Search Results

Search found 12327 results on 494 pages for 'attachment download'.

Page 467/494 | < Previous Page | 463 464 465 466 467 468 469 470 471 472 473 474  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • BULK INSERT from one table to another all on the server

    - by steve_d
    I have to copy a bunch of data from one database table into another. I can't use SELECT ... INTO because one of the columns is an identity column. Also, I have some changes to make to the schema. I was able to use the export data wizard to create an SSIS package, which I then edited in Visual Studio 2005 to make the changes desired and whatnot. It's certainly faster than an INSERT INTO, but it seems silly to me to download the data to a different computer just to upload it back again. (Assuming that I am correct that that's what the SSIS package is doing). Is there an equivalent to BULK INSERT that runs directly on the server, allows keeping identity values, and pulls data from a table? (as far as I can tell, BULK INSERT can only pull data from a file) Edit: I do know about IDENTITY_INSERT, but because there is a fair amount of data involved, INSERT INTO ... SELECT is kinda of slow. SSIS/BULK INSERT dumps the data into the table without regards to indexes and logging and whatnot, so it's faster. (Of course creating the clustered index on the table once it's populated is not fast, but it's still faster than the INSERT INTO...SELECT that I tried in my first attempt) Edit 2: The schema changes include (but are not limited to) the following: 1. Splitting one table into two new tables. In the future each will have its own IDENTITY column, but for the migration I think it will be simplest to use the identity from the original table as the identity for the both new tables. Once the migration is over one of the tables will have a one-to-many relationship to the other. 2. Moving columns from one table to another. 3. Deleting some cross reference tables that only cross referenced 1-to-1. Instead the reference will be a foreign key in one of the two tables. 4. Some new columns will be created with default values. 5. Some tables aren’t changing at all, but I have to copy them over due to the "put it all in a new DB" request.

    Read the article

  • iPhone: Create a single UIView from multiple clicks

    - by Cuzog
    I'm making a partial overlay modal in my app with the code from “Semi-Modal (Transparent) Dialogs on the iPhone” at ramin.firoozye.com. In doing so, the button that calls the modal is still visible and clickable. I will hide this button when the modal spawns, but I want to be sure if the user clicks very quickly twice, a new modal doesn't come up for each click. What is the best way to check that the modal doesn't already exist when calling it from the button click? You can download the test project here. For those that don't have xcode, the relevant functions are below: I call forth the modal on button click with this: - (IBAction)displayModal:(id)sender { ModalViewController *modalController = [[ModalViewController alloc] initWithNibName:@"ModalViewController" bundle:nil]; modalController.view.frame = CGRectOffset(modalController.view.frame, 0, 230); [self showModal:modalController.view]; } Then use this function to animate the custom modal over the current view: - (void)showModal:(UIView*) modalView { UIWindow* mainWindow = (((TestAppDelegate*) [UIApplication sharedApplication].delegate).window); CGPoint middleCenter = modalView.center; CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); modalView.center = offScreenCenter; // we start off-screen [mainWindow addSubview:modalView]; // Show it with a transition effect [UIView beginAnimations:nil context:nil]; [UIView setAnimationDuration:0.4]; // animation duration in seconds modalView.center = middleCenter; [UIView commitAnimations]; } Then I dismiss the modal on button click with this: - (IBAction)dismissModal:(id)sender { [self hideModal:self.view]; } And then use these functions to animate the modal offscreen and clean itself up: - (void)hideModal:(UIView*) modalView { CGSize offSize = [UIScreen mainScreen].bounds.size; CGPoint offScreenCenter = CGPointMake(offSize.width / 2.0, offSize.height * 1.5); [UIView beginAnimations:nil context:modalView]; [UIView setAnimationDuration:0.7]; [UIView setAnimationDelegate:self]; [UIView setAnimationDidStopSelector:@selector(hideModalEnded:finished:context:)]; modalView.center = offScreenCenter; [UIView commitAnimations]; } - (void)hideModalEnded:(NSString *)animationID finished:(NSNumber *)finished context:(void *)context { UIView* modalView = (UIView *)context; [modalView removeFromSuperview]; [self release]; } Any help is greatly appreciated!

    Read the article

  • Haskell data serialization of some data implementing a common type class

    - by Evan
    Let's start with the following data A = A String deriving Show data B = B String deriving Show class X a where spooge :: a -> Q [ Some implementations of X for A and B ] Now let's say we have custom implementations of show and read, named show' and read' respectively which utilize Show as a serialization mechanism. I want show' and read' to have types show' :: X a => a -> String read' :: X a => String -> a So I can do things like f :: String -> [Q] f d = map (\x -> spooge $ read' x) d Where data could have been [show' (A "foo"), show' (B "bar")] In summary, I wanna serialize stuff of various types which share a common typeclass so I can call their separate implementations on the deserialized stuff automatically. Now, I realize you could write some template haskell which would generate a wrapper type, like data XWrap = AWrap A | BWrap B deriving (Show) and serialize the wrapped type which would guarantee that the type info would be stored with it, and that we'd be able to get ourselves back at least an XWrap... but is there a better way using haskell ninja-ery? EDIT Okay I need to be more application specific. This is an API. Users will define their As, and Bs and fs as they see fit. I don't ever want them hacking through the rest of the code updating their XWraps, or switches or anything. The most i'm willing to compromise is one list somewhere of all the A, B, etc. in some format. Why? Here's the application. A is "Download a file from an FTP server." B is "convert from flac to mp3". A contains username, password, port, etc. information. B contains file path information. A and B are Xs, and Xs shall be called "Tickets." Q is IO (). Spooge is runTicket. I want to read the tickets off into their relevant data types and then write generic code that will runTicket on the stuff read' from the stuff on disk. At some point I have to jam type information into the serialized data.

    Read the article

  • Wordpress installed in root folder, subdomain now not working, GoDaddy host

    - by Kristin
    Hi, please forgive me for being a complete beginner at this, I'd rather not have to try to deal with this myself but as GoDaddy support have not replied after 2 days I'm going to have to. I think my problem is the same as the one above, but I'm not 100% sure, so I'm reposting it, I'm not really confident enough to attempt to try the fixes I've seen here so I need someone to give me baby instructions? Our original website (www.mwpics.com.au) was built in Dreamweaver etc, recently we created a new website in Wordpress, in a subdomain, then migrated it over to the root folder where it is now operating fine. I also moved the files for the old website into another directory which I called 'old', so they're all still there. The problem is that I have a subdomain set up - which is still showing as set up in the control panel on godaddy the url is www.mwpics.com.au/clients and it is at www.clients.mwpics.com.au. This directory contains loads of other directories, each of which is password protected by .htaccess files and which our clients access directly (not through the site) to download their finished work. The test one and the one for random clients is www.mwpics.com.au/clients/temp - username and password both temp (the usernames are all the same as the directory names). Since the WP install to the root directory the /clients extension no longer works (it should bring up an information page which is an .html index page in the directory) and the /clients/name extensions no longer works - it goes back to the wp site with a 'not found' error message. Strangely it does bring up the box for the username and password, but when you enter it it just goes back to the 'not found' message. Someone told me it was the .htaccess file - so as an experiment, I renamed the .htaccess file in the root directory and then copied the .htaccess file from the old root files into the root directory, eureka! It worked - and also the WP site opened to the home page... but bummer - the /pages in the WP site now no longer worked! But at least I know the source of the problem. So I switched it back and this is the status quo - I have no idea how to fix this, and with everyone back at work tomorrow, clients are going to want to start downloading their stuff... Can anyone help me? I'm starting to panic a bit

