Search Results

Search found 12398 results on 496 pages for 'in memory oltp'.

Page 470/496 | < Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >

  • Windows Phone period task, function not executing

    - by Special K.
    I'm trying to execute a code (to parse an XML to be more precisely, and after that I'll toast message the user with some new info's), but the class function AccDetailsDownloaded is not executed (is simply skipped), also the memory usage is ~2mb out of 6, here is my code: if (task is PeriodicTask) { getData(); } else { getData(); } // If debugging is enabled, launch the agent again in one minute. #if DEBUG_AGENT ScheduledActionService.LaunchForTest(task.Name, TimeSpan.FromSeconds(60)); #endif // Call NotifyComplete to let the system know the agent is done working. NotifyComplete(); } public void getData() { var settings = IsolatedStorageSettings.ApplicationSettings; string url = "http://example.com/example.xml"; if (!System.Net.NetworkInformation.NetworkInterface.GetIsNetworkAvailable()) { MessageBox.Show("No network connection available!"); return; } // start loading XML-data WebClient downloader = new WebClient(); Uri uri = new Uri(url, UriKind.Absolute); downloader.DownloadStringCompleted += new DownloadStringCompletedEventHandler(AccDetailsDownloaded); downloader.DownloadStringAsync(uri); string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } void AccDetailsDownloaded(object sender, DownloadStringCompletedEventArgs e) { if (e.Result == null || e.Error != null) { MessageBox.Show("There was an error downloading the XML-file!"); } else { string toastTitle = ""; toastTitle = "Periodic "; string toastMessage = "Mem usage: " + DeviceStatus.ApplicationPeakMemoryUsage + "/" + DeviceStatus.ApplicationMemoryUsageLimit; // Launch a toast to show that the agent is running. // The toast will not be shown if the foreground application is running. ShellToast toast = new ShellToast(); toast.Title = toastTitle; toast.Content = toastMessage; toast.Show(); } } Thank you.

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • how to update an Android ListActivity on changing data of the connected SimpleCursorAdapter

    - by 4485670
    I have the following code. What I want to achieve is to update the shown list when I click an entry so I can traverse through the list. I found the two uncommented ways to do it here on stackoverflow, but neither works. I also got the advice to create a new ListActivity on the data update, but that sounds like wasting resources? EDIT: I found the solution myself. All you need to do is call "SimpleCursorAdapter.changeCursor(new Cursor);". No notifying, no things in UI-Thread or whatever. import android.app.ListActivity; import android.database.Cursor; import android.os.Bundle; import android.util.Log; import android.view.View; import android.widget.ListView; import android.widget.SimpleCursorAdapter; public class MyActivity extends ListActivity { private DepartmentDbAdapter mDbHelper; private Cursor cursor; private String[] from = new String[] { DepartmentDbAdapter.KEY_NAME }; private int[] to = new int[] { R.id.text1 }; private SimpleCursorAdapter notes; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.departments_list); mDbHelper = new DepartmentDbAdapter(this); mDbHelper.open(); // Get all of the departments from the database and create the item list cursor = mDbHelper.fetchSubItemByParentId(1); this.startManagingCursor(cursor); // Now create an array adapter and set it to display using our row notes = new SimpleCursorAdapter(this, R.layout.department_row, cursor, from, to); this.setListAdapter(notes); } @Override protected void onListItemClick(ListView l, View v, int position, long id) { super.onListItemClick(l, v, position, id); // get new data and update the list this.updateData(safeLongToInt(id)); } /** * update data for the list * * @param int departmentId id of the parent department */ private void updateData(int departmentId) { // close the old one, get a new one cursor.close(); cursor = mDbHelper.fetchSubItemByParentId(departmentId); // change the cursor of the adapter to the new one notes.changeCursor(cursor); } /** * safely convert long to in to save memory * * @param long l the long variable * * @return integer */ public static int safeLongToInt(long l) { if (l < Integer.MIN_VALUE || l > Integer.MAX_VALUE) { throw new IllegalArgumentException (l + " cannot be cast to int without changing its value."); } return (int) l; } }

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • How to solve High Load average issue in Linux systems?

    - by RoCkStUnNeRs
    The following is the different load with cpu time in different time limit . The below output has parsed from the top command. TIME LOAD US SY NICE ID WA HI SI ST 12:02:27 208.28 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:23:22 195.48 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 12:34:55 199.15 4.2%us 1.0%sy 0.2%ni 93.9%id 0.7%wa 0.0%hi 0.0%si 0.0%st 13:41:50 203.66 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st 13:42:58 278.63 4.2%us 1.0%sy 0.2%ni 93.8%id 0.8%wa 0.0%hi 0.0%si 0.0%st Following is the additional Information of the system? cat /proc/cpuinfo processor : 0 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 0 cpu cores : 4 apicid : 0 initial apicid : 0 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4658.69 clflush size : 64 power management: processor : 1 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 1 cpu cores : 4 apicid : 1 initial apicid : 1 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 2 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 2 cpu cores : 4 apicid : 2 initial apicid : 2 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4655.00 clflush size : 64 power management: processor : 3 vendor_id : GenuineIntel cpu family : 6 model : 23 model name : Intel(R) Xeon(R) CPU E5410 @ 2.33GHz stepping : 10 cpu MHz : 1992.000 cache size : 6144 KB physical id : 0 siblings : 4 core id : 3 cpu cores : 4 apicid : 3 initial apicid : 3 fdiv_bug : no hlt_bug : no f00f_bug : no coma_bug : no fpu : yes fpu_exception : yes cpuid level : 13 wp : yes flags : fpu vme de pse tsc msr pae mce cx8 apic sep mtrr pge mca cmov pat pse36 clflush dts acpi mmx fxsr sse sse2 ss ht tm pbe lm constant_tsc arch_perfmon pebs bts pni monitor ds_cpl vmx est tm2 ssse3 cx16 xtpr dca sse4_1 lahf_lm bogomips : 4654.99 clflush size : 64 power management: Memory: total used free shared buffers cached Mem: 2 1 1 0 0 0 Swap: 5 0 5 let me know why the system is getting abnormally this much high load?

