Search Results

Search found 5254 results on 211 pages for 'concept analysis'.

Page 47/211 | < Previous Page | 43 44 45 46 47 48 49 50 51 52 53 54  | Next Page >

  • GIS: When and why to use ArcObjects over GDAL programming to work with ArcGIS rasters and vectors?

    - by anotherobject
    Im just starting off with GDAL + python to support operations that cannot be done with ArcGIS python geoprocessing scripting. Mainly I am doing spatial modeling/analysis/editing of raster and vector data. I am a bit confused when ArcObject development is required versus when GDAL can be used? Is there functionality of ArcObjects that GDAL does not do? Is the opposite true too? I am assuming that ArcObjects are more useful in developing online tools versus Desktop analysis and modeling where the difference is more to do with preference? In my case i prefer GDAL because of python support, which I believe ArcObjects lack. thanks!

    Read the article

  • How do I branch an individual file in SVN?

    - by Michael Carman
    The subversion concept of branching appears to be focused on creating an [un]stable fork of the entire repository on which to do development. Is there a mechanism for creating branches of individual files? For a use case, think of a common header (*.h) file that has multiple platform-specific source (*.c) implementations. This type of branch is a permanent one. All of these branches would see ongoing development with occasional cross-branch merging. This is in sharp contrast to unstable development/stable release branches which generally have a finite lifespan. I do not want to branch the entire repository (cheap or not) as it would create an unreasonable amount of maintenance to continuously merge between the trunk and all the branches. At present I'm using ClearCase, which has a different concept of branching that makes this easy. I've been asked to consider transitioning to SVN but this paradigm difference is important. I'm much more concerned about being able to easily create alternate versions for individual files than about things like cutting a stable release branch.

    Read the article

  • Data Mining open source tools

    - by Andriyev
    Hi I'm due to take up a project which is into data mining. Before I jump in I wanted to probe around for different data mining tools (preferably open source) which allows web based reporting. In my scenario the all the data would be provided to me, so I'm not supposed to crawl for it. In n nutshell, am looking for a tool which does - Data Analysis, Web based Reporting, provides some kind of a dashboard and mining features. I have worked on the Microsoft Analysis Services and BOXI and off late I have been looking at Pentaho, which seems to be a good option. Please share your experiences on any such tool which you know of. cheers

    Read the article

  • Domain Model and Contracts

    - by devoured elysium
    I am modelling a DVD Rental Store: A Client gives its clientNumber to the System. The System checks whenever the given clientNumber is valid. The Client gives the name of the DVD he wants to rent. ... n. ...I will later have to form an association between a new instance of "RentDVD" class concept to the current Client c. My Domain Model is something like: I've made the Contract for the first and second operations as: Preconditions: none Postconditions: there exists a Client c such that c.clientNumber = clientNumber. Now, I don't know if I should form an association between this Client c and the DVDStore(that I intend to use as front-end). If I don't make the association, how will I later be able to "reference" this same Client? Should I be making an association between Client and a different concept? Thanks

    Read the article

  • Is there a Java Descriptor like thing in .Net?

    - by Sun Liwen
    I'm working on a static analysis tool for .NET assembly. In Java, there is a Descriptor which can be used to represent method or field in a string with specified grammar. for field: double d[][][]; will be [[[D It's useful especially when doing bytecode analysis. Coz it's easy to describe. If there a similar thing in .NET CLR? Or is there a better way to achieve this? Thanks!

    Read the article

  • Creating a new buffer with text using EmacsClient

    - by User1
    I have a program that can send text to any other program for further analysis (eg sed, grep, etc). I would like it to send the data to Emacs and do analysis there. How would I do that? EmacsClient takes a filename by default, this is a data string not a file and I really don't want to create and delete files just to send data to Emacs. EmacsClient has an "eval" command-line option that let's you execute lisp code instead of open files. Is there a simple lisp function that will open a new buffer with the given text?

    Read the article

  • ORM on which standards i can select?

