ADO.net database provider. private int ExecuteNonQueryTransactionally(List<string> sqlList) { int totalRowsUpdated = 0; using (var conn = new SQLiteConnection(_connectionString)) { // Open connection (one connection so should be transactional - confirm) conn.Open(); // Apply each SQL statement passed in to sqlList foreach (string s in sqlList) { using (var cmd = new SQLiteCommand(conn)) { cmd.CommandText = s; totalRowsUpdated = totalRowsUpdated + cmd.ExecuteNonQuery(); } } } return totalRowsUpdated; }

    Read the article

  • Private constructor and public parameter constructor -C#

    - by Amutha
    I heard that private constructor prevent object creation from outside world. When i have a code public class Product { public string Name { get;set;} public double Price {get;set;} Product() { } public Product(string _name,double _price) { } } here still i can declare public constructor(parameter),won't it spoil the purpose of private constructor? When do we need both private and public constructor(parameter) in code? I need detailed explanation please.

    Read the article

  • Python (Twisted) - reading from fifo and sending read data to multiple protocols

    - by SpankMe
    Hi, Im trying to write some kind of multi protocol bot (jabber/irc) that would read messages from fifo file (one liners mostly) and then send them to irc channel and jabber contacts. So far, I managed to create two factories to connect to jabber and irc, and they seem to be working. However, I've problem with reading the fifo file - I have no idea how to read it in a loop (open file, read line, close file, jump to open file and so on) outside of reactor loop to get the data I need to send, and then get that data to reactor loop for sending in both protocols. I've been looking for information on how to do it in best way, but Im totally lost in the dark. Any suggestion/help would be highly appreciated. Thanks in advance!

    Read the article

  • How can I use the Graphviz macro in XWiki 2.0 syntax?

    - by DR
    The XWiki FAQ gives an example for XWiki 1.0 syntax: {graphviz:type=dot}digraph G {Hello->world}{graphviz} My XWiki is properly set up to display this. But I'm not able to translate this into XWiki 2.0 syntax. I tried this {{graphviz type=dot}} ... {{/graphviz}} and other variations, but the best I got was about "graphviz" not being a valid macro. What's the correct syntax?

    Read the article

  • Have Button re-appear immediately after clicking button in ListView row

    - by Soeren
    I have 4 buttons on a page. Each button opens a modal window and let’s the user input data in a form. When the user hits the save button in the modal, a ListView appears on the page with the submitted data. The button the user clicked to open the modal window is set to visible=false, so it’s gone when the row is added to the ListView. Now there are 3 buttons and the same goes for those; when the user hits a button, a modal appears, and when the modal form is submitted, the button disappears and a row is added to the ListView. In the ListView row, there is a delete button. When this button is clicked, the row is deleted and the button that was initially clicked to add this row (and open the modal), SHOULD reappear, but it doesn’t. The row disappears, but I have to refresh the page before the button comes back. There is a ScriptManager on the masterpage, so I guess this is an AJAX partial refresh issue. I tried adding different events, but I can’t find the one that fires at the right time. I use an ObjectDataSource to fill the ListView, and the data comes from a database, wrapped in a business object. This code loads a business object in a List< and checks if the user inserted an item of a specific type. If he did, the button he used to open the modal is hidden. This works fine (maybe not the most elegant) _goals = GoalManager.GetGoalsByUser(UserID); if (_goals != null) { foreach (Goal _goalinlist in _goals) { if (_goalinlist.GoalType == 1) { Button1.Visible = false; goalid1 = true; } if (_goalinlist.GoalType == 2) { Button2.Visible = false; goalid2 = true; } if (_goalinlist.GoalType == 3) { Button3.Visible = false; goalid3 = true; } if (_goalinlist.GoalType == 4) { Button4.Visible = false; goalid4 = true; } } } As you can see, I tried setting a boolean, and then check it when the page is re-loaded. But the problem (I guess) is that the whole page isn't refreshed when the delete button is clicked in the ListView. This is the delete button in the ListView: <asp:ImageButton ID="ImageButton2" runat="server" CommandName="Delete" CausesValidation="false" ToolTip="Delete" CommandArgument='<%#Eval("GoalID")%>' ImageUrl="delete.gif" OnClientClick="return confirm('Delete this post?');" CssClass="button"/> I guess the question is, how do I make the button re-appear right after the ListView button is clicked?

