Search Results

Search found 34816 results on 1393 pages for 'copy on write'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 48/1393 | < Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >

  • write c++ in latex, noob latex question

    - by voodoomsr
    maybe is a noob question but i can't find the solution in the web, i need to write C++ in Latex. I write C$++$ but the result is like crap, the signs are too big and there is too much space between C and the first plus sign. Previously i needed to write the sharp symbol for C#....c$\sharp$ it also looks like crap but with a escape character it looks nice, for the plus sign i can't do the same.

    Read the article

  • c# write big files to blob sqlite

    - by brizjin-gmail-com
    I have c# application which write files to sqlite database. It uses entity fraemwork for modeling data. Write file to blob (entity byte[] varible) with this line: row.file = System.IO.File.ReadAllBytes(file_to_load.FileName); //row.file is type byte[] //row is entity class table All work correctly when files size is less. When size more 300Mb app throw exception: Exception of type 'System.OutOfMemoryException' was thrown. How I can write to blob direct, without memory varibles?

    Read the article

  • OpenCV: How to copy CvSeq data into CvMat?

    - by Can Bal
    I have a CvSeq structure at hand, which is the output of an available OpenCV function. This holds 128 bytes of data in each of the sequence elements. I want to copy each of these 128-byte elements into rows of a CvMat structure to form a N-by-128 of type CV_32FC1. What would be the most efficient way to do this? I thought of using memcpy but I couldn't come up with a working solution. For the details, I want to calculate the SURF features in an image by cvExtractSURF() function, and copy the SURF descriptors into a matrix for passing it to the cvKMeans2().

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Change present working directory of a calling shell from a ruby script

    - by Erik Kastman
    I'm writing a simple ruby sandbox command-line utility to copy and unzip directories from a remote filesystem to a local scratch directory in order to unzip them and let users edit the files. I'm using Dir.mktmpdir as the default scratch directory, which gives a really ugly path (for example: /var/folders/zz/zzzivhrRnAmviuee+++1vE+++yo/-Tmp-/d20100311-70034-abz5zj) I'd like the last action of the copy-and-unzip script to cd the calling shell into the new scratch directory so people can access it easily, but I can't figure out how to change the PWD of the calling shell. One possibility is to have the utility print out the new path to stdout and then run the script as part of a subshell (i.e. cd $(sandbox my_dir) ), but I want to print out progress on the copy-and-unzipping since it can take up to 10 minutes, so this won't work. Should I just have it go to a pre-determined, easy-to-find scratch directory? Does anyone have a better suggestion? Thanks in advance for your help. -Erik

    Read the article

  • How to write files in specific order?

    - by Bernie
    Okay, here's a weird problem -- My wife just bought a 2014 Nissan Altima. So, I took her iTunes library and converted the .m4a files to .mp3, since the car audio system only supports .mp3 and .wma. So far so good. Then I copied the files to a DOS FAT-32 formatted USB thumb drive, and connected the drive to the car's USB port, only to find all of the tracks were out of sequence. All tracks begin with a two digit numeric prefix, i.e., 01, 02, 03, etc. So you would think they would be in order. So I called Nissan Connect support and the rep told me that there is a known problem with reading files in the correct order. He said the files are read in the same order they are written. So, I manually copied a few albums with the tracks in a predetermined order, and sure enough he was correct. So I copied about 6 albums for testing, then changed to the top level directory and did a "find . music.txt". Then I passed this file to rsync like this: rsync -av --files-from=music.txt . ../Marys\ Music\ Sequenced/ The files looked like they were copied in order, but when I listed the files in order of modified time, they were in the same sequence as the original files: ../Marys Music Sequenced/Air Supply/Air Supply Greatest Hits ls -1rt 01 Lost In Love.mp3 04 Every Woman In The World.mp3 03 Chances.mp3 02 All Out Of Love.mp3 06 Here I Am (Just When I Thought I Was Over You).mp3 05 The One That You Love.mp3 08 I Want To Give It All.mp3 07 Sweet Dreams.mp3 11 Young Love.mp3 So the question is, how can I copy files listed in a file named music.txt, and copy them to a destination, and ensure the modification times are in the same sequence as the files are listed?