    - by just_name
    Q: This question is about how can i figure or select the convenient ORM to my web application. when beginning a new web application,What are the criteria on which i can consider a specific ORM is better than another one for my project or case(web application)? another part of my question : when i begin any web application i use three layers: the DB layer (which contains the connections , and handle the CRUD operations ) the Managers layer(the Data Access Layer) a class for each table on my db (loosely coupled with the previous layer )it contains the CRUD operations for the specific table and the other required operations. the interface layer.. and i use Object Data source.Is that considered as an ORM (as a concept) or I'm wrong in understanding this concept. note:I still a beginner in this field ,, and every day i learn more about web development. please i want explanation and suggestions for this point. Thanks in advance.

    Read the article

  • is it posible to upload directly to remote server using SFTP on ASP.net MVC

    - by DucDigital
    Hi! I am currently develope something using asp.net MVC, im still quite not experience with it so please help me out. I have a form for user to upload Video. The current ideal concept to upload to remote server is to Upload it to to the current server, then use FTP to push it to a remote server. For me, this is not quite fast since you have to upload to current server (Time x1) and then the current server push to new server (Time x2) so it's double the time. So my idea is to make user upload it to the current server, and WHILE user is uploading, the current server add the file to DB and also send the file to the remote server at the same time using SFTP... is it posible and are there any security hole in this concept? Thank you very much

    Read the article

  • multiple move operations and data processes in work thread

    - by younevertell
    main thread-- start workthread--StartStage(get list of positions for data process) -- move to one position -- data sampling*strong text*-- data collection--data analysis------data sampling*strong text* basically, work thread does the data sampling*strong text*-- data collection--data analysis------data sampling*strong text* loop for one positioin until press stop or target is obtained. my questions: After work thread finishs the loop for one positioin, it would end itself. now how to make the work thread moves to the next position to do the data process loop after work thread finish one position work, would not end itself until data process for all the positions are done? Thanks in advance!

    Read the article

  • Minimum number of training examples for Find-S/Candidate Elimination algorithms?

    - by Rich
    Consider the instance space consisting of integer points in the x, y plane, where 0 = x, y = 10, and the set of hypotheses consisting of rectangles (i.e. being of the form (a = x = b, c = y = d), where 0 = a, b, c, d = 10). What is the smallest number of training examples one needs to provide so that the Find-S algorithm perfectly learns a particular target concept (e.g. (2 = x = 4, 6 = y = 9))? When can we say that the target concept is exactly learned in the case of the Find-S algorithm, and what is the optimal query strategy? I'd also like to know the answer w.r.t Candidate Elimination. Thanks in advance.

    Read the article

  • Running [R] on a Netbook

    - by Thomas
    I am interested in purchasing a netbook to do field research in another country. My hardware specifications for the nebtook are fairly basic: Be rugged enough to survive a bit of wear and tear Fairly fast processing (the ability to upgrade from 1GB of RAM to 2GB) A battery life of longer than 6 hours At least a 10 inch screen A decent camera for Skyping However, I am mainly concerned about being able to do basic statistical analysis in conjunction with R Be able run a Spreadsheet program to do basic data input (like Excel or Open Office) Use R to do basic data analysis (Regression, some simulation (nothing crazy), data cleaning, and some of the functionality) Word Processing (Word or Open Office) Do you have any suggestions on which models or brands my fit my needs? Some of the models I am considering: Samsung NB-30 Toshiba NB 305 Asus Eee PC 1005HA Lenovo S10-2 Does anyone use R on a netbook, and if so do you have any recommendations on how best to optimize it? This article from Lifehacker mentions some OS. Anybody use these in conjunction with R? Any help would be much appreciated.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • doctrine default values and relations

    - by Skirmantas
    Concept: Lets say we have table Properties with columns id and name (lets say with some predefined values: "Good" "Better" "Best"). Another table Users has column property_id with many to one relation on Properties (property_id = id). Users has default value on property_id, lets say 1 which means "Good". We might have another table analogue to Users however with default property, lets say "Better". What I need is ability to change default value for Users or other tables in administrator's panel. In mysql I can set default value for column like this: ALTER TABLE <Table> CHANGE <Column> DEFAULT <NEW_DEFAULT_VALUE> I can retrieve default value: SELECT DEFAULT(<Column>) FROM <Table> LIMIT 1 Is it possible to achieve this concept with Doctrine? What I actually need is such method in my table class: class UserTable extend Doctrine_Table { /* ... */ getDefaultProperty() { } setDefaultProperty($value) { /* $value can be either integer or Doctrine_Record */ } }