    Read the article

  • Using ImageMagick to create an image from a PDF...efficiently

    - by bigsweater
    I'm using ImageMagick to create a tiny JPG thumbnail image of an already-uploaded PDF. The code works fine. It's a WordPress widget, though this isn't necessarily WordPress specific. I'm unfamiliar with ImageMagick, so I was hoping somebody could tell me if this looks terrible or isn't following some best practices of some sort, or if I'm risking crashing the server. My questions, specifically, are: Is that image cached, or does the server have to re-generate the image every time somebody views the page? If it isn't cached, what's the best way to make sure the server doesn't have to regenerate the thumbnail? I tried to create a separate folder (/thumbs) for ImageMagick to put all the images in, instead of cluttering up the WP upload folders with images of PDFs. It kept throwing a permission error, despite 777 permissions on the folder in my testing environment. Why? Do the source/destination directories have to be the same? Am I doing anything incorrectly/inefficiently here that needs to be improved? The whole widget is on Pastebin: http://pastebin.com/WnSTEDm7 Relevant code: <?php if ( $url ) { $pdf = $url; $info = pathinfo($pdf); $filename = basename($pdf,'.'.$info['extension']); $uploads = wp_upload_dir(); $file_path = str_replace( $uploads['baseurl'], $uploads['basedir'], $url ); $dest_path = str_replace( '.pdf', '.jpg', $file_path ); $dest_url = str_replace( '.pdf', '.jpg', $pdf ); exec("convert \"{$file_path}[0]\" -colorspace RGB -geometry 60 $dest_path"); ?> <div class="entry"> <div class="widgetImg"> <p><a href="<?php echo $url; ?>" title="<?php echo $filename; ?>"><?php echo "<img src='".$dest_url."' alt='".$filename."' class='blueBorder' />"; ?></a></p> </div> <div class="widgetText"> <?php echo wpautop( $desc ); ?> <p><a class="downloadLink" href="<?php echo $url; ?>" title="<?php echo $filename; ?>">Download</a></p> </div> </div> <?php } ?> As you can see, the widget grabs whatever PDF is attached to the current page being viewed, creates an image of the first page of the PDF, stores it, then links to it in HTML. Thanks for any and all help!

    Read the article

  • Duplicate Blob field with foreach

    - by JGSilva
    I have some fields (blob) where I have uploaded some images. The images display correctly and I can open it without problem in Photoshop for example. I created a button where user can duplicate the product and everything works fine, but when it comes to duplicate the image entry I got some errors, like 1064 and others ones that I can't remember cause I am working 3 days inside this. Because de original product have 3 or more images I select then and gave an foreach. What I notice when a print de blob is that in the end it eats the next array, like if don't have an end. In other words, the next item got inside that utf-8 character in the print. That gave me some clue. The next approach was to save it in somewhere, and reupload it. The problem is that only the first one works. When I download the image saved, it opens normally so, it is not a saving in disk problem. When I gave a print in the $result, the same happens, is like the image is hungry and ate the next one. Here is the code. Notice = I created the [$count] to see if was not an rewrite in array error. Even tried to , in beging of the foreach, kind of clean the vars… $count=0; foreach ($original_image as $key => $val) { $count++; //$arquivo = ''; //$image = ''; //$file = ''; //$this->image = ''; //$return = ''; $arquivo[$count] = $val['pi_id'].'.'.$val['pi_type']; $image[$count] = $caminho_url.$arquivo[$count]; if (file_exists($image[$count])) { $this->image = Image::factory($image[$count]); $this->image->save($image[$count]); $file[$count]=mysql_real_escape_string(addslashes(fread(fopen($image[$count], "r"), filesize($image[$count])))); $return[$count] = Product::add_image($id_prod, $file[$count], $val['pi_type'],$val['pi_main']); }else { die('no'); } }

    Read the article

  • How to write my own global lock / unlock functions for PostgreSQL

    - by rafalmag
    I have postgresql (in perlu) function getTravelTime(integer, timestamp), which tries to select data for specified ID and timestamp. If there are no data or if data is old, it downloads them from external server (downloading time ~300ms). Multiple process use this database and this function. There is an error when two process do not find data and download them and try to do an insert to travel_time table (id and timestamp pair have to be unique). I thought about locks. Locking whole table would block all processes and allow only one to proceed. I need to lock only on id and timestamp. pg_advisory_lock seems to lock only in "current session". But my processes uses their own sessions. I tried to write my own lock/unlock functions. Am I doing it right? I use active waiting, how can I omit this? Maybe there is a way to use pg_advisory_lock() as global lock? My code: CREATE TABLE travel_time_locks ( id_key integer NOT NULL, time_key timestamp without time zone NOT NULL, UNIQUE (id_key, time_key) ); ------------ -- Function: mylock(integer, timestamp) DROP FUNCTION IF EXISTS mylock(integer, timestamp) CASCADE; -- Usage: SELECT mylock(1, '2010-03-28T19:45'); -- function tries to do a global lock similar to pg_advisory_lock(key, key) CREATE OR REPLACE FUNCTION mylock(id_input integer, time_input timestamp) RETURNS void AS $BODY$ DECLARE rows int; BEGIN LOOP BEGIN -- active waiting here !!!! :( INSERT INTO travel_time_locks (id_key, time_key) VALUES (id_input, time_input); EXCEPTION WHEN unique_violation THEN CONTINUE; END; EXIT; END LOOP; END; $BODY$ LANGUAGE 'plpgsql' VOLATILE COST 1; ------------ -- Function: myunlock(integer, timestamp) DROP FUNCTION IF EXISTS myunlock(integer, timestamp) CASCADE; -- Usage: SELECT myunlock(1, '2010-03-28T19:45'); -- function tries to do a global unlock similar to pg_advisory_unlock(key, key) CREATE OR REPLACE FUNCTION myunlock(id_input integer, time_input timestamp) RETURNS integer AS $BODY$ DECLARE BEGIN DELETE FROM ONLY travel_time_locks WHERE id_key=id_input AND time_key=time_input; RETURN 1; END; $BODY$ LANGUAGE 'plpgsql' VOLATILE COST 1;

    Read the article

  • Can I have a workspace that is both a git workspace and a svn workspace?