    Read the article

  • ffmpeg - How to determine if -movflags faststart is enabled? PHP

    - by IIIOXIII
    While I am able to encode an mp4 file which I can plan on my local windows machine, I am having trouble encoding files to mp4 which are readable when streaming by safari, etc. After a bit of reading, I believe my issue is that I must move the metadata from the end of the file to the beginning in order for the converted mp4 files to be streamable. To that end, I am trying to find out if the build of ffmpeg that I am currently using is able to use the -movflags faststart option through php - as my current outputted mp4 files are not working when streamed online. This is the way I am now echoing the -help, -formats, -codecs, but I am not seeing anything about -movflags faststart in any of the lists: exec($ffmpegPath." -help", $codecArr); for($ii=0;$ii<count($codecArr);$ii++){ echo $codecArr[$ii].'</br>'; } Is there a similar method of determining if -movflags fastart is available to my ffmpeg build? Any other way? Should it be listed with any of the previously suggested commands? -help/-formats? Can someone that knows it is enabled in their version of ffmpeg check to see if it is listed under -help or -formats, etc.? TIA. EDIT: COMPLETE CONSOLE OUTPUT FOR BOTH THE CONVERSION COMMAND AND -MOVFLAGS COMMAND BELOW: COMMAND: ffmpeg_new -i C:\vidtests\Wildlife.wmv -s 640x480 C:\vidtests\Wildlife.mp4 OUTPUT: ffmpeg version N-54207-ge59fb3f Copyright (c) 2000-2013 the FFmpeg developers built on Jun 25 2013 21:55:00 with gcc 4.7.3 (GCC) configuration: --enable-gpl --enable-version3 --disable-w32threads --enable-av isynth --enable-bzlib --enable-fontconfig --enable-frei0r --enable-gnutls --enab le-iconv --enable-libass --enable-libbluray --enable-libcaca --enable-libfreetyp e --enable-libgsm --enable-libilbc --enable-libmodplug --enable-libmp3lame --ena ble-libopencore-amrnb --enable-libopencore-amrwb --enable-libopenjpeg --enable-l ibopus --enable-librtmp --enable-libschroedinger --enable-libsoxr --enable-libsp eex --enable-libtheora --enable-libtwolame --enable-libvo-aacenc --enable-libvo- amrwbenc --enable-libvorbis --enable-libvpx --enable-libx264 --enable-libxavs -- enable-libxvid --enable-zlib libavutil 52. 37.101 / 52. 37.101 libavcodec 55. 17.100 / 55. 17.100 libavformat 55. 10.100 / 55. 10.100 libavdevice 55. 2.100 / 55. 2.100 libavfilter 3. 77.101 / 3. 77.101 libswscale 2. 3.100 / 2. 3.100 libswresample 0. 17.102 / 0. 17.102 libpostproc 52. 3.100 / 52. 3.100 [asf @ 00000000002ed760] Stream #0: not enough frames to estimate rate; consider increasing probesize Guessed Channel Layout for Input Stream #0.0 : stereo Input #0, asf, from 'C:\vidtests\Wildlife.wmv' : Metadata: SfOriginalFPS : 299700 WMFSDKVersion : 11.0.6001.7000 WMFSDKNeeded : 0.0.0.0000 comment : Footage: Small World Productions, Inc; Tourism New Zealand | Producer: Gary F. Spradling | Music: Steve Ball title : Wildlife in HD copyright : -¬ 2008 Microsoft Corporation IsVBR : 0 DeviceConformanceTemplate: AP@L3 Duration: 00:00:30.09, start: 0.000000, bitrate: 6977 kb/s Stream #0:0(eng): Audio: wmav2 (a[1][0][0] / 0x0161), 44100 Hz, stereo, fltp , 192 kb/s Stream #0:1(eng): Video: vc1 (Advanced) (WVC1 / 0x31435657), yuv420p, 1280x7 20, 5942 kb/s, 29.97 tbr, 1k tbn, 1k tbc [libx264 @ 00000000002e6980] using cpu capabilities: MMX2 SSE2Fast SSSE3 Cache64 [libx264 @ 00000000002e6980] profile High, level 3.0 [libx264 @ 00000000002e6980] 264 - core 133 r2334 a3ac64b - H.264/MPEG-4 AVC cod ec - Copyleft 2003-2013 - http://www.videolan.org/x264.html - options: cabac=1 r ef=3 deblock=1:0:0 analyse=0x3:0x113 me=hex subme=7 psy=1 psy_rd=1.00:0.00 mixed _ref=1 me_range=16 chroma_me=1 trellis=1 8x8dct=1 cqm=0 deadzone=21,11 fast_pski p=1 chroma_qp_offset=-2 threads=3 lookahead_threads=1 sliced_threads=0 nr=0 deci mate=1 interlaced=0 bluray_compat=0 constrained_intra=0 bframes=3 b_pyramid=2 b_ adapt=1 b_bias=0 direct=1 weightb=1 open_gop=0 weightp=2 keyint=250 keyint_min=2 5 scenecut=40 intra_refresh=0 rc_lookahead=40 rc=crf mbtree=1 crf=23.0 qcomp=0.6 0 qpmin=0 qpmax=69 qpstep=4 ip_ratio=1.40 aq=1:1.00 Output #0, mp4, to 'C:\vidtests\Wildlife.mp4': Metadata: SfOriginalFPS : 299700 WMFSDKVersion : 11.0.6001.7000 WMFSDKNeeded : 0.0.0.0000 