    Read the article

  • why gcc emits segmentation ,after my code run

    - by gcc
    every time ,why have I encountered with segmentation fault ? still,I have not found my fault sometimes, gcc emits segmentation fault ,sometimes, memory satck limit is exceeded I think you will understand (easily) what is for that code void my_main() { char *tutar[50],tempc; int i=0,temp,g=0,a=0,j=0,d=1,current=0,command=0,command2=0; do{ tutar[i]=malloc(sizeof(int)); scanf("%s",tutar[i]); temp=*tutar[i]; } while(temp=='x'); i=0; num_arrays=atoi(tutar[i]); i=1; tempc=*tutar[i]; if(tempc!='x' && tempc!='d' && tempc!='a' && tempc!='j') { current=1; arrays[current]=malloc(sizeof(int)); l_arrays[current]=calloc(1,sizeof(int)); c_arrays[current]=calloc(1,sizeof(int));} i=1; current=1; while(1) { tempc=*tutar[i]; if(tempc=='x') break; if(tempc=='n') { ++current; arrays[current]=malloc(sizeof(int)); l_arrays[current]=calloc(1,sizeof(int)); c_arrays[current]=calloc(1,sizeof(int)); ++i; continue; } if(tempc=='d') { ++i; command=atoi(tutar[i])-1; free(arrays[command]); free(l_arrays[command]); free(c_arrays[command]); ++i; continue; } if(tempc=='j') { ++i; current=atoi(tutar[i])-1; if(arrays[current]==NULL) { arrays[current]=malloc(sizeof(int)); l_arrays[current]=calloc(1,sizeof(int)); c_arrays[current]=calloc(1,sizeof(int)); ++i; } else { a=l_arrays[current]; j=l_arrays[current]; ++i;} continue; } } }

    Read the article

  • C - How to use both aio_read() and aio_write().

    - by Slav
    I implement game server where I need to both read and write. So I accept incoming connection and start reading from it using aio_read() but when I need to send something, I stop reading using aio_cancel() and then use aio_write(). Within write's callback I resume reading. So, I do read all the time but when I need to send something - I pause reading. It works for ~20% of time - in other case call to aio_cancel() fails with "Operation now in progress" - and I cannot cancel it (even within permanent while cycle). So, my added write operation never happens. How to use these functions well? What did I missed? EDIT: Used under Linux 2.6.35. Ubuntu 10 - 32 bit. Example code: void handle_read(union sigval sigev_value) { /* handle data or disconnection */ } void handle_write(union sigval sigev_value) { /* free writing buffer memory */ } void start() { const int acceptorSocket = socket(AF_INET, SOCK_STREAM, 0); struct sockaddr_in addr; memset(&addr, 0, sizeof(struct sockaddr_in)); addr.sin_family = AF_INET; addr.sin_addr.s_addr = INADDR_ANY; addr.sin_port = htons(port); bind(acceptorSocket, (struct sockaddr*)&addr, sizeof(struct sockaddr_in)); listen(acceptorSocket, SOMAXCONN); struct sockaddr_in address; socklen_t addressLen = sizeof(struct sockaddr_in); for(;;) { const int incomingSocket = accept(acceptorSocket, (struct sockaddr*)&address, &addressLen); if(incomingSocket == -1) { /* handle error ... */} else { //say socket to append outcoming messages at writing: const int currentFlags = fcntl(incomingSocket, F_GETFL, 0); if(currentFlags < 0) { /* handle error ... */ } if(fcntl(incomingSocket, F_SETFL, currentFlags | O_APPEND) == -1) { /* handle another error ... */ } //start reading: struct aiocb* readingAiocb = new struct aiocb; memset(readingAiocb, 0, sizeof(struct aiocb)); readingAiocb->aio_nbytes = MY_SOME_BUFFER_SIZE; readingAiocb->aio_fildes = socketDesc; readingAiocb->aio_buf = mySomeReadBuffer; readingAiocb->aio_sigevent.sigev_notify = SIGEV_THREAD; readingAiocb->aio_sigevent.sigev_value.sival_ptr = (void*)mySomeData; readingAiocb->aio_sigevent.sigev_notify_function = handle_read; if(aio_read(readingAiocb) != 0) { /* handle error ... */ } } } } //called at any time from server side: send(void* data, const size_t dataLength) { //... some thread-safety precautions not needed here ... const int cancellingResult = aio_cancel(socketDesc, readingAiocb); if(cancellingResult != AIO_CANCELED) { //this one happens ~80% of the time - embracing previous call to permanent while cycle does not help: if(cancellingResult == AIO_NOTCANCELED) { puts(strerror(aio_return(readingAiocb))); // "Operation now in progress" /* don't know what to do... */ } } //otherwise it's okay to send: else { aio_write(...); } }