    - by Troy
    I have checked out now a local working copy of a codebase that lives in an svn repo. It's a big Java project that I use Eclipse to develop in. Eclipse of course builds everything on the fly, in it's own way with all the binaries ending up in [project root]/bin. That's perfectly fine with me, for development, but when the build runs on the build server, it looks quite a lot different (maven build, binaries end up in a different directory structure, etc). Sometimes I need to recreate the build server environment on my local development system to debug the build or what have you, so I usually end up downloading an entirely new working copy into a new workspace and running the build from there (prevents cluttering my development workspace with all the build artifacts and dirtying up the working copy). Of course sometimes I'm interested in running the full build on code that I don't want to check in yet, so I will manually copy over the "development" workspace onto the "build" workspace. Besides taking a lot of extra time copying a lot of files that I don't actually need (just overlaying the new over the old), this also screws up my svn metadata, meaning that I can't check in changes from that "build workspace" working copy, and I often end up having to re-download the code to get it back into a known state. So I'm thinking I make my svn working copy a local git repo, then "check out" the in-development code from the svn working copy/git master, into the local build workspace. Then I can build, revert my changes, have all the advantages of a version controlled working copy in the build workspace. Then if I need to make changes to the build, push those back into the git master (which is also a svn working copy), then check them into the main svn repo. |-------------| |main svn repo| <------- |---------------------| |-------------| |svn working copy | <------- |--------------------| | (svn dev workspace/ | | non-svn-versioned | | git master) | | build workspace | |---------------------| | (git working copy) | |--------------------| Just switching everything to git would obviously be better, but, big company, too many people using svn, too costly to change everything, etc. We're stuck with svn as the main repo for now. BTW, I know there is a maven plugin for Eclipse and everything, I'm mainly interested to know if there is a way to maintain a workspace that is both a git working copy and an svn working copy. Actually any distributed version control system would probably work (hg possibly?). Advice? How does everybody else handle this situation of having a to manage both a "development" build process and a "production" build process?

    Read the article

  • jQuery question from a person who can't javascript

    - by Evilalan
    So I'm trying to adapt this Dropdown menu on Joomla the styles work great as expected so I'll post the javascript includes on the head of my website: <script type='text/javascript' src='js/jquery.js'></script> <script type='text/javascript' src='js/dropdown.js'></script> <script type='text/javascript'> $(function() { $('.menu').droppy(); }); </script> <script type='text/javascript'> $(function() { $('.menu').droppy({speed: 100}); }); </script> ok I don't know why its is not working I'll post the dropdown.js should I post the jQuery too? it's really big! $.fn.droppy = function(options) { options = $.extend({speed: 250}, options || {}); this.each(function() { var root = this, zIndex = 1000; function getSubnav(ele) { if (ele.nodeName.toLowerCase() == 'li') { var subnav = $('> ul', ele); return subnav.length ? subnav[0] : null; } else { return ele; } } function getActuator(ele) { if (ele.nodeName.toLowerCase() == 'ul') { return $(ele).parents('li')[0]; } else { return ele; } } function hide() { var subnav = getSubnav(this); if (!subnav) return; $.data(subnav, 'cancelHide', false); setTimeout(function() { if (!$.data(subnav, 'cancelHide')) { $(subnav).slideUp(options.speed); } }, 500); } function show() { var subnav = getSubnav(this); if (!subnav) return; $.data(subnav, 'cancelHide', true); $(subnav).css({zIndex: zIndex++}).slideDown(options.speed); if (this.nodeName.toLowerCase() == 'ul') { var li = getActuator(this); $(li).addClass('hover'); $('> a', li).addClass('hover'); } } $('ul, li', this).hover(show, hide); $('li', this).hover( function() { $(this).addClass('hover'); $('> a', this).addClass('hover'); }, function() { $(this).removeClass('hover'); $('> a', this).removeClass('hover'); } ); }); }; My question here is: Why is it not working! I know that this is really complex (I don't anything about JavaScript) but if you help me I'll post a tutorial and edited files that will help a lot of people! By the way I've download jQuery from the original site so I don't think that this can be the problem! Thanks in advance!

    Read the article

  • How to get Augmented Reality: A Practical Guide examples working?

    - by Glen
    I recently bought the book: Augmented Reality: A Practical Guide (http://pragprog.com/titles/cfar/augmented-reality). It has example code that it says runs on Windows, MacOS and Linux. But I can't get the binaries to run. Has anyone got this book and got the binaries to run on ubuntu? I also can't figure out how to compile the examples in Ubuntu. How would I do this? Here is what it says to do: Compiling for Linux Refreshingly, there are no changes required to get the programs in this chapter to compile for Linux, but as with Windows, you’ll first have to find your GL and GLUT files. This may mean you’ll have to download the correct version of GLUT for your machine. You need to link in the GL, GLU, and GLUT libraries and provide a path to the GLUT header file and the files it includes. See whether there is a glut.h file in the /usr/include/GL directory; otherwise, look elsewhere for it—you could use the command find / -name "glut.h" to search your entire machine, or you could use the locate command (locate glut.h). You may need to customize the paths, but here is an example of the compile command: gcc -o opengl_template opengl_template.cpp -I /usr/include/GL -I /usr/include -lGL -lGLU -lglut gcc is a C/C++ compiler that should be present on your Linux or Unix machine. The -I /usr/include/GL command-line argument tells gcc to look in /usr/include/GL for the include files. In this case, you’ll find glut.h and what it includes. When linking in libraries with gcc, you use the -lX switch—where X is the name of your library and there is a correspond- ing libX.a file somewhere in your path. For this example, you want to link in the library files libGL.a, libGLU.a, and libglut.a, so you will use the gcc arguments -lGL -lGLU -lglut. These three files are found in the default directory /usr/lib/, so you don’t need to specify their location as you did with glut.h. If you did need to specify the library path, you would add -L to the path. To run your compiled program, type ./opengl_template or, if the current directory is in your shell’s paths, just opengl_template. When working in Linux, it’s important to know that you may need to keep your texture files to a maximum of 256 by 256 pixels or find the settings in your system to raise this limit. Often an OpenGL program will work in Windows but produce a blank white texture in Linux until the texture size is reduced. The above instructions make no sense to me. Do I have to use gcc to compile or can I use eclipse? If I use either eclipse or gcc what do I need to do to compile and run the program?

    Read the article

  • jquery ajax form success callback not being called

    - by Michael Merchant
    I'm trying to upload a file using "AJAX", process data in the file and then return some of that data to the UI so I can dynamically update the screen. I'm using the JQuery Ajax Form Plugin, jquery.form.js found at http://jquery.malsup.com/form/ for the javascript and using Django on the back end. The form is being submitted and the processing on the back end is going through without a problem, but when a response is received from the server, my Firefox browser prompts me to download/open a file of type "application/json". The file has the json content that I've been trying to send to the browser. I don't believe this is an issue with how I'm sending the json as I have a modularized json_wrapper() function that I'm using in multiple places in this same application. Here is what my form looks after Django templates are applied: <form method="POST" enctype="multipart/form-data" action="/test_suites/active/upload_results/805/"> <p> <label for="id_resultfile">Upload File:</label> <input type="file" id="id_resultfile" name="resultfile"> </p> </form> You won't see any submit buttons because I'm calling submit with a button else where and am using ajaxSubmit() from the jquery.form.js plugin. Here is the controlling javascript code: function upload_results($dialog_box){ $form = $dialog_box.find("form"); var options = { type: "POST", success: function(data){ alert("Hello!!"); }, dataType: "json", error: function(){ console.log("errors"); }, beforeSubmit: function(formData, jqForm, options){ console.log(formData, jqForm, options); }, } $form.submit(function(){ $(this).ajaxSubmit(options); return false; }); $form.ajaxSubmit(options); } As you can see, I've gotten desperate to see the success callback function work and simply have an alert message created on success. However, we never reach that call. Also, the error function is not called and the beforeSubmit function is executed. The file that I get back has the following contents: {"count": 18, "failed": 0, "completed": 18, "success": true, "trasaction_id": "SQEID0.231"} I use 'success' here to denote whether or not the server was able to run the post command adequately. If it failed the result would look something like: {"success": false, "message":"<error_message>"} Your time and help is greatly appreciated. I've spent a few days on this now and would love to move on.

