Search Results

Search found 61830 results on 2474 pages for 'efficient time use'.

Page 47/2474 | < Previous Page | 43 44 45 46 47 48 49 50 51 52 53 54  | Next Page >

  • CPU/Mem/Disk utilization (average) after process has completed

    - by BassKozz
    Ubuntu Server 9.10 So there is the time command which will show you the time it took for a specific process/command to run after the command has completed. For example: :~$ time ls real 0m0.020s user 0m0.000s sys 0m0.000s I'd like to also collect the average CPU usage, Memory, and Disk (i/o) utilization after the process has completed using time (or another command if necessary). How can I accomplish this? Mainly I am using this to benchmark MySQL import performance using different innodb_buffer_pool_size settings.

    Read the article

  • OS X wants to back up Macintosh HD to itself

    - by slhck
    From time to time, OS X (10.6) will ask me if I want to perform a backup of my Macintosh HD, but the backup destination is obviously the HD itself. I have not plugged in any external device, nor is there a Time Capsule network share. A message like this will appear: Moreover, the Macintosh HD will suddenly have a Time Machine icon in Finder. Has somebody experienced the same and could help me identify how to stop OS X from using its own disk as the backup destination?

    Read the article

  • Python vs. Perl in ten years time

    - by Richard
    If you were starting learning a new language today, for scripting and doing "various stuff" with it (from making useful programs to it being glue to several command line programs), would you go with Python or Perl (or some third option, although the battle usually comes to these two)? I've never much used dynamic languages at all, having been able to do everything I needed in traditional static ones. Did some scripting in Perl a couple of years ago, but that was more of a momentary fling, than an attempt to learn it well. Now I've some free time, and have decided to go along with one of these two, and play a little with them. I like Perl's syntax, but Python does seem to be taking rather big steps on overtaking that area. What do you think, which one is more worth learning and why? Also, what do you think, what will be Python's future in about 10 years ... will it overtake Perl and other scripting languages's as a dominant tool for that kind of work (I more often than not find it being implemented in various applications I'm using - for internal scripting and automating loading of data and similar operations), or will it find a balance and coexist along others (Perl)? What is its current "momentum" - does it comes by default with Linux distributions, as Perl does, or does it needs to be installed separately every time? Is it a language which can be expected "to just be there"?

    Read the article

  • Python — Time complexity of built-in functions versus manually-built functions in finite fields

    - by stackuser
    Generally, I'm wondering about the advantages versus disadvantages of using the built-in arithmetic functions versus rolling your own in Python. Specifically, I'm taking in GF(2) finite field polynomials in string format, converting to base 2 values, performing arithmetic, then output back into polynomials as string format. So a small example of this is in multiplication: Rolling my own: def multiply(a,b): bitsa = reversed("{0:b}".format(a)) g = [(b<<i)*int(bit) for i,bit in enumerate(bitsa)] return reduce(lambda x,y: x+y,g) Versus the built-in: def multiply(a,b): # a,b are GF(2) polynomials in binary form .... return a*b #returns product of 2 polynomials in gf2 Currently, operations like multiplicative inverse (with for example 20 bit exponents) take a long time to run in my program as it's using all of Python's built-in mathematical operations like // floor division and % modulus, etc. as opposed to making my own division, remainder, etc. I'm wondering how much of a gain in efficiency and performance I can get by building these manually (as shown above). I realize the gains are dependent on how well the manual versions are built, that's not the question. I'd like to find out 'basically' how much advantage there is over the built-in's. So for instance, if multiplication (as in the example above) is well-suited for base 10 (decimal) arithmetic but has to jump through more hoops to change bases to binary and then even more hoops in operating (so it's lower efficiency), that's what I'm wondering. Like, I'm wondering if it's possible to bring the time down significantly by building them myself in ways that maybe some professionals here have already come across.