comment : Footage: Small World Productions, Inc; Tourism New Zealand | Producer: Gary F. Spradling | Music: Steve Ball title : Wildlife in HD copyright : -¬ 2008 Microsoft Corporation IsVBR : 0 DeviceConformanceTemplate: AP@L3 encoder : Lavf55.10.100 Stream #0:0(eng): Video: h264 (libx264) ([33][0][0][0] / 0x0021), yuv420p, 6 40x480, q=-1--1, 30k tbn, 29.97 tbc Stream #0:1(eng): Audio: aac (libvo_aacenc) ([64][0][0][0] / 0x0040), 44100 Hz, stereo, s16, 128 kb/s Stream mapping: Stream #0:1 -> #0:0 (vc1 -> libx264) Stream #0:0 -> #0:1 (wmav2 -> libvo_aacenc) Press [q] to stop, [?] for help frame= 53 fps= 49 q=29.0 size= 0kB time=00:00:00.13 bitrate= 2.9kbits/ frame= 63 fps= 40 q=29.0 size= 0kB time=00:00:00.46 bitrate= 0.8kbits/ frame= 74 fps= 35 q=29.0 size= 0kB time=00:00:00.83 bitrate= 0.5kbits/ frame= 85 fps= 32 q=29.0 size= 0kB time=00:00:01.20 bitrate= 0.3kbits/ frame= 95 fps= 30 q=29.0 size= 0kB time=00:00:01.53 bitrate= 0.3kbits/ frame= 107 fps= 28 q=29.0 size= 0kB time=00:00:01.93 bitrate= 0.2kbits/ Queue input is backward in time [mp4 @ 00000000003ef800] Non-monotonous DTS in output stream 0:1; previous: 7616 , current: 7063; changing to 7617. This may result in incorrect timestamps in th e output file. frame= 118 fps= 28 q=29.0 size= 113kB time=00:00:02.30 bitrate= 402.6kbits/ frame= 129 fps= 26 q=29.0 size= 219kB time=00:00:02.66 bitrate= 670.7kbits/ frame= 141 fps= 26 q=29.0 size= 264kB time=00:00:03.06 bitrate= 704.2kbits/ frame= 152 fps= 25 q=29.0 size= 328kB time=00:00:03.43 bitrate= 782.2kbits/ frame= 163 fps= 25 q=29.0 size= 431kB time=00:00:03.80 bitrate= 928.1kbits/ frame= 174 fps= 24 q=29.0 size= 568kB time=00:00:04.17 bitrate=1116.3kbits/ frame= 190 fps= 25 q=29.0 size= 781kB time=00:00:04.70 bitrate=1359.9kbits/ frame= 204 fps= 25 q=29.0 size= 1006kB time=00:00:05.17 bitrate=1593.1kbits/ frame= 218 fps= 25 q=29.0 size= 1058kB time=00:00:05.63 bitrate=1536.8kbits/ frame= 229 fps= 25 q=29.0 size= 1093kB time=00:00:06.00 bitrate=1490.9kbits/ frame= 239 fps= 24 q=29.0 size= 1118kB time=00:00:06.33 bitrate=1444.4kbits/ frame= 251 fps= 24 q=29.0 size= 1150kB time=00:00:06.74 bitrate=1397.9kbits/ frame= 265 fps= 24 q=29.0 size= 1234kB time=00:00:07.20 bitrate=1402.3kbits/ frame= 278 fps= 25 q=29.0 size= 1332kB time=00:00:07.64 bitrate=1428.3kbits/ frame= 294 fps= 25 q=29.0 size= 1403kB time=00:00:08.17 bitrate=1405.7kbits/ frame= 308 fps= 25 q=29.0 size= 1547kB time=00:00:08.64 bitrate=1466.4kbits/ frame= 323 fps= 25 q=29.0 size= 1595kB time=00:00:09.14 bitrate=1429.5kbits/ frame= 337 fps= 25 q=29.0 size= 1702kB time=00:00:09.60 bitrate=1450.7kbits/ frame= 351 fps= 25 q=29.0 size= 1755kB time=00:00:10.07 bitrate=1427.1kbits/ frame= 365 fps= 25 q=29.0 size= 1820kB time=00:00:10.54 bitrate=1414.1kbits/ frame= 381 fps= 25 q=29.0 size= 1852kB time=00:00:11.07 bitrate=1369.6kbits/ frame= 396 fps= 26 q=29.0 size= 1893kB time=00:00:11.57 bitrate=1339.5kbits/ frame= 409 fps= 26 q=29.0 size= 1923kB time=00:00:12.01 bitrate=1311.8kbits/ frame= 421 fps= 25 q=29.0 size= 1967kB time=00:00:12.41 bitrate=1298.3kbits/ frame= 434 fps= 25 q=29.0 size= 1998kB time=00:00:12.84 bitrate=1274.0kbits/ frame= 445 fps= 25 q=29.0 size= 2018kB time=00:00:13.21 bitrate=1251.3kbits/ frame= 458 fps= 25 q=29.0 size= 2048kB time=00:00:13.64 bitrate=1229.5kbits/ frame= 471 fps= 25 q=29.0 size= 2067kB time=00:00:14.08 bitrate=1202.3kbits/ frame= 484 fps= 25 q=29.0 size= 2189kB time=00:00:14.51 bitrate=1235.5kbits/ frame= 497 fps= 25 q=29.0 size= 2260kB time=00:00:14.94 bitrate=1238.3kbits/ frame= 509 fps= 25 q=29.0 size= 2311kB time=00:00:15.34 bitrate=1233.3kbits/ frame= 523 fps= 25 q=29.0 size= 2429kB time=00:00:15.81 bitrate=1258.1kbits/ frame= 535 fps= 25 q=29.0 size= 2541kB time=00:00:16.21 bitrate=1283.5kbits/ frame= 548 fps= 25 q=29.0 size= 2718kB time=00:00:16.64 bitrate=1337.5kbits/ frame= 560 fps= 25 q=29.0 size= 2845kB time=00:00:17.05 bitrate=1367.1kbits/ frame= 571 fps= 25 q=29.0 size= 2965kB time=00:00:17.41 bitrate=1394.6kbits/ frame= 580 fps= 25 q=29.0 size= 3025kB time=00:00:17.71 bitrate=1398.7kbits/ frame= 588 fps= 25 q=29.0 size= 3098kB time=00:00:17.98 bitrate=1411.1kbits/ frame= 597 fps= 25 q=29.0 size= 3183kB time=00:00:18.28 bitrate=1426.1kbits/ frame= 606 fps= 24 q=29.0 size= 3279kB