    Read the article

  • Browsers (IE and Firefox) freeze when copying large amount of text

    - by Matt
    I have a web application - a Java servlet - that delivers data to users in the form of a text printout in a browser (text marked up with HTML in order to display in the browser as we want it to). The text does display in different colors, though most of it is black. One typical mode of operation is this: 1. User submits a form to request data. 2. Servlet delivers HTML file to browser. 3. User does CTRL+A to select all the text. 4. User does CTRL+C to copy all the text. 5. User goes to a text editor and does CTRL+V to paste the text. In the testing where I'm having this problem, step #2 successfully loads all the data - we wait for that to complete. We can scroll down to the end of what the browser loaded and see the end of the data. However, the browser freezes on step #3 (Firefox) or on step #4 (IE). Because step #2 finishes, I think it is a browser/memory issue, and not an issue with the web application. If I run queries to deliver smaller amounts of data (but after several queries we get the same data we would have above in one query) and copy/paste this text, the file I save it into ends up being about 8 MB. If I save the browser's displayed HTML to a file on my computer via File-Save As from the browser menu, it works fine and the file is about 22 MB. We've tried this on 2 different computers at work (both running Windows XP, with at least 2 GB of RAM and many GB of free disk space), using Firefox and IE. We also tried it on a home computer from a home network outside of work (thinking it might be our IT security software causing the problem), running Windows 7 using IE, and still had the problem. When I've done this, I can see whatever browser I'm using utilizing the CPU at 50%. Firefox's memory usage grows to about 1 GB; IE's stays in the several hundred MBs. We once let this run for half an hour, and it did not complete. I'm most likely going to modify the web app to have an option of delivering a plain text file for download, and I imagine that will get the users what they need. But for the mean time, and because I'm curious - and I don't like my application freezing people's browsers, does anyone have any ideas about the browser freezing? I understand that sometimes you just reach your memory limit, but 22 MB sounds to me like an amount I should be able to copy to the clipboard.

    Read the article

  • NVIDIA graphics driver in Ubuntu 12.04

    - by user924501
    So my overall goal is that I want to be able to code with CUDA enabled applications. However, upon many days of searching, using installation walkthroughs, and reinstalling countless times after driver failure... I'm now here as a last resort. I cannot get Ubuntu 12.04 LTS to install the NVIDIA 295.59 driver for my GeForce GT 540M NVIDIA graphics card. My main system specs is as follows... (I believe having the Intel processor may be the problem) DELL Laptop XPS L502X Intel® Core™ i7-2620M CPU @ 2.70GHz × 4 Intel Integrated Graphics 64 bit NVIDIA GeForce GT 540M Ubuntu 12.04 LTS All other specs are irrelevant unless I forgot something? Methods Tried: aptitude install nvidia-current (all packages) Results: Nothing really happened. Nothing in the additional drivers menu appeared, nor was the NVIDIA X Server settings application allowing access because it thought there was no NVIDIA X Server installed. Downloaded driver from nvidia.com. Set nomodeset in the grub boot menu through /boot/grub/grub.cfg Went to console and turned off lightdm. Installed the driver, but it said the pre-install failed? (mean anything?) Started up lightdm again. Results: NVIDIA X Server settings still didn't notice it. Even tried to do nvidia-xconfig multiple times. I also went into the config file to make sure the driver setting said "nvidia". aptitude install nvidia-173 (all packages) Results: Couldn't find the xorg-video-abi-10 virtual package. It was nowhere to be found and the ubuntu forums everywhere had no answers. Lots of people were having this problem. This is easily done in windows, simply download the driver and debug in visual studio with no problems at all. I'd like clear step-by-step instructions on how I should go about this. I'm relatively new to linux but I can find my way around pretty well so you aren't talking to a straight-up beginner. Also, if you think another thread may have the answer please post because I was having a hard time looking for my specific type of problem. TL;DR I want to have access to my GPU so I can code with CUDA while in Ubuntu 12.04 on my 64 bit laptop that also has Intel integrated graphics on the processor. Solution: sudo apt-add-repository ppa:ubuntu-x-swat/x-updates && sudo apt-get update && sudo apt-get upgrade && sudo apt-get install nvidia-current

    Read the article

  • Hoe to convert a JSON array of paths to images stored on a server into a javaScript array to display them? Using AJAX

    - by MichaelF
    I need for html file/ ajax code to take the JSON message and store the PATHS as a javaScript array. Then my buildImage function can display the first image in the array. I'm new to AJAX and believe my misunderstanding lies within the converting of the JSON to Javascript. I'm confused also about if my code creates a JSON array or object or either. I might need also to download a library to my app to understand JSON? Below is a PHP file loading the paths of the images. I believe json ecode is converting the PHP Array in a Json message. <?php include("mysqlconnect.php"); $select_query = "SELECT `ImagesPath` FROM `offerstbl` ORDER by `ImagesId` DESC"; $sql = mysql_query($select_query) or die(mysql_error()); $data = array(); while($row = mysql_fetch_array($sql,MYSQL_BOTH)){ $data[] = $row['ImagesPath']; } echo $images = json_encode($data); ?> Below is the script in is going to be loaded on an Cordova app. <!DOCTYPE html> <html> <head> <link rel="stylesheet" href="css/styles.css"> <link rel="stylesheet" href="css/cascading.css"> <script> function importJson(str) { // console.log(typeof xmlhttp.responseText); if (str=="") { document.getElementById("content").innerHTML=""; return; } if (window.XMLHttpRequest) { // code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else { // code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.onreadystatechange=function() { if (xmlhttp.readyState==4) { //var images = JSON.parse(xmlhttp.responseText); document.getElementById("content").innerHTML=xmlhttp.responseText; } } xmlhttp.open("GET","http://server/content.php"); xmlhttp.send(); } function buildImage(src) { var img = document.createElement('img') img.src = src alert("1"); document.getElementById('content').appendChild(img); } for (var i = 0; i < images.length; i++) { buildImage(images[i]); } </script> </head> <body onload= "importJson();"> <div class="contents" id="content" ></div> <img src="img/logo.png" height="10px" width="10px" onload= "buildImage();"> </body>