    Read the article

  • Determining whether a class implements a generic list in a T4 template

    - by James Hollingworth
    I'm writing a T4 template which loads some classes from an assembly, does some analysis of the classes and then generates some code. One particular bit of analysis I need to do is to determine whether the class implements a generic list. I can do this pretty simply in C#, e.g. public class Foo : List<string> { } var t = typeof(Foo); if (t.BaseType != null && t.BaseType.IsGenericType && t.BaseType.GetGenericTypeDefinition() == typeof(List<>))) Console.WriteLine("Win"); However T4 templates use the FXCop introspection engine and so you do not have access to the .net reflection API. I've spent the past couple of hours in Reflector but still can't figure it out. Does anyone have any clues about how to do this?

    Read the article

  • How to obtain a random sub-datatable from another data table

    - by developerit
    Introduction In this article, I’ll show how to get a random subset of data from a DataTable. This is useful when you already have queries that are filtered correctly but returns all the rows. Analysis I came across this situation when I wanted to display a random tag cloud. I already had the query to get the keywords ordered by number of clicks and I wanted to created a tag cloud. Tags that are the most popular should have more chance to get picked and should be displayed larger than less popular ones. Implementation In this code snippet, there is everything you need. ' Min size, in pixel for the tag Private Const MIN_FONT_SIZE As Integer = 9 ' Max size, in pixel for the tag Private Const MAX_FONT_SIZE As Integer = 14 ' Basic function that retreives Tags from a DataBase Public Shared Function GetTags() As MediasTagsDataTable ' Simple call to the TableAdapter, to get the Tags ordered by number of clicks Dim dt As MediasTagsDataTable = taMediasTags.GetDataValide ' If the query returned no result, return an empty DataTable If dt Is Nothing OrElse dt.Rows.Count < 1 Then Return New MediasTagsDataTable End If ' Set the font-size of the group of data ' We are dividing our results into sub set, according to their number of clicks ' Example: 10 results -> [0,2] will get font size 9, [3,5] will get font size 10, [6,8] wil get 11, ... ' This is the number of elements in one group Dim groupLenth As Integer = CType(Math.Floor(dt.Rows.Count / (MAX_FONT_SIZE - MIN_FONT_SIZE)), Integer) ' Counter of elements in the same group Dim counter As Integer = 0 ' Counter of groups Dim groupCounter As Integer = 0 ' Loop througt the list For Each row As MediasTagsRow In dt ' Set the font-size in a custom column row.c_FontSize = MIN_FONT_SIZE + groupCounter ' Increment the counter counter += 1 ' If the group counter is less than the counter If groupLenth <= counter Then ' Start a new group counter = 0 groupCounter += 1 End If Next ' Return the new DataTable with font-size Return dt End Function ' Function that generate the random sub set Public Shared Function GetRandomSampleTags(ByVal KeyCount As Integer) As MediasTagsDataTable ' Get the data Dim dt As MediasTagsDataTable = GetTags() ' Create a new DataTable that will contains the random set Dim rep As MediasTagsDataTable = New MediasTagsDataTable ' Count the number of row in the new DataTable Dim count As Integer = 0 ' Random number generator Dim rand As New Random() While count < KeyCount Randomize() ' Pick a random row Dim r As Integer = rand.Next(0, dt.Rows.Count - 1) Dim tmpRow As MediasTagsRow = dt(r) ' Import it into the new DataTable rep.ImportRow(tmpRow) ' Remove it from the old one, to be sure not to pick it again dt.Rows.RemoveAt(r) ' Increment the counter count += 1 End While ' Return the new sub set Return rep End Function Pro’s This method is good because it doesn’t require much work to get it work fast. It is a good concept when you are working with small tables, let says less than 100 records. Con’s If you have more than 100 records, out of memory exception may occur since we are coping and duplicating rows. I would consider using a stored procedure instead.