time=00:00:18.58 bitrate=1445.2kbits/ frame= 616 fps= 24 q=29.0 size= 3441kB time=00:00:18.91 bitrate=1489.9kbits/ frame= 626 fps= 24 q=29.0 size= 3650kB time=00:00:19.25 bitrate=1553.0kbits/ frame= 638 fps= 24 q=29.0 size= 3826kB time=00:00:19.65 bitrate=1594.7kbits/ frame= 649 fps= 24 q=29.0 size= 3950kB time=00:00:20.02 bitrate=1616.3kbits/ frame= 660 fps= 24 q=29.0 size= 4067kB time=00:00:20.38 bitrate=1634.1kbits/ frame= 669 fps= 24 q=29.0 size= 4121kB time=00:00:20.68 bitrate=1631.8kbits/ frame= 682 fps= 24 q=29.0 size= 4274kB time=00:00:21.12 bitrate=1657.9kbits/ frame= 696 fps= 24 q=29.0 size= 4446kB time=00:00:21.58 bitrate=1687.1kbits/ frame= 709 fps= 24 q=29.0 size= 4590kB time=00:00:22.02 bitrate=1707.3kbits/ frame= 719 fps= 24 q=29.0 size= 4772kB time=00:00:22.35 bitrate=1748.5kbits/ frame= 732 fps= 24 q=29.0 size= 4852kB time=00:00:22.78 bitrate=1744.3kbits/ frame= 744 fps= 24 q=29.0 size= 4973kB time=00:00:23.18 bitrate=1756.9kbits/ frame= 756 fps= 24 q=29.0 size= 5099kB time=00:00:23.59 bitrate=1770.8kbits/ frame= 768 fps= 24 q=29.0 size= 5149kB time=00:00:23.99 bitrate=1758.4kbits/ frame= 780 fps= 24 q=29.0 size= 5227kB time=00:00:24.39 bitrate=1755.7kbits/ frame= 797 fps= 24 q=29.0 size= 5377kB time=00:00:24.95 bitrate=1765.0kbits/ frame= 813 fps= 24 q=29.0 size= 5507kB time=00:00:25.49 bitrate=1769.5kbits/ frame= 828 fps= 24 q=29.0 size= 5634kB time=00:00:25.99 bitrate=1775.5kbits/ frame= 843 fps= 24 q=29.0 size= 5701kB time=00:00:26.49 bitrate=1762.9kbits/ frame= 859 fps= 24 q=29.0 size= 5830kB time=00:00:27.02 bitrate=1767.0kbits/ frame= 872 fps= 24 q=29.0 size= 5926kB time=00:00:27.46 bitrate=1767.7kbits/ frame= 888 fps= 24 q=29.0 size= 6014kB time=00:00:27.99 bitrate=1759.7kbits/ frame= 900 fps= 24 q=29.0 size= 6332kB time=00:00:28.39 bitrate=1826.9kbits/ frame= 901 fps= 24 q=-1.0 Lsize= 6717kB time=00:00:30.10 bitrate=1828.0kbits /s video:6211kB audio:472kB subtitle:0 global headers:0kB muxing overhead 0.513217% [libx264 @ 00000000002e6980] frame I:8 Avg QP:21.77 size: 39744 [libx264 @ 00000000002e6980] frame P:433 Avg QP:25.69 size: 11490 [libx264 @ 00000000002e6980] frame B:460 Avg QP:29.25 size: 2319 [libx264 @ 00000000002e6980] consecutive B-frames: 5.4% 78.6% 2.7% 13.3% [libx264 @ 00000000002e6980] mb I I16..4: 21.8% 48.8% 29.5% [libx264 @ 00000000002e6980] mb P I16..4: 0.7% 4.0% 1.3% P16..4: 37.1% 22.2 % 15.5% 0.0% 0.0% skip:19.2% [libx264 @ 00000000002e6980] mb B I16..4: 0.1% 0.5% 0.2% B16..8: 43.5% 7.0 % 2.1% direct: 2.2% skip:44.5% L0:36.4% L1:52.7% BI:10.9% [libx264 @ 00000000002e6980] 8x8 transform intra:62.8% inter:56.2% [libx264 @ 00000000002e6980] coded y,uvDC,uvAC intra: 74.2% 78.8% 44.0% inter: 2 3.6% 14.5% 1.0% [libx264 @ 00000000002e6980] i16 v,h,dc,p: 48% 24% 9% 20% [libx264 @ 00000000002e6980] i8 v,h,dc,ddl,ddr,vr,hd,vl,hu: 16% 17% 15% 7% 8% 11% 8% 10% 8% [libx264 @ 00000000002e6980] i4 v,h,dc,ddl,ddr,vr,hd,vl,hu: 19% 17% 15% 7% 10% 11% 8% 7% 7% [libx264 @ 00000000002e6980] i8c dc,h,v,p: 53% 21% 18% 7% [libx264 @ 00000000002e6980] Weighted P-Frames: Y:0.7% UV:0.0% [libx264 @ 00000000002e6980] ref P L0: 62.4% 19.0% 12.0% 6.6% 0.0% [libx264 @ 00000000002e6980] ref B L0: 90.5% 8.9% 0.7% [libx264 @ 00000000002e6980] ref B L1: 97.9% 2.1% [libx264 @ 00000000002e6980] kb/s:1692.37 AND THE –MOVFLAGS COMMAND: C:\XSITE\SITE>ffmpeg_new -i C:\vidtests\Wildlife.mp4 -movflags faststart C:\vidtests\Wildlife_fs.mp4 AND THE –MOVFLAGS OUTPUT ffmpeg version N-54207-ge59fb3f Copyright (c) 2000-2013 the FFmpeg developers built on Jun 25 2013 21:55:00 with gcc 4.7.3 (GCC) configuration: --enable-gpl --enable-version3 --disable-w32threads --enable-av isynth --enable-bzlib --enable-fontconfig --enable-frei0r --enable-gnutls --enab le-iconv --enable-libass --enable-libbluray --enable-libcaca --enable-libfreetyp e --enable-libgsm --enable-libilbc --enable-libmodplug --enable-libmp3lame --ena ble-libopencore-amrnb --enable-libopencore-amrwb --enable-libopenjpeg --enable-l ibopus --enable-librtmp --enable-libschroedinger --enable-libsoxr --enable-libsp eex --enable-libtheora --enable-libtwolame --enable-libvo-aacenc --enable-libvo- amrwbenc --enable-libvorbis --enable-libvpx --enable-libx264 --enable-libxavs -- enable-libxvid --enable-zlib libavutil 52. 37.101 / 52. 