    Read the article

  • sys.path() and PYTHONPATH issues

    - by Justin
    I've been learning Python, I'm working in 2.7.3, and I'm trying to understand import statements. The documentation says that when you attempt to import a module, the interpreter will first search for one of the built-in modules. What is meant by a built-in module? Then, the documentation says that the interpreter searches in the directories listed by sys.path, and that sys.path is initialized from these sources: the directory containing the input script (or the current directory). PYTHONPATH (a list of directory names, with the same syntax as the shell variable PATH). the installation-dependent default. Here is a sample output of a sys.path command from my computer using python in command-line mode: (I deleted a few so that it wouldn't be huge) ['', '/usr/lib/python2.7', '/usr/lib/python2.7/lib-old', '/usr/lib/python2.7/lib-dynload', '/usr/local/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages', '/usr/lib/python2.7/dist-packages/PIL', '/usr/lib/python2.7/dist-packages/gst-0.10', '/usr/lib/python2.7/dist-packages/gtk-2.0', '/usr/lib/pymodules/python2.7', '/usr/lib/python2.7/dist-packages/ubuntuone-couch', '/usr/lib/python2.7/dist-packages/ubuntuone-storage-protocol'] Now, I'm assuming that the '' path refers to the directory containing the 'script', and so I figured the rest of them would be coming from my PYTHONPATH environmental variable. However, when I go to the terminal and type env, PYTHONPATH doesn't exist as an environmental variable. I also tried import os then os.environ, but I get the same output. Do I really not have a PYTHONPATH environmental variable? I don't believe I ever specifically defined a PYTHONPATH environmental variable, but I assumed that when I installed new packages they automatically altered that environment variable. If I don't have a PYTHONPATH, how is my sys.path getting populated? If I download new packages, how does Python know where to look for them if I don't have this PYTHONPATH variable? How do environment variables work? From what I understand, environment variables are specific to the process for which they are set, however, if I open multiple terminal windows and run env, they all display a number of identical variables, for example, PATH. I know there file locations for persistent environment variables, for example /etc/environment, which contains my PATH variable. Is it possible to tell where a persistent environment variable is stored? What is the recommended location for storing new persistent environment variables? How do environment variables actually work with say, the Python interpreter? The Python interpreter looks for PYTHONPATH, but how does it work at the nitty-gritty level?

    Read the article

  • PHP, PEAR, and oci8 configuration

    - by zack_falcon
    I'll make this quick. I installed Oracle 11g (with appropriate database, users, etc), Apache 2.4.6, and PHP 5.5.4 on a Fedora 19 system. I wanted to connect PHP to Oracle. What I really wanted to do was to download MDB2_Driver_oci8, which I thought would be easy, but before I can do such a thing, PHP needs to have that plug-in enabled, so here's what I did: Tried to install oci8 via the following: pecl install oci8 When that didn't exactly work the first few times, I figured out I, for some reason, needed "Development tools" - via yum groupinstall "Development Tools" Then I figured out later that PHP actually doesn't do oci8 - it's PHP Devel. So, I had to install that too, via yum install php-devel. And then, I finally got to install oci8. It asked for the Oracle Directory, and that was that. But it said the following: Configuration option 'php_ini' is not set to php.ini location You should add 'extensions=oci8.so' to php.ini First, I did a locate oci8.so - found it in /usr/lib64/php/modules/ Second, I added what it told me to, to the php.ini file. Third, I checked the usual php_info() test page - no mention of OCI8. Uh-oh. Fourth, running both php -i and php -m listed oci8 as one of the modules. Weird. In desperation, I went ahead and downloaded the MDB2_Driver_oci8. Maybe that will fix things. Nope. When I loaded my PHP Webpage, it returned the following: Error message: extension oci8 is not compiled into PHP As well as: MDB2 error: not found Strange. And then I decided to check the error logs: PHP Startup - unable to load dynamic library '/usr/lib64/php/modules/oci8.so' - libclntsh.so.11.1: cannot open shared object file: No such file or directory in Unknown on line 0 And now I'm stuck. I tried going into the php.ini, and found that the extension_dir was commented out. I put it back in, which only seemed to break stuff. Things of note: I followed this (link) guide on how to configure PHP and install oci8. ./configure --with-oci8 doesn't work. Fedora says no such directory. As both the webpage files and the actual server reside on the same PC, I did not install the Oracle Client files. The extension_dir is commented out by default in the php.ini. This is just one of my problems in a long line of problems concerning the replication of an already existing and working, but dying, setup. It seems whenever I want to solve a problem, I have to do X first. And by doing X, I uncover another problem, which I have to solve by doing Y, which has its own problems, etc, etc. Any help would be much appreciated. Thanks.

    Read the article

  • Allow users to pull temporary data then delete table?

    - by JM4
    I don't know the best way to title this question but am trying to accomplish the following goal: When a client logs into their profile, they are presented with a link to download data from an existing database in CSV format. The process works, however, I would like for this data to be 'fresh' each time they click the link so my plan was - once a user has clicked the link and downloaded the CSV file, the database table would 'erase' all of its data and start fresh (be empty) until the next set of data populated it. My EXISTING CSV creation code: <?php $host = 'localhost'; $user = 'username'; $pass = 'password'; $db = 'database'; $table = 'tablename'; $file = 'export'; $link = mysql_connect($host, $user, $pass) or die("Can not connect." . mysql_error()); mysql_select_db($db) or die("Can not connect."); $result = mysql_query("SHOW COLUMNS FROM ".$table.""); $i = 0; if (mysql_num_rows($result) > 0) { while ($row = mysql_fetch_assoc($result)) { $csv_output .= $row['Field'].", "; $i++; } } $csv_output .= "\n"; $values = mysql_query("SELECT * FROM ".$table.""); while ($rowr = mysql_fetch_row($values)) { for ($j=0;$j<$i;$j++) { $csv_output .= '"'.$rowr[$j].'",'; } $csv_output .= "\n"; } $filename = $file."_".date("Y-m-d",time()); header("Content-type: application/vnd.ms-excel"); header("Content-disposition: csv" . date("Y-m-d") . ".csv"); header( "Content-disposition: filename=".$filename.".csv"); print $csv_output; exit; ?> any ideas?

    Read the article

  • MEF C# Service - DLL Updating

    - by connerb
    Currently, I have a C# service that runs off of many .dll's and has modules/plugins that it imports at startup. I would like to create an update system that basically stops the service, deletes any files it is told to delete (old versions), downloads new versions from a server, and starts the service. I believe I have coded this right except for the delete part, because as long as I am not overwriting anything, the file will download. If I try to overwrite something, it won't work, which is why I am trying to delete it before hand. However, when I do File.Delete() to the path that I want to do, it gives me access to the path is denied. Here is my code: new Thread(new ThreadStart(() => { ServiceController controller = new ServiceController("client"); controller.Stop(); controller.WaitForStatus(ServiceControllerStatus.Stopped); try { if (um.FilesUpdated != null) { foreach (FilesUpdated file in um.FilesUpdated) { if (file.OldFile != null) { File.Delete(Path.Combine(Utility.AssemblyDirectory, file.OldFile)); } if (file.NewFile != null) { wc.DownloadFile(cs.UpdateUrl + "/updates/client/" + file.NewFile, Path.Combine(Utility.AssemblyDirectory, file.NewFile)); } } } if (um.ModulesUpdated != null) { foreach (ModulesUpdated module in um.ModulesUpdated) { if (module.OldModule != null) { File.Delete(Path.Combine(cs.ModulePath, module.OldModule)); } if (module.NewModule != null) { wc.DownloadFile(cs.UpdateUrl + "/updates/client/modules/" + module.NewModule, Path.Combine(cs.ModulePath, module.NewModule)); } } } } catch (Exception ex) { Logger.log(ex); } controller.Start(); })).Start(); I believe it is because the files are in use, but I can't seem to unload them. I though stopping the service would work, but apparently not. I have also checked the files and they are not read-only (but the folder is, which is located in Program Files, however I couldn't seem to get it to not be read-only programmatically or manually). The service is also being run as an administrator (NT AUTHORITY\SYSTEM). I've read about unloading the AppDomain but AppDomain.Unload(AppDomain.CurrentDomain); returned an exception as well. Not too sure even if this is a problem with MEF or my program just not having the correct permissions...I would assume that it's mainly because the file is in use.