    Read the article

  • WinForm-style Invoke() in unmanaged C++

    - by Matt Green
    I've been playing with a DataBus-type design for a hobby project, and I ran into an issue. Back-end components need to notify the UI that something has happened. My implementation of the bus delivers the messages synchronously with respect to the sender. In other words, when you call Send(), the method blocks until all the handlers have called. (This allows callers to use stack memory management for event objects.) However, consider the case where an event handler updates the GUI in response to an event. If the handler is called, and the message sender lives on another thread, then the handler cannot update the GUI due to Win32's GUI elements having thread affinity. More dynamic platforms such as .NET allow you to handle this by calling a special Invoke() method to move the method call (and the arguments) to the UI thread. I'm guessing they use the .NET parking window or the like for these sorts of things. A morbid curiosity was born: can we do this in C++, even if we limit the scope of the problem? Can we make it nicer than existing solutions? I know Qt does something similar with the moveToThread() function. By nicer, I'll mention that I'm specifically trying to avoid code of the following form: if(! this->IsUIThread()) { Invoke(MainWindowPresenter::OnTracksAdded, e); return; } being at the top of every UI method. This dance was common in WinForms when dealing with this issue. I think this sort of concern should be isolated from the domain-specific code and a wrapper object made to deal with it. My implementation consists of: DeferredFunction - functor that stores the target method in a FastDelegate, and deep copies the single event argument. This is the object that is sent across thread boundaries. UIEventHandler - responsible for dispatching a single event from the bus. When the Execute() method is called, it checks the thread ID. If it does not match the UI thread ID (set at construction time), a DeferredFunction is allocated on the heap with the instance, method, and event argument. A pointer to it is sent to the UI thread via PostThreadMessage(). Finally, a hook function for the thread's message pump is used to call the DeferredFunction and de-allocate it. Alternatively, I can use a message loop filter, since my UI framework (WTL) supports them. Ultimately, is this a good idea? The whole message hooking thing makes me leery. The intent is certainly noble, but are there are any pitfalls I should know about? Or is there an easier way to do this?

    Read the article

  • .NET Windows Service with timer stops responding

    - by Biri
    I have a windows service written in c#. It has a timer inside, which fires some functions on a regular basis. So the skeleton of my service: public partial class ArchiveService : ServiceBase { Timer tickTack; int interval = 10; ... protected override void OnStart(string[] args) { tickTack = new Timer(1000 * interval); tickTack.Elapsed += new ElapsedEventHandler(tickTack_Elapsed); tickTack.Start(); } protected override void OnStop() { tickTack.Stop(); } private void tickTack_Elapsed(object sender, ElapsedEventArgs e) { ... } } It works for some time (like 10-15 days) then it stops. I mean the service shows as running, but it does not do anything. I make some logging and the problem can be the timer, because after the interval it does not call the tickTack_Elapsed function. I was thinking about rewrite it without a timer, using an endless loop, which stops the processing for the amount of time I set up. This is also not an elegant solution and I think it can have some side effects regarding memory. The Timer is used from the System.Timers namespace, the environment is Windows 2003. I used this approach in two different services on different servers, but both is producing this behavior (this is why I thought that it is somehow connected to my code or the framework itself). Does somebody experienced this behavior? What can be wrong? Edit: I edited both services. One got a nice try-catch everywhere and more logging. The second got a timer-recreation on a regular basis. None of them stopped since them, so if this situation remains for another week, I will close this question. Thank you for everyone so far. Edit: I close this question because nothing happened. I mean I made some changes, but those changes are not really relevant in this matter and both services are running without any problem since then. Please mark it as "Closed for not relevant anymore".

    Read the article

  • A case-insensitive related implementation problem

    - by Robert
    Hi All, I am going through a final refinement posted by the client, which needs me to do a case-insesitive query. I will basically walk through how this simple program works. First of all, in my Java class, I did a fairly simple webpage parsing: title=(String)results.get("title"); doc = docBuilder.parse("http://" + server + ":" + port + "/exist/rest/db/wb/xql/media_lookup.xql?" + "&title=" + title); This Java statement references an XQuery file "media_lookup.xql" which is stored on localhost, and the only parameter we are passing is the string "title". Secondly, let's take at look at that XQuery file: $title := request:get-parameter('title',""), $mediaNodes := doc('/db/wb/portfolio/media_data.xml'), $query := $mediaNodes//media[contains(title,$title)], Then it will evaluate that query. This XQuery will get the "title" parameter that are passes from our Java class, and query the "media_data" xml file stored in the database, which contains a bunch of media nodes with a 'title' element node. As you may expect, this simple query will just match those media nodes whose 'title' element contains a substring of what the value of string 'title' is. So if our 'title' is "Chi", it will return media nodes whose title may be "Chicago" or "Chicken". The refinment request posted by the client is that there should be NO case-sensitivity. The very intuitive way is to modify the XQuery statement by using a lower-case funtion in it, like: $query := $mediaNodes//media[contains(lower-case(title/text(),lower-case($title))], However, the question comes: this modified query will run my machine into memory overflow. Since my "media_data.xml" is quite huge and contains thouands of millions of media nodes, I assume the lower-case() function will run on each of the entries, thus causing the machine to crash. I've talked with some experienced XQuery programmer, and they think I should use an index to solve this problem, and I will definitely research into that. But before that, I am just posting this problem here to get other ideas or any suggestions, do you think any other way may help? for example, could I tweak the Java parse statement to realize the case-insensitivity? Since I think I saw some people did some string concatination by using "contains." in Java before passing it to the server. Any idea or help is welcomed, thanks in advance.