37.101 libavcodec 55. 17.100 / 55. 17.100 libavformat 55. 10.100 / 55. 10.100 libavdevice 55. 2.100 / 55. 2.100 libavfilter 3. 77.101 / 3. 77.101 libswscale 2. 3.100 / 2. 3.100 libswresample 0. 17.102 / 0. 17.102 libpostproc 52. 3.100 / 52. 3.100 Input #0, mov,mp4,m4a,3gp,3g2,mj2, from 'C:\vidtests\Wildlife.mp4': Metadata: major_brand : isom minor_version : 512 compatible_brands: isomiso2avc1mp41 title : Wildlife in HD encoder : Lavf55.10.100 comment : Footage: Small World Productions, Inc; Tourism New Zealand | Producer: Gary F. Spradling | Music: Steve Ball copyright : -¬ 2008 Microsoft Corporation Duration: 00:00:30.13, start: 0.036281, bitrate: 1826 kb/s Stream #0:0(eng): Video: h264 (High) (avc1 / 0x31637661), yuv420p, 640x480, 1692 kb/s, 29.97 fps, 29.97 tbr, 30k tbn, 59.94 tbc Metadata: handler_name : VideoHandler Stream #0:1(eng): Audio: aac (mp4a / 0x6134706D), 44100 Hz, stereo, fltp, 12 8 kb/s Metadata: handler_name : SoundHandler [libx264 @ 0000000004360620] using cpu capabilities: MMX2 SSE2Fast SSSE3 Cache64 [libx264 @ 0000000004360620] profile High, level 3.0 [libx264 @ 0000000004360620] 264 - core 133 r2334 a3ac64b - H.264/MPEG-4 AVC cod ec - Copyleft 2003-2013 - http://www.videolan.org/x264.html - options: cabac=1 r ef=3 deblock=1:0:0 analyse=0x3:0x113 me=hex subme=7 psy=1 psy_rd=1.00:0.00 mixed _ref=1 me_range=16 chroma_me=1 trellis=1 8x8dct=1 cqm=0 deadzone=21,11 fast_pski p=1 chroma_qp_offset=-2 threads=3 lookahead_threads=1 sliced_threads=0 nr=0 deci mate=1 interlaced=0 bluray_compat=0 constrained_intra=0 bframes=3 b_pyramid=2 b_ adapt=1 b_bias=0 direct=1 weightb=1 open_gop=0 weightp=2 keyint=250 keyint_min=2 5 scenecut=40 intra_refresh=0 rc_lookahead=40 rc=crf mbtree=1 crf=23.0 qcomp=0.6 0 qpmin=0 qpmax=69 qpstep=4 ip_ratio=1.40 aq=1:1.00 Output #0, mp4, to 'C:\vidtests\Wildlife_fs.mp4': Metadata: major_brand : isom minor_version : 512 compatible_brands: isomiso2avc1mp41 title : Wildlife in HD copyright : -¬ 2008 Microsoft Corporation comment : Footage: Small World Productions, Inc; Tourism New Zealand | Producer: Gary F. Spradling | Music: Steve Ball encoder : Lavf55.10.100 Stream #0:0(eng): Video: h264 (libx264) ([33][0][0][0] / 0x0021), yuv420p, 6 40x480, q=-1--1, 30k tbn, 29.97 tbc Metadata: handler_name : VideoHandler Stream #0:1(eng): Audio: aac (libvo_aacenc) ([64][0][0][0] / 0x0040), 44100 Hz, stereo, s16, 128 kb/s Metadata: handler_name : SoundHandler Stream mapping: Stream #0:0 -> #0:0 (h264 -> libx264) Stream #0:1 -> #0:1 (aac -> libvo_aacenc) Press [q] to stop, [?] for help frame= 52 fps=0.0 q=29.0 size= 29kB time=00:00:01.76 bitrate= 133.9kbits/ frame= 63 fps= 60 q=29.0 size= 104kB time=00:00:02.14 bitrate= 397.2kbits/ frame= 74 fps= 47 q=29.0 size= 176kB time=00:00:02.51 bitrate= 573.2kbits/ frame= 87 fps= 41 q=29.0 size= 265kB time=00:00:02.93 bitrate= 741.2kbits/ frame= 101 fps= 37 q=29.0 size= 358kB time=00:00:03.39 bitrate= 862.8kbits/ frame= 113 fps= 34 q=29.0 size= 437kB time=00:00:03.79 bitrate= 943.7kbits/ frame= 125 fps= 33 q=29.0 size= 520kB time=00:00:04.20 bitrate=1012.2kbits/ frame= 138 fps= 32 q=29.0 size= 606kB time=00:00:04.64 bitrate=1069.8kbits/ frame= 151 fps= 31 q=29.0 size= 696kB time=00:00:05.06 bitrate=1124.3kbits/ frame= 163 fps= 30 q=29.0 size= 780kB time=00:00:05.47 bitrate=1166.4kbits/ frame= 176 fps= 30 q=29.0 size= 919kB time=00:00:05.90 bitrate=1273.9kbits/ frame= 196 fps= 31 q=29.0 size= 994kB time=00:00:06.57 bitrate=1237.4kbits/ frame= 213 fps= 31 q=29.0 size= 1097kB time=00:00:07.13 bitrate=1258.8kbits/ frame= 225 fps= 30 q=29.0 size= 1204kB time=00:00:07.53 bitrate=1309.8kbits/ frame= 236 fps= 30 q=29.0 size= 1323kB time=00:00:07.91 bitrate=1369.4kbits/ frame= 249 fps= 29 q=29.0 size= 1451kB time=00:00:08.34 bitrate=1424.6kbits/ frame= 263 fps= 29 q=29.0 size= 1574kB time=00:00:08.82 bitrate=1461.3kbits/ frame= 278 fps= 29 q=29.0 size= 1610kB time=00:00:09.30 bitrate=1416.9kbits/ frame= 296 fps= 30 q=29.0 size= 1655kB time=00:00:09.91 bitrate=1368.0kbits/ frame= 313 fps= 30 q=29.0 size= 1697kB time=00:00:10.48 bitrate=1326.4kbits/ frame= 330 fps= 30 q=29.0 size= 1737kB time=00:00:11.05 bitrate=1286.5kbits/ frame= 345 fps= 30 q=29.0 size= 1776kB time=00:00:11.54 bitrate=1260.4kbits/ frame= 361 fps= 30 q=29.0 size= 1813kB