    Read the article

  • Allow users to pull temporary data then delete table data (headers remain)?

    - by JM4
    I don't know the best way to title this question but am trying to accomplish the following goal: When a client logs into their profile, they are presented with a link to download data from an existing database in CSV format. The process works, however, I would like for this data to be 'fresh' each time they click the link so my plan was - once a user has clicked the link and downloaded the CSV file, the database table would 'erase' all of its data and start fresh (be empty) until the next set of data populated it. My EXISTING CSV creation code: <?php $host = 'localhost'; $user = 'username'; $pass = 'password'; $db = 'database'; $table = 'tablename'; $file = 'export'; $link = mysql_connect($host, $user, $pass) or die("Can not connect." . mysql_error()); mysql_select_db($db) or die("Can not connect."); $result = mysql_query("SHOW COLUMNS FROM ".$table.""); $i = 0; if (mysql_num_rows($result) > 0) { while ($row = mysql_fetch_assoc($result)) { $csv_output .= $row['Field'].", "; $i++; } } $csv_output .= "\n"; $values = mysql_query("SELECT * FROM ".$table.""); while ($rowr = mysql_fetch_row($values)) { for ($j=0;$j<$i;$j++) { $csv_output .= '"'.$rowr[$j].'",'; } $csv_output .= "\n"; } $filename = $file."_".date("Y-m-d",time()); header("Content-type: application/vnd.ms-excel"); header("Content-disposition: csv" . date("Y-m-d") . ".csv"); header( "Content-disposition: filename=".$filename.".csv"); print $csv_output; exit; ?> any ideas?

    Read the article

  • app-engine-rest-server to raise KeyError("name %s already used" % model_name)

    - by fx
    I'm playing with the project appengine-rest-server to create the REST webservices for all the existing models. I got a strange error, the first time I query the browser: http://localhost:8080/rest/metadata/user, it gives me the result: <xs:schema> - <xs:element name="user"> - <xs:complexType> - <xs:sequence> <xs:element maxOccurs="1" minOccurs="0" name="key" type="xs:normalizedString"/> <xs:element maxOccurs="1" minOccurs="0" name="surname" type="xs:string"/> <xs:element maxOccurs="1" minOccurs="0" name="firstname" type="xs:string"/> <xs:element maxOccurs="1" minOccurs="0" name="ages" type="xs:long"/> <xs:element maxOccurs="1" minOccurs="0" name="sex" type="xs:boolean"/> <xs:element maxOccurs="1" minOccurs="0" name="updatedDate" type="xs:dateTime"/> <xs:element maxOccurs="1" minOccurs="0" name="createdDate" type="xs:dateTime"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> But refreshing the page, gives me this error: Traceback (most recent call last): File "/Users/foo/Documents/AppEngine/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/tools/dev_appserver.py", line 3185, in _HandleRequest self._Dispatch(dispatcher, self.rfile, outfile, env_dict) File "/Users/foo/Documents/AppEngine/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/tools/dev_appserver.py", line 3128, in _Dispatch base_env_dict=env_dict) File "/Users/foo/Documents/AppEngine/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/tools/dev_appserver.py", line 515, in Dispatch base_env_dict=base_env_dict) File "/Users/foo/Documents/AppEngine/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/tools/dev_appserver.py", line 2387, in Dispatch self._module_dict) File "/Users/foo/Documents/AppEngine/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/tools/dev_appserver.py", line 2297, in ExecuteCGI reset_modules = exec_script(handler_path, cgi_path, hook) File "/Users/foo/Documents/AppEngine/GoogleAppEngineLauncher.app/Contents/Resources/GoogleAppEngine-default.bundle/Contents/Resources/google_appengine/google/appengine/tools/dev_appserver.py", line 2195, in ExecuteOrImportScript script_module.main() File "/Users/foo/Documents/AppEngine/helloworld/main.py", line 48, in main rest.Dispatcher.add_models({"user": UserModel}) File "/Users/foo/Documents/AppEngine/helloworld/rest/__init__.py", line 845, in add_models cls.add_model(model_name, model_type) File "/Users/foo/Documents/AppEngine/helloworld/rest/__init__.py", line 863, in add_model raise KeyError("name %s already used" % model_name) KeyError: 'name user already used' Can someone give me the explanation on why it happens? Restarting the server, run on the browser again I get the xml result, but refreshing causes the error. Is it a bug in the appengine-rest-server application or it is in my code? My helloworld application is available for download here.

    Read the article

  • SSH X11 not working

    - by azat
    I have a home and work computer, the home computer has a static IP address. If I ssh from my work computer to my home computer, the ssh connection works but X11 applications are not displayed. In my /etc/ssh/sshd_config at home: X11Forwarding yes X11DisplayOffset 10 X11UseLocalhost yes At work I have tried the following commands: xhost + home HOME_IP ssh -X home ssh -X HOME_IP ssh -Y home ssh -Y HOME_IP My /etc/ssh/ssh_config at work: Host * ForwardX11 yes ForwardX11Trusted yes My ~/.ssh/config at work: Host home HostName HOME_IP User azat PreferredAuthentications password ForwardX11 yes My ~/.Xauthority at work: -rw------- 1 azat azat 269 Jun 7 11:25 .Xauthority My ~/.Xauthority at home: -rw------- 1 azat azat 246 Jun 7 19:03 .Xauthority But it doesn't work After I make an ssh connection to home: $ echo $DISPLAY localhost:10.0 $ kate X11 connection rejected because of wrong authentication. X11 connection rejected because of wrong authentication. X11 connection rejected because of wrong authentication. X11 connection rejected because of wrong authentication. X11 connection rejected because of wrong authentication. X11 connection rejected because of wrong authentication. X11 connection rejected because of wrong authentication. X11 connection rejected because of wrong authentication. kate: cannot connect to X server localhost:10.0 I use iptables at home, but I've allowed port 22. According to what I've read that's all I need. UPD. With -vvv ... debug2: callback start debug2: x11_get_proto: /usr/bin/xauth list :0 2/dev/null debug1: Requesting X11 forwarding with authentication spoofing. debug2: channel 1: request x11-req confirm 1 debug2: client_session2_setup: id 1 debug2: fd 3 setting TCP_NODELAY debug2: channel 1: request pty-req confirm 1 ... When try to launch kate: debug1: client_input_channel_open: ctype x11 rchan 2 win 65536 max 16384 debug1: client_request_x11: request from 127.0.0.1 55486 debug2: fd 8 setting O_NONBLOCK debug3: fd 8 is O_NONBLOCK debug1: channel 2: new [x11] debug1: confirm x11 debug2: X11 connection uses different authentication protocol. X11 connection rejected because of wrong authentication. debug2: X11 rejected 2 i0/o0 debug2: channel 2: read failed debug2: channel 2: close_read debug2: channel 2: input open - drain debug2: channel 2: ibuf empty debug2: channel 2: send eof debug2: channel 2: input drain - closed debug2: channel 2: write failed debug2: channel 2: close_write debug2: channel 2: output open - closed debug2: X11 closed 2 i3/o3 debug2: channel 2: send close debug2: channel 2: rcvd close debug2: channel 2: is dead debug2: channel 2: garbage collecting debug1: channel 2: free: x11, nchannels 3 debug3: channel 2: status: The following connections are open: #1 client-session (t4 r0 i0/0 o0/0 fd 5/6 cc -1) #2 x11 (t7 r2 i3/0 o3/0 fd 8/8 cc -1) # The same as above repeate about 7 times kate: cannot connect to X server localhost:10.0 UPD2 Please provide your Linux distribution & version number. Are you using a default GNOME or KDE environment for X or something else you customized yourself? azat:~$ kded4 -version Qt: 4.7.4 KDE Development Platform: 4.6.5 (4.6.5) KDE Daemon: $Id$ Are you invoking ssh directly on a command line from a terminal window? What terminal are you using? xterm, gnome-terminal, or? How did you start the terminal running in the X environment? From a menu? Hotkey? or ? From terminal emulator `yakuake` Manualy press `Ctrl + N` and write commands Can you run xeyes from the same terminal window where the ssh -X fails? `xeyes` - is not installed But `kate` or another kde app is running Are you invoking the ssh command as the same user that you're logged into the X session as? From the same user UPD3 I also download ssh sources, and using debug2() write why it's report that version is different It see some cookies, and one of them is empty, another is MIT-MAGIC-COOKIE-1