    Read the article

  • Office add on saves you time if you use Moodle

    - by Brian Scarbeau
    Moodle is a free elearning content management software program. It does take a great deal of time to set it up because you need to upload your Office files to Moodle. Now, Microsoft has made that job easier with their new Office Add on. With it you can save directly into Moodle.   Here are the instructions on how to use. Just change the URL you use for your Moodle site. 1. Go to this site and download and install the software. http://www.educationlabs.com/projects/officeaddinformoodle/Pages/default.aspx 2. Open your Office Word in this example and then select Save to Moodle (Notice you can also open files that you have stored in moodle make changes and then save back to moodle. (WOW) 3,  Now because this is the first time you are using this feature you will see a dialog box that looks like this: Enter the moodle website exactly as you see here along with your username and password for moodle. Click the checkbox to remember you. 4. After you click on Save to Moodle you should see a dialog box like this: 5.  Click the plus on the left Lake Highland Preparatory School-Online Learning 6. You will now see the listing of your moodle classes. Now click on the class that you your file to go to and save. Now you use this file in moodle. Good luck!

    Read the article

  • Calculating Delta time , what is wrong?

    - by SteveL
    For 2 days now i am trying to calculate the correct delta time for my game , I am starting to getting crazy since i tried all the solutions that i found on the 5 first google pages... What is wrong? I cant get the correct delta time ,whatever i tried is just not working , the delta goes from 1 to 4 and then back 1 and then to 3 even if i take the averange delta between many frames.Plus the game runs way much faster(i mean the movement) on slow devices than in fast. The game runs on android so the spikes between frames are expected. My code is this: void Game::render() { timesincestart=getTimeMil(); _director->Render(); _director->Update(); float dif=(getTimeMil()-timesincestart);//usally its about 5 milliseconds lastcheck++; sumdelta+=dif; if(lastcheck>20) { sumdelta=sumdelta/20; delta=sumdelta; sumdelta=0; lastcheck=0; } LOGI("delta:%f",delta); }

    Read the article

  • For Oracle's JD Edwards Customers--IT's Getting Better All The Time

    - by Oracle Accelerate for Midsize Companies
    By Jim Lein, Programs Management Sr. Principal, Oracle Midsize Programs. The annual JD Edwards Oracle Profit Magazine Special Edition was released this week. Look for the print copy in your mailbox or access the online version here. I entered the software industry when I joined JD Edwards in 1999. The next six years were a wild roller coaster ride for employees, partners, and--most unfortunately--for many of our customers. (Not entirely my fault BTW). In this Special Edition, I immediately gravitated to Aaron Lazenby's interview with Lyle Ekdahl, Group VP and General Manager of Oracle JD Edwards, "Better All The Time".  I met Lyle in 2003 when he joined PeopleSoft to guide JD Edwards' CRM development. He dropped by my cube (it was a double-wide cube, mind you) to explain his strategy. It was an intense first impression. Passionate, competent, personable. From my discussions with partners and customers, it is clear that for Oracle's JD Edwards customers it is getting better all the time. Now I've got that darn Beatle's song stuck in my head...

    Read the article

  • Apache VERY high page load time

    - by Aaron Waller
    My Drupal 6 site has been running smoothly for years but recently has experienced intermittent periods of extreme slowness (10-60 sec page loads). Several hours of slowness followed by hours of normal (4-6 sec) page loads. The page always loads with no error, just sometimes takes forever. My setup: Windows Server 2003 Apache/2.2.15 (Win32) Jrun/4.0 PHP 5 MySql 5.1 Drupal 6 Cold fusion 9 Vmware virtual environment DMZ behind a corporate firewall Traffic: 1-3 hits/sec avg Troubleshooting No applicable errors in apache error log No errors in drupal event log Drupal devel module shows 242 queries in 366.23 milliseconds,page execution time 2069.62 ms. (So it looks like queries and php scripts are not the problem) NO unusually high CPU, memory, or disk IO Cold fusion apps, and other static pages outside of drupal also load slow webpagetest.org test shows very high time-to-first-byte The problem seems to be with Apache responding to requests, but previously I've only seen this behavior under 100% cpu load. Judging solely by resource monitoring, it looks as though very little is going on. Here is the kicker - roughly half of the site's access comes from our LAN, but if I disable the firewall rule and block access from outside of our network, internal (LAN) access (1000+ devices) is speedy. But as soon as outside access is restored the site is crippled. Apache config? Crawlers/bots? Attackers? I'm at the end of my rope, where should I be looking to determine where the problem lies?