    Read the article

  • Understanding C++ dynamic allocation

    - by kiokko89
    Consider the following code: class CString { private: char* buff; size_t len; public: CString(const char* p):len(0), buff(nullptr) { cout << "Constructor called!"<<endl; if (p!=nullptr) { len= strlen(p); if (len>0) { buff= new char[len+1]; strcpy_s(buff, len+1, p); } } } CString (const CString& s) { cout << "Copy constructor called!"<<endl; len= s.len; buff= new char[len+1]; strcpy_s(buff, len+1, s.buff); } CString& operator = (const CString& rhs) { cout << "Assignment operator called!"<<endl; if (this != &rhs) { len= rhs.len; delete[] buff; buff= new char[len+1]; strcpy_s(buff, len+1, rhs.buff); } return *this; } CString operator + (const CString& rhs) const { cout << "Addition operator called!"<<endl; size_t lenght= len+rhs.len+1; char* tmp = new char[lenght]; strcpy_s(tmp, lenght, buff); strcat_s(tmp, lenght, rhs.buff); return CString(tmp); } ~CString() { cout << "Destructor called!"<<endl; delete[] buff; } }; int main() { CString s1("Hello"); CString s2("World"); CString s3 = s1+s2; } My problem is that I don't know how to delete the memory allocated in the addition operator function(char* tmp = new char[length]). I couldn't do this in the constructor(I tried delete[] p) because it is also called from the main function with arrays of chars as parameters which are not allocated on the heap...How can I get around this? (Sorry for my bad English...)

    Read the article

  • BufferedReader no longer buffering after a while?

    - by BobTurbo
    Sorry I can't post code but I have a bufferedreader with 50000000 bytes set as the buffer size. It works as you would expect for half an hour, the HDD light flashing every two minutes or so, reading in the big chunk of data, and then going quiet again as the CPU processes it. But after about half an hour (this is a very big file), the HDD starts thrashing as if it is reading one byte at a time. It is still in the same loop and I think I checked free ram to rule out swapping (heap size is default). Probably won't get any helpful answers, but worth a try. OK I have changed heap size to 768mb and still nothing. There is plenty of free memory and java.exe is only using about 300mb. Now I have profiled it and heap stays at about 200MB, well below what is available. CPU stays at 50%. Yet the HDD starts thrashing like crazy. I have.. no idea. I am going to rewrite the whole thing in c#, that is my solution. Here is the code (it is just a throw-away script, not pretty): BufferedReader s = null; HashMap<String, Integer> allWords = new HashMap<String, Integer>(); HashSet<String> pageWords = new HashSet<String>(); long[] pageCount = new long[78592]; long pages = 0; Scanner wordFile = new Scanner(new BufferedReader(new FileReader("allWords.txt"))); while (wordFile.hasNext()) { allWords.put(wordFile.next(), Integer.parseInt(wordFile.next())); } s = new BufferedReader(new FileReader("wikipedia/enwiki-latest-pages-articles.xml"), 50000000); StringBuilder words = new StringBuilder(); String nextLine = null; while ((nextLine = s.readLine()) != null) { if (a.matcher(nextLine).matches()) { continue; } else if (b.matcher(nextLine).matches()) { continue; } else if (c.matcher(nextLine).matches()) { continue; } else if (d.matcher(nextLine).matches()) { nextLine = s.readLine(); if (e.matcher(nextLine).matches()) { if (f.matcher(s.readLine()).matches()) { pageWords.addAll(Arrays.asList(words.toString().toLowerCase().split("[^a-zA-Z]"))); words.setLength(0); pages++; for (String word : pageWords) { if (allWords.containsKey(word)) { pageCount[allWords.get(word)]++; } else if (!word.isEmpty() && allWords.containsKey(word.substring(0, word.length() - 1))) { pageCount[allWords.get(word.substring(0, word.length() - 1))]++; } } pageWords.clear(); } } } else if (g.matcher(nextLine).matches()) { continue; } words.append(nextLine); words.append(" "); }

    Read the article

  • Akka framework support for finding duplicate messages

    - by scala_is_awesome
    I'm trying to build a high-performance distributed system with Akka and Scala. If a message requesting an expensive (and side-effect-free) computation arrives, and the exact same computation has already been requested before, I want to avoid computing the result again. If the computation requested previously has already completed and the result is available, I can cache it and re-use it. However, the time window in which duplicate computation can be requested may be arbitrarily small. e.g. I could get a thousand or a million messages requesting the same expensive computation at the same instant for all practical purposes. There is a commercial product called Gigaspaces that supposedly handles this situation. However there seems to be no framework support for dealing with duplicate work requests in Akka at the moment. Given that the Akka framework already has access to all the messages being routed through the framework, it seems that a framework solution could make a lot of sense here. Here is what I am proposing for the Akka framework to do: 1. Create a trait to indicate a type of messages (say, "ExpensiveComputation" or something similar) that are to be subject to the following caching approach. 2. Smartly (hashing etc.) identify identical messages received by (the same or different) actors within a user-configurable time window. Other options: select a maximum buffer size of memory to be used for this purpose, subject to (say LRU) replacement etc. Akka can also choose to cache only the results of messages that were expensive to process; the messages that took very little time to process can be re-processed again if needed; no need to waste precious buffer space caching them and their results. 3. When identical messages (received within that time window, possibly "at the same time instant") are identified, avoid unnecessary duplicate computations. The framework would do this automatically, and essentially, the duplicate messages would never get received by a new actor for processing; they would silently vanish and the result from processing it once (whether that computation was already done in the past, or ongoing right then) would get sent to all appropriate recipients (immediately if already available, and upon completion of the computation if not). Note that messages should be considered identical even if the "reply" fields are different, as long as the semantics/computations they represent are identical in every other respect. Also note that the computation should be purely functional, i.e. free from side-effects, for the caching optimization suggested to work and not change the program semantics at all. If what I am suggesting is not compatible with the Akka way of doing things, and/or if you see some strong reasons why this is a very bad idea, please let me know. Thanks, Is Awesome, Scala