time=00:00:12.07 bitrate=1230.3kbits/ frame= 377 fps= 30 q=29.0 size= 1847kB time=00:00:12.59 bitrate=1201.4kbits/ frame= 395 fps= 30 q=29.0 size= 1880kB time=00:00:13.22 bitrate=1165.0kbits/ frame= 410 fps= 30 q=29.0 size= 1993kB time=00:00:13.72 bitrate=1190.2kbits/ frame= 424 fps= 30 q=29.0 size= 2080kB time=00:00:14.18 bitrate=1201.4kbits/ frame= 439 fps= 30 q=29.0 size= 2166kB time=00:00:14.67 bitrate=1209.4kbits/ frame= 455 fps= 30 q=29.0 size= 2262kB time=00:00:15.21 bitrate=1217.5kbits/ frame= 469 fps= 30 q=29.0 size= 2341kB time=00:00:15.68 bitrate=1223.0kbits/ frame= 484 fps= 30 q=29.0 size= 2430kB time=00:00:16.19 bitrate=1229.1kbits/ frame= 500 fps= 30 q=29.0 size= 2523kB time=00:00:16.71 bitrate=1236.3kbits/ frame= 515 fps= 30 q=29.0 size= 2607kB time=00:00:17.21 bitrate=1240.4kbits/ frame= 531 fps= 30 q=29.0 size= 2681kB time=00:00:17.73 bitrate=1238.2kbits/ frame= 546 fps= 30 q=29.0 size= 2758kB time=00:00:18.24 bitrate=1238.2kbits/ frame= 561 fps= 30 q=29.0 size= 2824kB time=00:00:18.75 bitrate=1233.4kbits/ frame= 576 fps= 30 q=29.0 size= 2955kB time=00:00:19.25 bitrate=1256.8kbits/ frame= 586 fps= 29 q=29.0 size= 3061kB time=00:00:19.59 bitrate=1279.6kbits/ frame= 598 fps= 29 q=29.0 size= 3217kB time=00:00:19.99 bitrate=1318.4kbits/ frame= 610 fps= 29 q=29.0 size= 3354kB time=00:00:20.39 bitrate=1347.2kbits/ frame= 622 fps= 29 q=29.0 size= 3483kB time=00:00:20.78 bitrate=1372.6kbits/ frame= 634 fps= 29 q=29.0 size= 3593kB time=00:00:21.19 bitrate=1388.6kbits/ frame= 648 fps= 29 q=29.0 size= 3708kB time=00:00:21.66 bitrate=1402.3kbits/ frame= 661 fps= 29 q=29.0 size= 3811kB time=00:00:22.08 bitrate=1413.5kbits/ frame= 674 fps= 29 q=29.0 size= 3978kB time=00:00:22.53 bitrate=1446.3kbits/ frame= 690 fps= 29 q=29.0 size= 4133kB time=00:00:23.05 bitrate=1468.4kbits/ frame= 706 fps= 29 q=29.0 size= 4263kB time=00:00:23.58 bitrate=1480.4kbits/ frame= 721 fps= 29 q=29.0 size= 4391kB time=00:00:24.08 bitrate=1493.8kbits/ frame= 735 fps= 29 q=29.0 size= 4524kB time=00:00:24.55 bitrate=1509.4kbits/ frame= 748 fps= 29 q=29.0 size= 4661kB time=00:00:24.98 bitrate=1528.2kbits/ frame= 763 fps= 29 q=29.0 size= 4835kB time=00:00:25.50 bitrate=1553.1kbits/ frame= 778 fps= 29 q=29.0 size= 4993kB time=00:00:25.99 bitrate=1573.6kbits/ frame= 795 fps= 29 q=29.0 size= 5149kB time=00:00:26.56 bitrate=1588.1kbits/ frame= 814 fps= 29 q=29.0 size= 5258kB time=00:00:27.18 bitrate=1584.4kbits/ frame= 833 fps= 29 q=29.0 size= 5368kB time=00:00:27.82 bitrate=1580.2kbits/ frame= 851 fps= 29 q=29.0 size= 5469kB time=00:00:28.43 bitrate=1575.9kbits/ frame= 870 fps= 29 q=29.0 size= 5567kB time=00:00:29.05 bitrate=1569.5kbits/ frame= 889 fps= 29 q=29.0 size= 5688kB time=00:00:29.70 bitrate=1568.4kbits/ Starting second pass: moving header on top of the file frame= 902 fps= 28 q=-1.0 Lsize= 6109kB time=00:00:30.14 bitrate=1659.8kbits /s dup=1 drop=0 video:5602kB audio:472kB subtitle:0 global headers:0kB muxing overhead 0.566600% [libx264 @ 0000000004360620] frame I:8 Avg QP:20.52 size: 39667 [libx264 @ 0000000004360620] frame P:419 Avg QP:25.06 size: 10524 [libx264 @ 0000000004360620] frame B:475 Avg QP:29.03 size: 2123 [libx264 @ 0000000004360620] consecutive B-frames: 3.2% 79.6% 0.3% 16.9% [libx264 @ 0000000004360620] mb I I16..4: 20.7% 52.3% 26.9% [libx264 @ 0000000004360620] mb P I16..4: 0.7% 4.2% 1.1% P16..4: 39.4% 21.4 % 13.8% 0.0% 0.0% skip:19.3% [libx264 @ 0000000004360620] mb B I16..4: 0.1% 0.9% 0.3% B16..8: 41.8% 6.4 % 1.7% direct: 1.7% skip:47.1% L0:36.4% L1:53.3% BI:10.3% [libx264 @ 0000000004360620] 8x8 transform intra:65.7% inter:58.8% [libx264 @ 0000000004360620] coded y,uvDC,uvAC intra: 71.2% 76.6% 35.7% inter: 2 0.7% 13.0% 0.5% [libx264 @ 0000000004360620] i16 v,h,dc,p: 48% 24% 8% 20% [libx264 @ 0000000004360620] i8 v,h,dc,ddl,ddr,vr,hd,vl,hu: 17% 18% 15% 6% 8% 11% 8% 10% 8% [libx264 @ 0000000004360620] i4 v,h,dc,ddl,ddr,vr,hd,vl,hu: 19% 16% 15% 7% 10% 11% 8% 8% 7% [libx264 @ 0000000004360620] i8c dc,h,v,p: 51% 22% 19% 9% [libx264 @ 0000000004360620] Weighted P-Frames: Y:0.7% UV:0.0% [libx264 @ 0000000004360620] ref P L0: 63.4% 19.7% 11.0% 5.9% 0.0% [libx264 @ 0000000004360620] ref B L0: 90.7% 8.7% 0.7% [libx264 @ 0000000004360620] ref B L1: 98.4% 1.6% [libx264 @ 0000000004360620] kb/s:1524.54