    Read the article

  • First time application where to start?

    - by Nazariy
    After many years of searches and copy pasting, I'm still looking for simple solution that can transliterate text input on the fly from one key set to another. There are quite few online services that provide this feature but it still quite annoying to go online all the time. Unfortunately there is not that many applications left which are capable of doing so, and none of them supported by this day. I decided to make my own and at same time to learn something new for my self. The idea is quite simple: application should sit in system tray and wait until input language get changed, for example to Russian. If Russian language is activated, application should start to listen for user key strokes combination and replace them based on custom dictionary for example R = ?, SH = ? etc. I should be able to bind application to any installed language (Russian, Ukrainian, Bulgarian, Belarusian etc.) and customise dictionary for any of them. So my question is: Which language should I chose for this task C++, C# or might be something hardcore like Assembler, as application should work natively with Windows XP/Vista/7 or possibly Mac. (cross platform support is good but my main target is Windows) Due to nature of application behaviour how can I tell anti-virus software that it is not a "Key Logger" and basically not a virus? Where should I start and what should I be aware of? P.S. My current programming knowledge is quite basic, PHP and JavaScript with Object Oriented approach.

    Read the article

  • Installation taking a very long time, hangs at "Configuring bcmwl-kernel-source"

    - by user290522
    I am installing Ubuntu 14.04(32-bit) on my laptop (Compaq Presario V2000), and after about 7 hours, it is still in Configuring bcmwl-kernel-source (i386) mode. The messages I read are as follows: ubuntu kernel: [22814.858163] ACPI: \_SB_.PCI0.LPC0.LPC0.ACAD: ACPI_NOTIFY_BUS_CHECK event: unsupported with the numbers in the square brackets increasing. I have had Windows XP professional on this laptop, and I am erasing it. I am not sure if I should turn off the laptop, and start all over again. About 4 years ago I installed Ubuntu on this laptop, and that was very fast. The only problem I encountered was my wireless, and could not make it to work, and switched back to Windows. I appreciate any comments regarding this installation taking such a long time. After 40 hours the installation was still in configuring mode with the following messages: ubuntu CRON[29329]: (root) CMD ( cd/ && run-part .. report /etc/cron-hourly) I did the following to check for errors: pressed ctrl-alt-f2. This time the system froze. I had no other choice but to turn off the laptop, and start all over again. The exact model of the laptop is "Compaq Presario V2069CL Notebook PC" with AMD processor.

    Read the article

  • OLL-Live Java EE 7: Using WebSockets for Real-Time Communication

    - by emarti
    OLL-Live offers FREE, one-hour interactive webinars from Oracle. At an OLL Live webinar, you will experience an information packed session led by an Oracle expert showing you ways you can use Oracle products. Our speaker this time is Eduardo Moranchel, Java Curriculum Developer. Eduardo's topic is Using WebSockets for Real-Time Communication. See how WebSocket and JSON technologies can help you build more interactive Java EE applications. You will also learn how to build an application using HTML 5 for the front end and WebSocket with JSON in the back end. The application that will be demoed is a collaborative sticker book application that was featured in the Java EE 7 embracing HTML 5 article in May/June edition of the Java Magazine. July 10, 2013, at 8:00 AM PT About the speaker Eduardo Moranchel, is a Curriculum Developer at Oracle's Mexico Development Center. Eduardo has extensive experience designing and developing applications using Java. He enjoys sharing his experience and passion for the Java platform by developing courses and tutorials for the newest Java technologies. He is co-organizer of the Java User Group in Guadalajara, Mexico. He co-authored the Java EE 7 embracing HTML 5 article in the most recent Java Magazine.