    Read the article

  • Casting between variant and bstr_t causing inconsisten crash in Windows 2008

    - by user58470
    We have a C# application, calling a simple C++ wrapper class, that then calls an existing C++ DLL. The C++ code is all VC++ 6.0. We are getting inconsistent behaviour, but the crash, when it happens, always happens within the C++ wrapper DLL, and always in the same spot (have confirmed using painful logging statements). It never happens on any environment except on Windows 2008, so we suspect some bad-but-not-fatal memory trashing is going on that somehow Windows 2008 is being more mindful of. Here's the relevant code, if anyone has any ideas on why this might be crashing it would be much appreciated. We've been tearing our hair out for a few days and project timelines are slipping all for the want of being able to return a simple string back to C#... I've been told we've tried setting the VARIANT vresult using VariantInit, and clearing it when we are done with VariantClear, but that didn't help. // JobMgrDll.cpp : Defines the entry point for the DLL application. // #include "stdafx.h" #include "JobMgrDll.h" #include "jobmgr.h" CString gcontext; CString guser; CString ghost; CString glog; JOBMGRDLL_API int nJobMgrDll=0; extern "C" JOBMGRDLL_API char* perform_billcalc(char* cmd, char* context, char* user,char* host,BSTR* log,int* loglen) { char* result = new char[1000]; memset(result,0,999); result[999] = '\0'; bstr_t bt_command = cmd; UUID uuid = __uuidof(BRLib::Rules); VARIANT vresult; char *p_rv; gcontext = context; guser = user; ghost = host; write_log("execute_job"); p_rv = execute_job(uuid, "none", bt_command, &vresult); write_log("DONE execute_job"); CString message; write_log ("Intializing bstr_t with variant"); // WE ALWAYS GET HERE bstr_t res(vresult); //message.Format("%s result = %s",p_rv,res); //write_log(message); write_log("copying Result"); // WE DON'T ALWAYS GET HERE, BUT SOMETIMES WE DO strcpy(result,(char*)res); write_log(CString(result)); *loglen = glog.GetLength(); *log = glog.AllocSysString(); return result; } Again, any ideas much, much appreciated.

    Read the article

  • Strange Java Socket Behavior (Connects, but Doesn't Send)

    - by Donald Campbell
    I have a fairly complex project that boils down to a simple Client / Server communicating through object streams. Everything works flawlessly for two consecutive connections (I connect once, work, disconnect, then connect again, work, and disconnect). The client connects, does its business, and then closes. The server successfully closes both the object output stream and the socket, with no IO errors. When I try to connect a third time, the connection appears to go through (the ServerSocket.accept() method goes through and an ObjectOutputStream is successfully created). No data is passed, however. The inputStream.readUnshared() method simply blocks. I have taken the following memory precautions: When it comes time to close the sockets, all running threads are stopped, and all objects are nulled out. After every writeUnshared() method call, the ObjectOutputBuffer is flushed and reset. Has anyone encountered a similar problem, or does anyone have any suggestions? I'm afraid my project is rather large, and so copying code is problematic. The project boils down to this: SERVER MAIN ServerSocket serverSocket = new ServerSocket(port); while (true) { new WorkThread(serverSocket.accept()).start(); } WORK THREAD (SERVER) public void run() { ObjectInputBuffer inputBuffer = new ObjectInputBuffer(new BufferedInputStream(socket.getInputStream())); while (running) { try { Object myObject = inputBuffer.readUnshared(); // do work is not specified in this sample doWork(myObject); } catch (IOException e) { running = false; } } try { inputBuffer.close(); socket.close(); } catch (Exception e) { System.out.println("Could not close."); } } CLIENT public Client() { Object myObject; Socket mySocket = new Socket(address, port); try { ObjectOutputBuffer output = new ObjectOutputBuffer(new BufferedOutputStream(mySocket.getOutputStream())); output.reset(); output.flush(); } catch (Exception e) { System.out.println("Could not get an input."); mySocket.close(); return; } // get object data is not specified in this sample. it simply returns a serializable object myObject = getObjectData(); while (myObject != null) { try { output.writeUnshared(myObject); output.reset(); output.flush(); } catch (Exception e) { e.printStackTrace(); break; } // catch } // while try { output.close(); socket.close(); } catch (Exception e) { System.out.println("Could not close."); } } Thank you to everyone who may be able to help!

    Read the article

  • Are there any platforms where using structure copy on an fd_set (for select() or pselect()) causes p

    - by Jonathan Leffler
    The select() and pselect() system calls modify their arguments (the 'struct fd_set *' arguments), so the input value tells the system which file descriptors to check and the return values tell the programmer which file descriptors are currently usable. If you are going to call them repeatedly for the same set of file descriptors, you need to ensure that you have a fresh copy of the descriptors for each call. The obvious way to do that is to use a structure copy: struct fd_set ref_set_rd; struct fd_set ref_set_wr; struct fd_set ref_set_er; ... ...code to set the reference fd_set_xx values... ... while (!done) { struct fd_set act_set_rd = ref_set_rd; struct fd_set act_set_wr = ref_set_wr; struct fd_set act_set_er = ref_set_er; int bits_set = select(max_fd, &act_set_rd, &act_set_wr, &act_set_er, &timeout); if (bits_set > 0) { ...process the output values of act_set_xx... } } My question: Are there any platforms where it is not safe to do a structure copy of the struct fd_set values as shown? I'm concerned lest there be hidden memory allocation or anything unexpected like that. (There are macros/functions FD_SET(), FD_CLR(), FD_ZERO() and FD_ISSET() to mask the internals from the application.) I can see that MacOS X (Darwin) is safe; other BSD-based systems are likely to be safe, therefore. You can help by documenting other systems that you know are safe in your answers. (I do have minor concerns about how well the struct fd_set would work with more than 8192 open file descriptors - the default maximum number of open files is only 256, but the maximum number is 'unlimited'. Also, since the structures are 1 KB, the copying code is not dreadfully efficient, but then running through a list of file descriptors to recreate the input mask on each cycle is not necessarily efficient either. Maybe you can't do select() when you have that many file descriptors open, though that is when you are most likely to need the functionality.) There's a related SO question - asking about 'poll() vs select()' which addresses a different set of issues from this question.