    Read the article

  • Trying to update debian not working

    - by Sean
    As root i type this command apt-get update and get these error messages. > Err http://security.debian.org lenny/updates Release.gpg Could not resolve 'security.debian.org' Err http://security.debian.org lenny/updates/main Translation-en_US Could not resolve 'security.debian.org' Err http://security.debian.org lenny/updates/contrib Translation-en_US Could not resolve 'security.debian.org' Err http://security.debian.org lenny/updates/non-free Translation-en_US Could not resolve 'security.debian.org' Err http://www.backports.org lenny-backports Release.gpg Could not resolve 'www.backports.org' Err http://www.backports.org lenny-backports/main Translation-en_US Could not resolve 'www.backports.org' Err http://www.backports.org lenny-backports/contrib Translation-en_US Could not resolve 'www.backports.org' Err http://www.backports.org lenny-backports/non-free Translation-en_US Could not resolve 'www.backports.org' Err http://ftp.us.debian.org lenny Release.gpg Could not resolve 'ftp.us.debian.org' Err http://ftp.us.debian.org lenny/main Translation-en_US Could not resolve 'ftp.us.debian.org' Err http://ftp.us.debian.org lenny/contrib Translation-en_US Could not resolve 'ftp.us.debian.org' Err http://ftp.us.debian.org lenny/non-free Translation-en_US Could not resolve 'ftp.us.debian.org' Err http://http.us.debian.org stable Release.gpg Could not resolve 'http.us.debian.org' Err http://http.us.debian.org stable/main Translation-en_US Could not resolve 'http.us.debian.org' Err http://http.us.debian.org stable/contrib Translation-en_US Could not resolve 'http.us.debian.org' Err http://http.us.debian.org stable/non-free Translation-en_US Could not resolve 'http.us.debian.org' Reading package lists... Done W: Failed to fetch http://ftp.us.debian.org/debian/dists/lenny/Release.gpg Could not resolve 'ftp.us.debian.org' W: Failed to fetch http://ftp.us.debian.org/debian/dists/lenny/main/i18n/Translation-en_US.gz Could not resolve 'ftp.us.debian.org' W: Failed to fetch http://ftp.us.debian.org/debian/dists/lenny/contrib/i18n/Translation-en_US.gz Could not resolve 'ftp.us.debian.org' W: Failed to fetch http://ftp.us.debian.org/debian/dists/lenny/non-free/i18n/Translation-en_US.gz Could not resolve 'ftp.us.debian.org' W: Failed to fetch http://http.us.debian.org/debian/dists/stable/Release.gpg Could not resolve 'http.us.debian.org' W: Failed to fetch http://http.us.debian.org/debian/dists/stable/main/i18n/Translation-en_US.gz Could not resolve 'http.us.debian.org' W: Failed to fetch http://http.us.debian.org/debian/dists/stable/contrib/i18n/Translation-en_US.gz Could not resolve 'http.us.debian.org' W: Failed to fetch http://http.us.debian.org/debian/dists/stable/non-free/i18n/Translation-en_US.gz Could not resolve 'http.us.debian.org' W: Failed to fetch http://security.debian.org/dists/lenny/updates/Release.gpg Could not resolve 'security.debian.org' W: Failed to fetch http://security.debian.org/dists/lenny/updates/main/i18n/Translation-en_US.gz Could not resolve 'security.debian.org' W: Failed to fetch http://security.debian.org/dists/lenny/updates/contrib/i18n/Translation-en_US.gz Could not resolve 'security.debian.org' W: Failed to fetch http://security.debian.org/dists/lenny/updates/non-free/i18n/Translation-en_US.gz Could not resolve 'security.debian.org' W: Failed to fetch http://www.backports.org/debian/dists/lenny-backports/Release.gpg Could not resolve 'www.backports.org' W: Failed to fetch http://www.backports.org/debian/dists/lenny-backports/main/i18n/Translation-en_US.gz Could not resolve 'www.backports.org' W: Failed to fetch http://www.backports.org/debian/dists/lenny-backports/contrib/i18n/Translation-en_US.gz Could not resolve 'www.backports.org' W: Failed to fetch http://www.backports.org/debian/dists/lenny-backports/non-free/i18n/Translation-en_US.gz Could not resolve 'www.backports.org' W: Some index files failed to download, they have been ignored, or old ones used instead. W: You may want to run apt-get update to correct these problems This is on a dreamplug linux server. Configured so that my network starts on 192.168.1.2 and my router is port forwarding ssh to 192.168.1.6 to the server.