    Read the article

  • Advice: The first-time interviewer's dilemna

    - by shan23
    I've been working in my first job for about 2 years now, and I've been "asked" to interview a potential teammate (whom I might have to mentor as well) on pretty short notice (2 days from now). Initially, I had been given a free rein(or so I thought, and hence agreed), but today, I've been told "not to pose bookish questions" - implying I can only ask basic programming puzzles and stuff similar to the 'fizbuzz' question. I strongly believe that not knowing basic algorithmic notations(the haziest ideas of space/time complexities) or the tiniest idea of regular expressions would make working with the guy very difficult for anyone. I know i'm asking for a lot here, but according to you, what would be a comprehensive way to test out the absolutely basic requirements of a CS guy(he has 2 yrs of exp) without sounding too pedantic/bookish etc ? It seems it would be legit to ask C questions/simple puzzles only....but I really do want to have something a bit different from "finding loops in linked lists" that has kind of become the opening statement of most techie interviews !! This is a face-to-face interview with about an hour or more of time - I looked at Steve's basic phone-screen questions, and I was wondering if there exists a guide on "basic face-to-face interview questions" that I can use(or compile from the community's answers here). EDIT: The position is mostly for a kernel level C programming job, with some smattering of C++ required for writing the test framework.

    Read the article

  • How to protect your real time online shooter from potential bots

    - by Zaky German
    I'm looking to create a multiplayer top down shooter. While i've read about different topics, i can see them i've got some real challenges ahead, but i'm all up for it. One thing i can't understand is how am i supposed to be protecting the game from people who try to create bots? What i mean is, as far as i understand, it's impossible to protect the network traffic in a way that players won't be able to create programs that listen to what's going on and understand it. So what worries me is that people can create bots that listen to the current location of rival players, and send communication that mimic as if the player is shooting in the exact "perfect" location to win that match. So what kind of techniques are used to protect real time games from such bots? Also i'd like to mention that i've tried searching for discussions (as this sounds like something many people struggle with), but couldn't find anything about it specifically, only as a part of broader questions about networking in real time games. If i should have looked harder feel free to put me in my place :) Thanks alot!

    Read the article

  • Vector with Constant-Time Remove - still a Vector?

    - by Darrel Hoffman
    One of the drawbacks of most common implementations of the Vector class (or ArrayList, etc. Basically any array-backed expandable list class) is that their remove() operation generally operates in linear time - if you remove an element, you must shift all elements after it one space back to keep the data contiguous. But what if you're using a Vector just to be a list-of-things, where the order of the things is irrelevant? In this case removal can be accomplished in a few simple steps: Swap element to be removed with the last element in the array Reduce size field by 1. (No need to re-allocate the array, as the deleted item is now beyond the size field and thus not "in" the list any more. The next add() will just overwrite it.) (optional) Delete last element to free up its memory. (Not needed in garbage-collected languages.) This is clearly now a constant-time operation, since only performs a single swap regardless of size. The downside is of course that it changes the order of the data, but if you don't care about the order, that's not a problem. Could this still be called a Vector? Or is it something different? It has some things in common with "Set" classes in that the order is irrelevant, but unlike a Set it can store duplicate values. (Also most Set classes I know of are backed by a tree or hash map rather than an array.) It also bears some similarity to Heap classes, although without the log(N) percolate steps since we don't care about the order.

    Read the article

  • Grub menu will not show the first time I try to boot my ubuntu server 12.04 after it is shutdown for a long time

    - by user211477
    I am running into a booting issue after installing Ubuntu Server 12.04 LTS. Following is the symptom of the problem. SYSTEM DESCRIPTION: Dual core AMD Athlon 64 3 Disks: two SATA (out of which one is SSD) and one PATA. Using LVM for disk partition management. /boot is not under LVM rest of the partitions are. / is on the SSD BIOS boot sequence is correct and points to the disk with /boot and boot loader is installed on this disk. SYMPTOMS: POST messages Blinking cursor on first line then moves to second line Screen flickers then becomes black Everything is unresponsive, hard reboot POST messages will not show up on screen. Monitor displays powersave message Force shutdown machine again. Shutoff power to machine for a few minutes. Restart machine. POST message show up. Grub menu shows up Ubuntu server 12.04 boots normally. From now on Ubuntu server boots normally until machine is shutdown for a long time (for example, 30 mins) Repeat steps 1 through 13 once the machine is started after a long time. WHAT DID I TRY? I read several posts and have tried: radeon.modeset=0 setting the gfxmode edd=0 nolacpi boot-repair Nothing seems to work. In my search I did see only one post with this same symptom. Unfortunately, I am not being able to locate that post anymore. The interesting fact is that with this same machine configuration, if I install Ubuntu Desktop 12.04 then everything works fine. Any help will be appreciated.