    Read the article

  • getting Cannot identify image file when trying to create thumbnail in django

    - by Mo J. Mughrabi
    Am trying to create a thumbnail in django, am trying to build a custom class specifically to be used for generating thumbnails. As following from StringIO import StringIO from PIL import Image class Thumbnail(object): source = '' size = (50, 50) output = '' def __init__(self): pass @staticmethod def load(src): self = Thumbnail() self.source = src return self def generate(self, size=(50, 50)): if not isinstance(size, tuple): raise Exception('Thumbnail class: The size parameter must be an instance of a tuple.') self.size = size # resize properties box = self.size factor = 1 fit = True image = Image.open(self.source) # Convert to RGB if necessary if image.mode not in ('L', 'RGB'): image = image.convert('RGB') while image.size[0]/factor > 2*box[0] and image.size[1]*2/factor > 2*box[1]: factor *=2 if factor > 1: image.thumbnail((image.size[0]/factor, image.size[1]/factor), Image.NEAREST) #calculate the cropping box and get the cropped part if fit: x1 = y1 = 0 x2, y2 = image.size wRatio = 1.0 * x2/box[0] hRatio = 1.0 * y2/box[1] if hRatio > wRatio: y1 = int(y2/2-box[1]*wRatio/2) y2 = int(y2/2+box[1]*wRatio/2) else: x1 = int(x2/2-box[0]*hRatio/2) x2 = int(x2/2+box[0]*hRatio/2) image = image.crop((x1,y1,x2,y2)) #Resize the image with best quality algorithm ANTI-ALIAS image.thumbnail(box, Image.ANTIALIAS) # save image to memory temp_handle = StringIO() image.save(temp_handle, 'png') temp_handle.seek(0) self.output = temp_handle return self def get_output(self): return self.output.read() the purpose of the class is so i can use it inside different locations to generate thumbnails on the fly. The class works perfectly, I've tested it directly under a view.. I've implemented the thumbnail class inside the save method of the forms to resize the original images on saving. in my design, I have two fields for thumbnails. I was able to generate one thumbnail, if I try to generate two it crashes and I've been stuck for hours not sure whats the problem. Here is my model class Image(models.Model): article = models.ForeignKey(Article) title = models.CharField(max_length=100, null=True, blank=True) src = models.ImageField(upload_to='publication/image/') r128 = models.ImageField(upload_to='publication/image/128/', blank=True, null=True) r200 = models.ImageField(upload_to='publication/image/200/', blank=True, null=True) uploaded_at = models.DateTimeField(auto_now=True) Here is my forms class ImageForm(models.ModelForm): """ """ class Meta: model = Image fields = ('src',) def save(self, commit=True): instance = super(ImageForm, self).save(commit=True) file = Thumbnail.load(instance.src) instance.r128 = SimpleUploadedFile( instance.src.name, file.generate((128, 128)).get_output(), content_type='image/png' ) instance.r200 = SimpleUploadedFile( instance.src.name, file.generate((200, 200)).get_output(), content_type='image/png' ) if commit: instance.save() return instance the strange part is, when i remove the line which contains instance.r200 in the form save. It works fine, and it does the thumbnail and stores it successfully. Once I add the second thumbnail it fails.. Any ideas what am doing wrong here? Thanks Update: I tried earlier doing the following but I still got the same error class ImageForm(models.ModelForm): """ """ class Meta: model = Image fields = ('src',) def save(self, commit=True): instance = super(ImageForm, self).save(commit=True) instance.r128 = SimpleUploadedFile( instance.src.name, Thumbnail.load(instance.src).generate((128, 128)).get_output(), content_type='image/png' ) instance.r200 = SimpleUploadedFile( instance.src.name, Thumbnail.load(instance.src).generate((200, 200)).get_output(), content_type='image/png' ) if commit: instance.save() return instance

    Read the article

  • ANSI C as core of a C# project? Is this possible?

    - by Nektarios
    I'm writing a NON-GUI app which I want to be cross platform between OS X and Windows. I'm looking at the following architecture, but I don't know if it will work on the windows side: (Platform specific entry point) - ANSI C main loop = ANSI C model code doing data processing / logic = (Platform specific helpers) So the core stuff I'm planning to write in regular ANSI C, because A) it should be platform independent, B) I'm extremely comfortable with C, C) It can do the job and do it well (Platform specific entry point) can be written in whatever necessary to get the job done, this is a small amount of code, doesn't matter to me. (Platform specific helpers) is the sticky thing. This is stuff like parsing XML, accessing databases, graphics toolkit stuff, whatever. Things that aren't easy in C. Things that modern languages/frameworks will give for free. On OS X this code will be written in Objective-C interfacing with Cocoa. On Windows I'm thinking my best bet is to use C# So on Windows my architecture (simplified) looks like (C# or C?) - ANSI C - C# Is this possible? Some thoughts/suggestions so far.. 1) Compile my C core as a .dll -- this is fine, but seems there's no way to call my C# helpers unless I can somehow get function pointers and pass them to my core, but that seems unlikely 2) Compile a C .exe and a C# .exe and have them talk via shared memory or some kind of IPC. I'm not entirely opposed to this but it obviously introduces a lot of complexity so it doesn't seem ideal 3) Instead of C# use C++, it gets me some nice data management stuff and nice helper code. And I can mix it pretty easily. And the work I do could probably easily port to Linux. But I really don't like C++, and I don't want this to turn in to a 3rd-party-library-fest. Not that it's a huge deal, but it's 2010.. anything for basic data management should be built in. And targetting Linux is really not a priority. Note that no "total" alternatives are OK as suggested in other similar questions on SO I've seen; java, RealBasic, mono.. this is an extremely performance intensive application doing soft realtime for game/simulation purposes, I need C & friends here to do it right (maybe you don't, but I do)

    Read the article

  • What can cause System.Move to occasionaly give wrong results?