    Read the article

  • Trouble with dns and debian update

    - by Sean
    I tried to update my debian dreamplug server with the command running as root apt-get update and recieved these errors. Err http://security.debian.org lenny/updates Release.gpg Could not resolve 'security.debian.org' Err htdtp://security.debian.org lenny/updates/main Translation-en_US Could not resolve 'security.debian.org' Err htdtp://security.debian.org lenny/updates/contrib Translation-en_US Could not resolve 'security.debian.org' Err htdtp://security.debian.org lenny/updates/non-free Translation-en_US Could not resolve 'security.debian.org' Err httdp://www.backports.org lenny-backports Releasegpg Could not resolve 'www.backports.org' Err httdp://www.backports.org lenny-backports/main Translation-en_US Could not resolve 'www.backports.org' Err httdp://www.backports.org lenny-backports/contrib Translation-en_US Could not resolve 'www.backports.org' Err httdp://www.backports.org lenny-backports/non-free Translation-en_US Could not resolve 'www.backports.org' Err httdp://ftp.us.debian.org lenny Release.gpg Could not resolve 'ftp.us.debian.org' Err httdp://ftp.us.debian.org lenny/main Translation-en_US Could not resolve 'ftp.us.debian.org' Err httdp://ftp.us.debian.org lenny/contrib Translation-en_US Could not resolve 'ftp.us.debian.org' Err httdp://ftp.us.debian.org lenny/non-free Translation-en_US Could not resolve 'ftp.us.debian.org' Err httdp://http.us.debian.org stable Release.gpg Could not resolve 'http.us.debian.org' Err htdtp://http.us.debian.org stable/main Translation-en_US Could not resolve 'http.us.debian.org' Err httdp://http.us.debian.org stable/contrib Translation-en_US Could not resolve 'http.us.debian.org' Err htdtp://http.us.debian.org stable/non-free Translation-en_US Could not resolve 'http.us.debian.org' Reading package lists... Done W: Failed to fetch ttp://ftp.us.debian.org/debian/dists/lenny/Release.gpg Could not resolve 'ftp.us.debian.org' W: Failed to fetch ttp://ftp.us.debian.org/debian/dists/lenny/main/i18n/Translation-en_US.gz Could not resolve 'ftp.us.debian.org' W: Failed to fetch ttp://ftp.us.debian.org/debian/dists/lenny/contrib/i18n/Translation-en_US.gz Could not resolve 'ftp.us.debian.org' W: Failed to fetch ttp://ftp.us.debian.org/debian/dists/lenny/non-free/i18n/Translation-en_US.gz Could not resolve 'ftp.us.debian.org' W: Failed to fetch ttp://http.us.debian.org/debian/dists/stable/Release.gpg Could not resolve 'http.us.debian.org' W: Failed to fetch ttp://http.us.debian.org/debian/dists/stable/main/i18n/Translation-en_US.gz Could not resolve 'http.us.debian.org' W: Failed to fetch ttp://http.us.debian.org/debian/dists/stable/contrib/i18n/Translation-en_US.gz Could not resolve 'http.us.debian.org' W: Failed to fetch ttp://http.us.debian.org/debian/dists/stable/non-free/i18n/Translation-en_US.gz Could not resolve 'http.us.debian.org' W: Failed to fetch ttp://security.debian.org/dists/lenny/updates/Release.gpg Could not resolve 'security.debian.org' W: Failed to fetch ttp://security.debian.org/dists/lenny/updates/main/i18n/Translation-en_US.gz Could not resolve 'security.debian.org' W: Failed to fetch ttp://security.debian.org/dists/lenny/updates/contrib/i18n/Translation-en_US.gz Could not resolve 'security.debian.org' W: Failed to fetch ttp://security.debian.org/dists/lenny/updates/non-free/i18n/Translation-en_US.gz Could not resolve 'security.debian.org' W: Failed to fetch ttp://www.backports.org/debian/dists/lenny-backports/Release.gpg Could not resolve 'www.backports.org' W: Failed to fetch ttp://www.backports.org/debian/dists/lenny-backports/main/i18n/Translation-en_US.gz Could not resolve 'www.backports.org' W: Failed to fetch ttp://www.backports.org/debian/dists/lenny-backports/contrib/i18n/Translation-en_US.gz Could not resolve 'www.backports.org' W: Failed to fetch ttp://www.backports.org/debian/dists/lenny-backports/non-free/i18n/Translation-en_US.gz Could not resolve 'www.backports.org' W: Some index files failed to download, they have been ignored, or old ones used instead. W: You may want to run apt-get update to correct these problems I am able to ping ip addresses but not namespaces. Can't seem to figure out the problem. My /etc/resolv.conf file contains nameserver 192.168.1.2 which is my router.

    Read the article

  • SSL certificates and types for securing your websites and applications

    - by Mit Naik
    Need to share few information regarding SSL certificates and there types, which SSL certificates are widely used etc. There are several SSL certificates available in the market today inorder to secure your domains, multiple subdomains, your applications and code too. Few of the details are mentioned below. CheapSSL certificates available today are Standard Rapidssl certificate, Thwate SSL 123 etc certificates which are basic level certificates. Most of these cheap SSL certificates are domain-validated only and don't provide the greatest trust for your customers. This means you shouldn't use cheap SSL certificates on e-commerce stores or other public-facing sites that require people to trust the site. EV certificates I found Geotrust Truebusinessid with EV certificate which is one of the cheapest certificate available in market today, you can also find Thwate, Versign EV version of certificates. Its designed to prevent phishing attacks better than normal SSL certificates. What makes an EV Certificate so special? An SSL Certificate Provider has to do some extensive validation to give you one including: Verifying that your organization is legally registered and active, Verifying the address and phone number of your organization, Verifying that your organization has exclusive right to use the domain specified in the EV Certificate, Verifying that the person ordering the certificate has been authorized by the organization, Verifying that your organization is not on any government blacklists. SSL WILDCARD CERTIFICATES, SSL Wildcard Certificates are big money-savers. An SSL Wildcard Certificate allows you to secure an unlimited number of first-level sub-domains on a single domain name. For example, if you need to secure the following websites: * www.yourdomain.com * secure.yourdomain.com * product.yourdomain.com * info.yourdomain.com * download.yourdomain.com * anything.yourdomain.com and all of these websites are hosted on the multiple server box, you can purchase and install one Wildcard certificate issued to *.yourdomain.com to secure all these sites. SAN CERTIFICATES, are interesting certificates and are helpfull if you want to secure multiple domains by generating single CSR and can install the same certificate on your additional sites without generating new CSRs for all the additional domains. CODE SIGNING CERTIFICATES, A code signing certificate is a file containing a digital signature that can be used to sign executables and scripts in order to verify your identity and ensure that your code has not been tampered with since it was signed. This helps your users to determine whether your software can be trusted. Scroll to the chart below to compare cheap code signing certificates. A code signing certificate allows you to sign code using a private and public key system similar to how an SSL certificate secures a website. When you request a code signing certificate, a public/private key pair is generated. The certificate authority will then issue a code signing certificate that contains the public key. A certificate for code signing needs to be signed by a trusted certificate authority so that the operating system knows that your identity has been validated. You could still use the code signing certificate to sign and distribute malicious software but you will be held legally accountable for it. You can sign many different types of code. The most common types include Windows applications such as .exe, .cab, .dll, .ocx, and .xpi files (using an Authenticode certificate), Apple applications (using an Apple code signing certificate), Microsoft Office VBA objects and macros (using a VBA code signing certificate), .jar files (using a Java code signing certificate), .air or .airi files (using an Adobe AIR certificate), and Windows Vista drivers and other kernel-mode software (using a Vista code certificate). In reality, a code signing certificate can sign almost all types of code as long as you convert the certificate to the correct format first. Also I found the below URL which provides you good suggestion regarding purchasing best SSL certificates for securing your site, as per the Financial institution, Bank, Hosting providers, ISP, Retail Merchants etc. Please vote and provide comments or any additional suggestions regarding SSL certificates.

    Read the article

< Previous Page | 463 464 465 466 467 468 469 470 471 472 473 474  | Next Page >