    Read the article

  • Using onboard and pci-e graphics card at the same time

    - by Endle
    Hello wonderful people. I know there are several other posts with similar questions. I also know how to use Google. I also have read up on posts discussing bumblebee, crossfire, ati catylist and many other interesting topics. I would just like someone to give me advice on how to use the onboard and pci-e graphics at the same time. I know the computer is capable of doing this. It works in Windows. I can use the VGA and DVI onboard port and the HDMI port of the add on card all at the same time. Works great in Windows 7, In Ubuntu, it seems only one or the other will work. I can use any combination of two displays on either adapter: VGA and HDMI..HDMI and DVI..so forth and so on. I have started experimenting with xorg.conf files, but have not been able to get any of them to work. Here is my last attempt at writing an xorg.conf file: Section "ServerLayout" Identifier "X.org Configured" Screen 0 "Screen0" 0 0 Screen 1 "Screen1" LeftOf "Screen0" Screen 2 "Screen2" LeftOf "Screen1" InputDevice "Mouse0" "CorePointer" InputDevice "Keyboard0" "CoreKeyboard" EndSection Section "Device" Identifier "Onboard Video" Driver "radeon" BusID "PCI:01:05.0" EndSection Section "Device" Identifier "Graphics Card" Driver "radeon" BusID "PCI:02:00.0" EndSection Section "Monitor" Identifier "CRT2" Option "VendorName" "ViewSonic" Option "ModelName" "Generic Autodetecting Monitor" Option "DPMS" "true" EndSection Section "Monitor" Identifier "DVI1" VendorName "ACR" ModelName "P224W" Option "DPMS" EndSection Section "Monitor" Identifier "DVI2" Option "VendorName" "Acer" Option "ModelName" "Generic Autodetecting Monitor" Option "DPMS" "true" EndSection Section "Screen" Identifier "Screen0" Device "Onboard Video" Monitor "CRT2" DefaultDepth 24 SubSection "Display" Depth 24 Modes "1280x1024" EndSubSection EndSection Section "Screen" Identifier "Screen1" Device "Graphics Card" Monitor "DVI1" DefaultDepth 24 SubSection "Display" Depth 24 Modes "1920x1080" EndSubSection

    Read the article

  • Reliance on Outlook (been a looong time, I know)

    - by AndyScott
    Do you feel that your development group too reliant on Outlook? Have you reached a point that you have to search your email for pertinent information when asked? What are you using? I realized things had gotten out of hand a couple weeks ago over a weekend. I was at my in-laws house (in the country, no PC/laptop, no internet connection; and I get an email on my phone that I needed to reply to, but I couldn't send without deleting items from my inbox/sent items/etc. Now mind you, I have rules set up to move stuff into folders, and files more than a month old are automatically moved to the PST; but generally don't manually move items to a PST until I have had a chance to 'work' the item. Please don't bother mocking my process, it's just the way I work. That being said, it was a frustrating process of 'I need all this information, what can I afford to lose'. I work on an International project (think lots of customers), and conversations in 9 or 10 different directions about 10-20 different things are not abnormal for a given day. I have found myself looking data up in Outlook because that's where it is. I think that I have reached the point now, where I don't feel that Outlook is up to the task of organizing the data that it contains.   When you have that many emails (200 or so a day), information seems to get lost at times, and I find that Outlook's search capabilities are lacking. Additionally, I find that any sort of organizational 'system' of sorting emails that can cover multiple topics is a lost cause. But at the same time, the old process of taking the information that I got from emails and moving it into another 'notes' type of program has proved to be too time consuming. Anyone out there have some better type of system? (Comments about the capacity of my brain, and it's ability to recall information not needed.)

    Read the article

  • When running UPDATE ... datetime = NOW(); will all rows updated have the same date/time?

    - by Darryl Hein
    When you run something similar to: UPDATE table SET datetime = NOW(); on a table with 1 000 000 000 records and the query takes 10 seconds to run, will all the rows have the exact same time (minutes and seconds) or will they have different times? In other words, will the time be when the query started or when each row is updated? I'm running MySQL, but I'm thinking this applies to all dbs.