    - by Fredrik Loftheim
    The last few days we have had some strange problems with our database components developed by a third party. There has been no changes to these components for months. The code that HAS changed the last few days is our own code and we have also updated our gui-components developed by another third party. After debugging I have found that a call to System.Move in one of the database component procedures occationaly gives wrong results! Please take a look at the code below from the database components and read my comments. How can this inconsistent behaviour happen? Can anyone give me an idea of how to procede to find the cause of this inconsistent behaviour? NB! I dont think there is anything wrong with THIS code, it is only shown to explain the problem "symptoms". My guess is that there is some sort of memory corruption or something, caused by our code or the updated gui-component-code. Edit: Take a look at the blogpost linked below. It seems that it could be related to my problem. At least as I read it it confirms that System.Move can give wrong results: http://blog.excastle.com/2007/08/28/delphi-bug-of-the-day-fpu-stack-leak/ Procedure InternalDescribe; var cbufl: sb4; //sb4=LongInt cbuf: array[0..30] of char; cbufp: PChar; //.... begin //..Some code repeat //...Some code to initialize cbufp and cbufl //On the 15. iteration the values immediately Before Move are always these: //cbufp = 'STDPRODUCTSTOREDELEMENTSCOUNT' //cbuf = ('S', 'T', 'A', 'T', 'U', 'S', #0, 'E', 'V', 'A', 'R', 'R', 'E', 'C', 'I', 'D', #0, 'D', 'U', 'C', 'T', 'I', 'D', #0, #0, #0, #0, #0, #0, #0, #0) //cbufl = 29 Move(cbufp^, cbuf, cbufl); //Values immediately After Move should then be: //cbuf = ('S', 'T', 'D', 'P', 'R', 'O', 'D', 'U', 'C', 'T', 'S', 'T', 'O', 'R', 'E', 'D', 'E', 'L', 'E', 'M', 'E', 'N', 'T', 'S', 'C', 'O', 'U', 'N', 'T', #0, #0) //But sometimes this Move results in this value( 1 in 5..15 times): //cbuf = ('S', 'T', 'D', 'P', 'R', 'O', 'D', 'U', 'C', 'T', 'S', 'T', 'O', 'R', 'E', 'D', #0, #0, #0, #0, #0, 'N', 'T', 'S', 'C', 'O', 'U', 'N', 'T', #0, #0) } until SomeCondition; //...Some more code end;

    Read the article

  • Different behavior of reflected generic delegates with and without debugger

    - by Andrew_B
    Hello. We have encountered some strange things while calling reflected generic delegates. In some cases with attatched debuger we can make impossible call, while without debugger we cannot catch any exception and application fastfails. Here is the code: using System; using System.Windows.Forms; using System.Reflection; namespace GenericDelegate { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private delegate Class2 Delegate1(); private void button1_Click(object sender, EventArgs e) { MethodInfo mi = typeof (Class1<>).GetMethod("GetClass", BindingFlags.NonPublic | BindingFlags.Static); if (mi != null) { Delegate1 del = (Delegate1) Delegate.CreateDelegate(typeof (Delegate1), mi); MessageBox.Show("1"); try { del(); } catch (Exception) { MessageBox.Show("No, I can`t catch it"); } MessageBox.Show("2"); mi.Invoke(null, new object[] {});//It's Ok, we'll get exception here MessageBox.Show("3"); } } class Class2 { } class Class1<T> : Class2 { internal static Class2 GetClass() { Type type = typeof(T); MessageBox.Show("Type name " + type.FullName +" Type: " + type + " Assembly " + type.Assembly); return new Class1<T>(); } } } } There are two problems: Behavior differs with debugger and without You cannot catch this error without debugger by clr tricks. It's just not the clr exception. There are memory acces vialation, reading zero pointer inside of internal code. Use case: You develop something like plugins system for your app. You read external assembly, find suitable method in some type, and execute it. And we just forgot about that we need to check up is the type generic or not. Under VS (and .net from 2.0 to 4.0) everything works fine. Called function does not uses static context of generic type and type parameters. But without VS application fails with no sound. We even cannot identify call stack attaching debuger. Tested with .net 4.0 The question is why VS catches but runtime do not?

    Read the article

  • How to Transfer Large File from MS Word Add-In (VBA) to Web Server?