    Read the article

  • SQL Authority News – Download Microsoft SQL Server 2014 Feature Pack and Microsoft SQL Server Developer’s Edition

    - by Pinal Dave
    Yesterday I attended the SQL Server Community Launch in Bangalore and presented on Performing an effective Presentation. It was a fun presentation and people very well received it. No matter on what subject, I present, I always end up talking about SQL. Here are two of the questions I had received during the event. Q1) I want to install SQL Server on my development server, where can we get it for free or at an economical price (I do not have MSDN)? A1) If you are not going to use your server in a production environment, you can just get SQL Server Developer’s Edition and you can read more about it over here. Here is another favorite question which I keep on receiving it during the event. Q2) I already have SQL Server installed on my machine, what are different feature pack should I install and where can I get them from. A2) Just download and install Microsoft SQL Server 2014 Service Pack. Here is the link for downloading it. The Microsoft SQL Server 2014 Feature Pack is a collection of stand-alone packages which provide additional value for Microsoft SQL Server. It includes tool and components for Microsoft SQL Server 2014 and add-on providers for Microsoft SQL Server 2014. Here is the list of component this product contains: Microsoft SQL Server Backup to Windows Azure Tool Microsoft SQL Server Cloud Adapter Microsoft Kerberos Configuration Manager for Microsoft SQL Server Microsoft SQL Server 2014 Semantic Language Statistics Microsoft SQL Server Data-Tier Application Framework Microsoft SQL Server 2014 Transact-SQL Language Service Microsoft Windows PowerShell Extensions for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Shared Management Objects Microsoft Command Line Utilities 11 for Microsoft SQL Server Microsoft ODBC Driver 11 for Microsoft SQL Server – Windows Microsoft JDBC Driver 4.0 for Microsoft SQL Server Microsoft Drivers 3.0 for PHP for Microsoft SQL Server Microsoft SQL Server 2014 Transact-SQL ScriptDom Microsoft SQL Server 2014 Transact-SQL Compiler Service Microsoft System CLR Types for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Remote Blob Store SQL RBS codeplex samples page SQL Server Remote Blob Store blogs Microsoft SQL Server Service Broker External Activator for Microsoft SQL Server 2014 Microsoft OData Source for Microsoft SQL Server 2014 Microsoft Balanced Data Distributor for Microsoft SQL Server 2014 Microsoft Change Data Capture Designer and Service for Oracle by Attunity for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Master Data Service Add-in for Microsoft Excel Microsoft SQL Server StreamInsight Microsoft Connector for SAP BW for Microsoft SQL Server 2014 Microsoft SQL Server Migration Assistant Microsoft SQL Server 2014 Upgrade Advisor Microsoft OLEDB Provider for DB2 v5.0 for Microsoft SQL Server 2014 Microsoft SQL Server 2014 PowerPivot for Microsoft SharePoint 2013 Microsoft SQL Server 2014 ADOMD.NET Microsoft Analysis Services OLE DB Provider for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Analysis Management Objects Microsoft SQL Server Report Builder for Microsoft SQL Server 2014 Microsoft SQL Server 2014 Reporting Services Add-in for Microsoft SharePoint Reference: Pinal Dave (http://blog.sqlauthority.com)Filed under: PostADay, SQL, SQL Authority, SQL Download, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority News, T SQL

    Read the article

  • Why I don’t need to go on the SQLCruise

    - by Jonathan Kehayias
    Brent Ozar ( Blog | Twitter ) and Tim Ford ( Blog | Twitter ) are putting on a new type of event in the month of August after SQL Saturday #40 in South Florida July, 31st , properly named SQLCruise . The concept is great, at least in my opinion, you pay for a cruise, get to have a break, and at the same time attend a mini-conference on SQL Server with training provided by two great speakers. The cost is relatively affordable, so what could possibly make it better? How about a sponsor offering up...(read more)

    Read the article

< Previous Page | 43 44 45 46 47 48 49 50 51 52 53 54  | Next Page >