    Read the article

  • Having a hard time having consecutive animations for an attack

    - by Kelby Styler
    So I've been trying to figure this out for about 8 hours now...It's driving me nuts because I am pretty sure that it is something dead simple that I am just not understanding. I had everything working fine when I was just cycling through the animation: Idle - Attack - Attack 1 - Attack 2. Just in an infinite loop. The problem now is that I want it to go Attack - check if x time passes if ctrl pressed before x passes move to Attack 1, if not move back to Idle - Then either Attack 1 or Idle depending on how long has passed. I've almost gotten it a few time, but something always happens where it falls apart if I press ctrl too fast or after multiple cycles of the animation. Any help would be appreciated, I'm just at my wits end on this one. I've been looking at this so long that I just don't know where to go anymore. Code is below, here is the controller using UnityEngine; using System.Collections; public class MeleeAttack : MonoBehaviour { public int damage; public bool Attack; public bool Attack1; public bool Attack2; public bool Idle; private Animator animator; private int attnum = 0; private float count = 2f; private float timeLeft; //Gives value to damage output void MAttackDmg () { if (Input.GetKeyDown (KeyCode.RightControl) || Input.GetKeyDown (KeyCode.LeftControl)) { switch (attnum) { case (0): Attack = true; damage = 2; animator.SetBool ("Attack", Attack); attnum++; Idle = false; animator.SetBool ("Idle", Idle); timeLeft = count; break; case (1): Attack1 = true; damage = 2; animator.SetBool ("Attack1", Attack1); attnum++; Idle = false; animator.SetBool ("Idle", Idle); timeLeft = count; break; case (2): Attack2 = true; damage = 2; animator.SetBool ("Attack2", Attack2); attnum = 0; Idle = false; animator.SetBool ("Idle", Idle); timeLeft = count; break; } } if (Input.GetKeyUp (KeyCode.RightControl) || Input.GetKeyUp (KeyCode.LeftControl)) { switch (attnum) { case (0): Debug.Log ("false"); damage = 0; if (timeLeft <= 0f) { Attack2 = false; animator.SetBool ("Attack2", Attack2); Debug.Log ("t1"); Idle = true; animator.SetBool ("Idle", Idle); attnum = 0; timeLeft = count; } break; case (1): Debug.Log ("false1"); damage = 0; if (timeLeft <= 0f) { Debug.Log ("t2"); Attack = false; animator.SetBool ("Attack", Attack); Idle = true; animator.SetBool ("Idle", Idle); attnum = 0; timeLeft = count; } break; case (2): Debug.Log ("false2"); damage = 0; if (timeLeft <= 0f) { Attack1 = false; animator.SetBool ("Attack1", Attack1); Debug.Log ("t3"); Idle = true; animator.SetBool ("Idle", Idle); attnum = 0; timeLeft = count; } break; } } } // Use this for initialization void Awake () { animator = GetComponent<Animator> (); } // Update is called once per frame void Update () { timeLeft -= Time.deltaTime;; MAttackDmg (); } void Start (){ timeLeft = count; } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • python compare time

    - by Jesse Siu
    i want to using python create filter for a log file. get recent 7 days record. but when i didn't know how to compare time. like current time is 11/9/2012, i want to get records from 04/9/2012 to now the log file like Sat Sep 2 03:32:13 2012 [pid 12461] CONNECT: Client "66.249.68.236" Sat Sep 2 03:32:13 2012 [pid 12460] [ftp] OK LOGIN: Client "66.249.68.236", anon password "[email protected]" Sat Sep 2 03:32:14 2012 [pid 12462] [ftp] OK DOWNLOAD: Client "66.249.68.236", "/pub/10.5524/100001_101000/100022/readme.txt", 451 i using this one def OnlyRecent(line): print time.strptime(line.split("[")[0].strip(),"%a %b %d %H:%M:%S %Y") print time.time() if time.strptime(line.split("[")[0].strip(),"%a %b %d %H:%M:%S %Y") < time.time(): return True return False But it shows (2012, 9, 2, 3, 32, 13, 5, 246, -1) 1347332968.08 (2012, 9, 2, 3, 32, 13, 5, 246, -1) 1347332968.08 (2012, 9, 2, 3, 32, 14, 5, 246, -1) 1347332968.08 the time format is different, and it can't compare time. So how to set this comparison in 7 days. Thanks