    Read the article

  • How to configure a session timeout for Grails application?

    - by curd0
    In one of controllers in my Grails application I'm preserving a parameter value in a session variable like this: session.myVariable = params.myValue After that, I can access the saved value from different controllers/GSP-pages as long as I actively use the app. However, if I don't use my app for a while, even though my browser window is still open, the session variable looses it's value. Does this happens because the session expires? I was under impression that a session lives until the browser window is still open, but apparently I was wrong. What should I do to ensure all session variables I define in my Grails app don't expire until the browser is closed? Is there any way to set session timeout manually? Thank you in advance for your answers!

    Read the article

  • I keep getting a "System InvalidOperationException occurred in System Windows Forms dll" error in VB

    - by Heartrent
    I've just started learning VB.NET with VS 9.0; a small application I'm working on keeps returning an "A first chance exception of type System InvalidOperationException occurred in System Windows Forms dll" error from the Immediate Window. The application has almost zero functionality so far, it consists of a menu strip with: File About |Open |Save |Save As |Quit The only code I have written opens an Open File dialog, a Save As dialog, an About window with background sound and an OK button, and the Quit button which exits. Since there is almost no code for me to search through, I can't understand why there would be an error. The program runs just fine when I'm debugging it too.

    Read the article

  • How to run a powershell script within a DOS batch file

    - by Don Vince
    How do I have a powershell script embedded within the same file as a DOS batch script? I know this kind of thing is possible in other scenarios: Embedding SQL in a DOS batch script using sqlcmd and a clever arrangements of goto's and comments at the beginning of the file In a *nix environment having a the name of the program you wish to run the script with on the first line of the script commented out e.g. #!/usr/local/bin/python There may not be a way to do this - in which case I will have to call the separate powershell script from the launching DOS script. One possible solution I've considered is to echo out the powershell script, and then run it. A good reason to not do this is that part of the reason to attempt this is to be using the advantages of the powershell environment without the pain of, for example, DOS escape characters I have some unusual constraints and would like to find an elegant solution. I suspect this question may be baiting responses of the variety: "why don't you try and solve this different problem instead." Suffice to say these are my constraints, sorry about that. Any ideas? Is there a suitable combination of clever comments and escape characters that will enable me to achieve this? Some thoughts on how to achieve this: A carat ^ at the end of a line in DOS is a continuation - like an underscore in VB An ampersand & in DOS typically is used to separate commands echo Hello & echo World results in 2 echos on separate lines %0 will give you the script that's currently running So something like this (if I could make it work) would be good: # & call powershell -psconsolefile %0 # & goto :EOF /* From here on in we're running nice juicy powershell code */ Write-Output "Hello World" Except... It doesn't work... because the extension of the file isn't as per powershell's liking: Windows PowerShell console file "insideout.bat" extension is not psc1. Windows PowerShell console file extension must be psc1. DOS isn't really altogether happy with the situation either - although it does stumble on '#' is not recognized as an internal or external command, operable program or batch file.

    Read the article

  • How do I call a super class method

    - by KandadaBoggu
    I have two classes A, and B. Class B overrides the foo method of class A. Class B has a bar method where I want to call the foo method of the super class. What is the syntax for such a call? class A def foo "hello" end end class B def foo super + " world" end def bar # how to call the `foo` method of the super class? # something similar to super.foo end end

    Read the article

  • Bing Maps - how to link to a push pin from a link outside the map

    - by Rajah
    I have a Virtual Earth Maps (Bing Maps??) to which I have added a set of pushpins. Each pushpin is labelled 1 to n. In addition to adding pushpins to the map, I also add text to the web-page that contains the description to each pushpin. I would like to add a link to the text outside the map, that when clicked will open the balloon associated with the corresponding pushpin. How do I open the balloon associated with a pushpin, through a link that exists outside the map? To get a better understanding, look at my map: link. When you click load, PushPins are added to the map. I would like to have a link from the list on the right of the map, that opens the corresponding PushPin. Thanks in advance!

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • How do I use WMI with Delphi without drastically increasing the application's file size?