    - by Ian Robinson
    Overview I have a Microsoft Word Add-In, written in VBA (Visual Basic for Applications), that compresses a document and all of it's related contents (embedded media) into a zip archive. After creating the zip archive it then turns the file into a byte array and posts it to an ASMX web service. This mostly works. Issues The main issue I have is transferring large files to the web site. I can successfully upload a file that is around 40MB, but not one that is 140MB (timeout/general failure). A secondary issue is that building the byte array in the VBScript Word Add-In can fail by running out of memory on the client machine if the zip archive is too large. Potential Solutions I am considering the following options and am looking for feedback on either option or any other suggestions. Option One Opening a file stream on the client (MS Word VBA) and reading one "chunk" at a time and transmitting to ASMX web service which assembles the "chunks" into a file on the server. This has the benefit of not adding any additional dependencies or components to the application, I would only be modifying existing functionality. (Fewer dependencies is better as this solution should work in a variety of server environments and be relatively easy to set up.) Question: Are there examples of doing this or any recommended techniques (either on the client in VBA or in the web service in C#/VB.NET)? Option Two I understand WCF may provide a solution to the issue of transferring large files by "chunking" or streaming data. However, I am not very familiar with WCF, and am not sure what exactly it is capable of or if I can communicate with a WCF service from VBA. This has the downside of adding another dependency (.NET 3.0). But if using WCF is definitely a better solution I may not mind taking that dependency. Questions: Does WCF reliably support large file transfers of this nature? If so, what does this involve? Any resources or examples? Are you able to call a WCF service from VBA? Any examples?

    Read the article

  • Primary language - QtC++, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Technical non-terminating condition in a loop

    - by Snarfblam
    Most of us know that a loop should not have a non-terminating condition. For example, this C# loop has a non-terminating condition: any even value of i. This is an obvious logic error. void CountByTwosStartingAt(byte i) { // If i is even, it never exceeds 254 for(; i < 255; i += 2) { Console.WriteLine(i); } } Sometimes there are edge cases that are extremely unlikeley, but technically constitute non-exiting conditions (stack overflows and out-of-memory errors aside). Suppose you have a function that counts the number of sequential zeros in a stream: int CountZeros(Stream s) { int total = 0; while(s.ReadByte() == 0) total++; return total; } Now, suppose you feed it this thing: class InfiniteEmptyStream:Stream { // ... Other members ... public override int Read(byte[] buffer, int offset, int count) { Array.Clear(buffer, offset, count); // Output zeros return count; // Never returns -1 (end of stream) } } Or more realistically, maybe a stream that returns data from external hardware, which in certain cases might return lots of zeros (such as a game controller sitting on your desk). Either way we have an infinite loop. This particular non-terminating condition stands out, but sometimes they don't. A completely real-world example as in an app I'm writing. An endless stream of zeros will be deserialized into infinite "empty" objects (until the collection class or GC throws an exception because I've exceeded two billion items). But this would be a completely unexpected circumstance (considering my data source). How important is it to have absolutely no non-terminating conditions? How much does this affect "robustness?" Does it matter if they are only "theoretically" non-terminating (is it okay if an exception represents an implicit terminating condition)? Does it matter whether the app is commercial? If it is publicly distributed? Does it matter if the problematic code is in no way accessible through a public interface/API? Edit: One of the primary concerns I have is unforseen logic errors that can create the non-terminating condition. If, as a rule, you ensure there are no non-terminating conditions, you can identify or handle these logic errors more gracefully, but is it worth it? And when? This is a concern orthogonal to trust.

    Read the article

  • nodejs async.waterfall method

    - by user1513388
    Update 2 Complete code listing var request = require('request'); var cache = require('memory-cache'); var async = require('async'); var server = '172.16.221.190' var user = 'admin' var password ='Passw0rd' var dn ='\\VE\\Policy\\Objects' var jsonpayload = {"Username": user, "Password": password} async.waterfall([ //Get the API Key function(callback){ request.post({uri: 'http://' + server +'/sdk/authorize/', json: jsonpayload, headers: {'content_type': 'application/json'} }, function (e, r, body) { callback(null, body.APIKey); }) }, //List the credential objects function(apikey, callback){ var jsonpayload2 = {"ObjectDN": dn, "Recursive": true} request.post({uri: 'http://' + server +'/sdk/Config/enumerate?apikey=' + apikey, json: jsonpayload2, headers: {'content_type': 'application/json'} }, function (e, r, body) { var dns = []; for (var i = 0; i < body.Objects.length; i++) { dns.push({'name': body.Objects[i].Name, 'dn': body.Objects[i].DN}) } callback(null, dns, apikey); }) }, function(dns, apikey, callback){ // console.log(dns) var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"CredentialPath": dns[i].dn, "Pattern": null, "Recursive": false} console.log(dns[i].dn) request.post({uri: 'http://' + server +'/sdk/credentials/retrieve?apikey=' + apikey, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { // console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, apikey); console.log(cb) }); } } ], function (err, result) { // console.log(result) // result now equals 'done' }); Update: I'm building a small application that needs to make multiple HTTP calls to a an external API and amalgamates the results into a single object or array. e.g. Connect to endpoint and get auth key - pass auth key to step 2 Connect to endpoint using auth key and get JSON results - create an object containing summary results and pass to step 3. Iterate over passed object summary results and call API for each item in the object to get detailed information for each summary line Create a single JSON data structure that contains the summary and detail information. The original question below outlines what I've tried so far! Original Question: Will the async.waterfall method support multiple callbacks? i.e. Iterate over an array thats passed from a previous item in the chain, then invoke multiple http requests each of which would have their own callbacks. e.g, sync.waterfall([ function(dns, key, callback){ var cb = []; for (var i = 0; i < dns.length; i++) { //Retrieve the credential var jsonpayload3 = {"Cred": dns[i].DN, "Pattern": null, "Recursive": false} console.log(dns[i].DN) request.post({uri: 'http://' + vedserver +'/api/cred/retrieve?apikey=' + key, json: jsonpayload3, headers: {'content_type': 'application/json'} }, function (e, r, body) { console.log(body) cb.push({'cl': body.Classname}) callback(null, cb, key); }); } }

    Read the article

< Previous Page | 466 467 468 469 470 471 472 473 474 475 476 477  | Next Page >