    Read the article

  • Learn Cloud Computing – It’s Time

    - by Ben Griswold
    Last week, I gave an in-house presentation on cloud computing.  I walked through an overview of cloud computing – characteristics (on demand, elastic, fully managed by provider), why are we interested (virtualization, distributed computing, increased access to high-speed internet, weak economy), various types (public, private, virtual private cloud) and services models (IaaS, PaaS, SaaS.)  Though numerous providers have emerged in the cloud computing space, the presentation focused on Amazon, Google and Microsoft offerings and provided an overview of their platforms, costs, data tier technologies, management and security.  One of the biggest talking points was why developers should consider the cloud as part of their deployment strategy: You only have to pay for what you consume You will be well-positioned for one time event provisioning You will reap the benefits of automated growth and scalable technologies For the record: having deployed dozens of applications on various platforms over the years, pricing tends to be the biggest customer concern.  Yes, scalability is a customer consideration, too, but it comes in distant second.  Boy do I hope you’re still reading… You may be thinking, “Cloud computing is well and good and it sounds catchy, but should I bother?  After all, it’s just another technology bundle which I’m supposed to ramp up on because it’s the latest thing, right?”  Well, my clients used to be 100% reliant upon me to find adequate hosting for them.  Now I find they are often aware of cloud services and some come to me with the “possibility” that deploying to the cloud is the best solution for them.  It’s like the patient who walks into the doctor’s office with their diagnosis and treatment already in mind thanks to the handful of Internet searches they performed earlier that day.  You know what?  The customer may be correct about the cloud. It may be a perfect fit for their app.  But maybe not…  I don’t think there’s a need to learn about every technical thing under the sun, but if you are responsible for identifying hosting solutions for your customers, it is time to get up to speed on cloud computing and the various offerings (if you haven’t already.)  Here are a few references to get you going: DZone Refcardz #82 Getting Started with Cloud Computing by Daniel Rubio Wikipedia Cloud Computing – What is it? Amazon Machine Images (AMI) Google App Engine SDK Azure SDK EC2 Spot Pricing Google App Engine Team Blog Amazon EC2 Team Blog Microsoft Azure Team Blog Amazon EC2 – Cost Calculator Google App Engine – Cost and Billing Resources Microsoft Azure – Cost Calculator Larry Ellison has stated that cloud computing has been defined as "everything that we currently do" and that it will have no effect except to "change the wording on some of our ads" Oracle launches worldwide cloud-computing tour NoSQL Movement  

    Read the article

  • connecting… for infinity time

    - by Subhransu
    I have website working fine before. But now its not able to connect to the server(I believe that is the problem). But its strange that the message not able to connect to the server is not coming and its keep connecting... for infinite time. Here is the screenshot. Here are some of the useful details about the status of the server. Application starts when server wakes up are: cd /etc/init.d/ Application server running in my server : Traceroute:

    Read the article

  • The Best Free Online First Person Shooter (FPS) Games

    - by Lori Kaufman
    First Person Shooter (FPS) games are action games centered around gun and projectile weapon-based combat. As the player, you experience the action directly through the eyes of the protagonist. FPS games have become a very popular type of game online. A lot of FPS games are paid, but there are many you can play for free. Most FPS games have online versions where you play in a supported browser or download a program for your PC that allows you to connect to the game online. We have collected links and information about some of the more popular free FPS games available. All the games listed here are free to play, but there may be some limitations, and you have to register for many of them and download game clients to your computer to be able to connect to the game online. Secure Yourself by Using Two-Step Verification on These 16 Web Services How to Fix a Stuck Pixel on an LCD Monitor How to Factory Reset Your Android Phone or Tablet When It Won’t Boot

    Read the article

< Previous Page | 43 44 45 46 47 48 49 50 51 52 53 54  | Next Page >