    - by Mick
    I am using Delphi 2010, and when I created a console application that prints "Hello World", it takes 111 kb. If I want to query WMI with Delphi, I add WBEMScripting_TLB, ActiveX, and Variants units to my project. If I perform a simple WMI query, my executable size jumps to 810 kb. I Is there anyway to query WMI without such a large addition to the size of the file? Forgive my ignorance, but why do I not have this issue with C++? Here is my code: program WMITest; {$APPTYPE CONSOLE} uses SysUtils, WBEMScripting_TLB, ActiveX, Variants; function GetWMIstring(wmiHost, root, wmiClass, wmiProperty: string): string; var Services: ISWbemServices; SObject: ISWbemObject; ObjSet: ISWbemObjectSet; SProp: ISWbemProperty; Enum: IEnumVariant; Value: Cardinal; TempObj: OLEVariant; loc: TSWbemLocator; SN: string; i: integer; begin Result := ''; i := 0; try loc := TSWbemLocator.Create(nil); Services := Loc.ConnectServer(wmiHost, root {'root\cimv2'}, '', '', '', '', 0, nil); ObjSet := Services.ExecQuery('SELECT * FROM ' + wmiClass, 'WQL', wbemFlagReturnImmediately and wbemFlagForwardOnly, nil); Enum := (ObjSet._NewEnum) as IEnumVariant; if not VarIsNull(Enum) then try while Enum.Next(1, TempObj, Value) = S_OK do begin try SObject := IUnknown(TempObj) as ISWBemObject; except SObject := nil; end; TempObj := Unassigned; if SObject <> nil then begin SProp := SObject.Properties_.Item(wmiProperty, 0); SN := SProp.Get_Value; if not VarIsNull(SN) then begin if varisarray(SN) then begin for i := vararraylowbound(SN, 1) to vararrayhighbound(SN, 1) do result := vartostr(SN[i]); end else Result := SN; Break; end; end; end; SProp := nil; except Result := ''; end else Result := ''; Enum := nil; Services := nil; ObjSet := nil; except on E: Exception do Result := e.message; end; end; begin try WriteLn('hello world'); WriteLn(GetWMIstring('.', 'root\CIMV2', 'Win32_OperatingSystem', 'Caption')); WriteLn('done'); except on E: Exception do Writeln(E.ClassName, ': ', E.Message); end; end.

    Read the article

  • flex combobox hide and show down arrow

    - by crazy horse
    I am looking to implement a search text box as follows: When user starts typing in and there are non-zero results, the text box will open up and display the results below it. When the user selects a result, the text box closed, but this time with a down-arrow (like a combobox) so that the user can re-open the list. I suspect what I really need is a combobox with ability to hide/show the down arrow. How do I do this in Flex? Thanks in advance.

    Read the article

  • How can I make the SmartGWT core smaller?

    - by Jon Anter
    I have recently written a Hello World application using SmartGWT and noticed that the size of the application is huge. In my case it is over 600kb just for that application. I think that size is obscene so I narrowed the culprit down to two core libraries, ISC_Core and ISC_Foundation which combine for a total size of 649kb. Is there anyway to reduce the bloat of these libraries? Any help would be appreciated.

    Read the article

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • How to develop my own sms Gateway ?

    - by waheed
    I intend to develop an SMS gateway in c#, but i am doubtful about it's feasibility, because my initial research had shown that an SMS gateway had to cover for protocol differences. So what exactly a gateway had to do, further if i use SMPP, so is it possible to send/receive SMS to/from any number in the world by simply using SMPP ?

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • cucumber, capybara & selenium works randomly

    - by user247479
    Setup with cucumber, capybara and selenium but some scenarios works only randomly. Running ruby 1.8.6 on rvm rails 2.3.8 selenium pops open firefox 3.6 I have tried to add this with no luck: with_scope(selector) do click_button(button) selenium.wait_for_page_to_load end The error output is sometimes: Given I am logged in and have created newsletter and subscribers # features/step_definitions/newsletter_send_steps.rb:108 end of file reached (EOFError) /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/protocol.rb:133:in sysread' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/protocol.rb:133:inrbuf_fill' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/timeout.rb:62:in timeout' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/timeout.rb:93:intimeout' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/protocol.rb:132:in rbuf_fill' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/protocol.rb:116:inreaduntil' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/protocol.rb:126:in readline' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/http.rb:2020:inread_status_line' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/http.rb:2009:in read_new' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/http.rb:1050:inrequest_without_fakeweb' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/http.rb:1037:in request_without_fakeweb' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/http.rb:543:instart' /Users/christianhager/.rvm/rubies/ruby-1.8.6-p399/lib/ruby/1.8/net/http.rb:1035:in request_without_fakeweb' ./features/step_definitions/web_steps.rb:24:in__instance_exec2' ./features/step_definitions/web_steps.rb:9:in with_scope' ./features/step_definitions/web_steps.rb:9:inwith_scope' ./features/step_definitions/web_steps.rb:23:in /^(?:|I )press "([^\"]*)"(?: within "([^\"]*)")?$/' features/enhanced/newsletter_send1.feature:7:inGiven I am logged in and have created newsletter and subscribers' And othertimes: no button with value or id or text 'create_user_button' found (Capybara::ElementNotFound) ./features/step_definitions/web_steps.rb:24:in __instance_exec2' ./features/step_definitions/web_steps.rb:9:inwith_scope' ./features/step_definitions/web_steps.rb:9:in with_scope' ./features/step_definitions/web_steps.rb:23:in/^(?:|I )press "([^\"])"(?: within "([^\"])")?$/' features/enhanced/newsletter_send1.feature:7:in `Given I am logged in and have created newsletter and subscribers' And sometimes it just works.... This is how my env.rb looks like ENV["RAILS_ENV"] ||= "cucumber" require File.expand_path(File.dirname(__FILE__) + '/../../config/environment') require 'cucumber/formatter/unicode' # Remove this line if you don't want Cucumber Unicode support require 'cucumber/rails/world' require 'cucumber/rails/active_record' require 'cucumber/web/tableish' require 'capybara/rails' require 'capybara/cucumber' require 'capybara/session' require 'cucumber/rails/capybara_javascript_emulation' require "selenium-webdriver" Capybara.default_driver = :selenium Capybara.default_wait_time = 5 Capybara.ignore_hidden_elements = false Capybara.default_selector = :css ActionController::Base.allow_rescue = false require 'database_cleaner' DatabaseCleaner.strategy = :truncation Before do Capybara.reset_sessions! DatabaseCleaner.clean end Cucumber::Rails::World.use_transactional_fixtures = false Cucumber-steps: Given I am on the signup page And I fill in "user_login" with "[email protected]" within "body" And I fill in "user_password" with "secret" within "body" And I fill in "user_password_confirmation" with "secret" within "body" And I check "terms_of_use" within "body" And I press "create_user_button" within "body" Any insight would be great :)

    Read the article

< Previous Page | 459 460 461 462 463 464 465 466 467 468 469 470  | Next Page >