    Read the article

  • ClearCase: Copy old versions with Snapshot Views under Windows

    - by cogmios
    Using IBM Rational ClearCase: - I have only access to Snapshot Views so NO dynamic Views I want to copy ALL versions from a certain changeset to c:\temp. I have already listed the changeset versions in a file (couple of hundred of versions, I only need the latest one), I do not have a baseline over this older set. What I now have and does not work: #!/usr/bin/perl -w # # PROGRAM: copytest.pl $filename = "Design test123.doc"; $view = "D:\\AdminViews\\ABC_R1_READ_2\\ABCD002\\ABC_DESIGN\\BLA Framework\\P0\\"; $version = "\\main\\ABC_R1_READ\\1"; $printhet = 'cleartool find . -name "' . $filename . '" -version version(' . $version. ') -exec "cmd /c copy %CLEARCASE_XPN% D:\temp\%CLEARCASE_PN%"'; system($printhet);

    Read the article

  • Unlocking SVN working copy with unversioned resources

    - by Vijay Dev
    I have a repository which contains some unversioned directories and files. The server running svn was recently changed and since the checkout was done using the url svn://OLD-IP, I relocated my svn working copy, this time to the url svn://NEW-DOMAIN-NAME. Now since there are some unversioned resources, the switch did not happen properly and the working copy got locked. A cleanup operation did not work either because of these unversioned resources. I looked up in the net and found about svn ignore and tried that but to no use. I am unable to release all locks. Any ideas on solving the problem? Once I release the locks, I believe I can use svn ignore and carry on the relocate operation.

    Read the article

  • XAML Serialization object not using asp.net shadow copy

    - by mrwayne
    Hi, I'm having a problem where i use the XAML serializer / deserializer for a configuration type file that i have. The problem that i'm getting, is that the XAML serializer is returning objects from the assembly in the /Bin directory, while the rest of the web application is using assembly's stored in the ..../Temporary Files/.. directory. Is there any way to prevent this from happening? Is this a bug in the XAML serializer / assembly loading routines? Every time i compile i need to stop and start the asp.net application so the shadow copy and the bin are exactly the same file. Even when not making a change to the dll and recompiling still causes the problem. Any thoughts on how to get around this problem? Currently i've tried turning shadow copy off, but then i have the same problem of needing to shut down / start up the web app every time i compile. Help!

    Read the article

  • Assinging a GD reference to a new variable fails to copy

    - by Stomped
    This is a contrived example, but it illustrates my problem much more concisely then the code I'm using - and I've tested this and it exhibits the problem: $image = imagecreatefromjpeg('test.jpg'); $copy_of_image = $image; // The important bit imagedestroy($image); header('Content-type: image/jpeg'); imagejpeg($copy_of_image); Now, my expectation is that $copy_of_image is exactly that, but when I run this, it fails, printing out the URL of the script of all things. Comment out the imagedestroy() and it works just fine. a var_dump of $image provides: resource(3) of type (gd) So why can't I copy this? Apparently the assignment $copy_of_image = $image is creating a reference rather then a copy - is there a way to prevent that?

    Read the article

  • Copy hashtable to another hashtable using c++

    - by zengr
    I am starting with c++ and need to know, what should be the approach to copy one hashtable to another hashtable in C++? We can easily do this in java using: HashMap copyOfOriginal=new HashMap(original); But what about C++? How should I go about it? UPDATE Well, I am doing it at a very basic level,perhaps the java example was a wrong one to give. This is what I am trying to implement using C++: I have this hash array and each element of the array point to the head of a linked list. Which has it's individual nodes (data and next pointer). And now, I need to copy the complete hash array and the linked list each node is pointing to.

    Read the article

  • Python Windows File Copy with Wildcard Support

    - by Wang Dingwei
    I've been doing this all the time: result = subprocess.call(['copy', '123*.xml', 'out_folder\\.', '/y']) if result == 0: do_something() else: do_something_else() Until today I started to look into pywin32 modules, then I saw functions like win32file.CopyFiles(), but then I found it may not support copying files to a directory. Maybe this functionality is hidden somewhere, but I haven't found it yet. I've also tried "glob" and "shutil" combination, but "glob" is incredibly slow if there are many files. So, how do you emulate this Windows command with Python? copy 123*.xml out_folder\. /y

    Read the article

  • QObject cloning

    - by Olorin
    I know that Qobjects are supposed to be identities not values eg you cannot copy them and by default the copy constructor and asignment are disabled as explained in qt documentation. But is it possible to create a new Qobject from an existing one using a clone method? Would this be a logic error ? If i say QObject b; QObject a; b.cloneFrom(a); or QObject a = new QBject(); QObject b = new QBject(); b->cloneFrom(a); and the clone method copyes stuff like members etc would this be wrong? And if this is ok can i write my own copy constructor and asignment operator that does just that? Note: i actually want to try this with classes that inherit qobject.

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • How do i write this jpql query?

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • Using ServletOutputStream to write very large files in a Java servlet without memory issues

    - by Martin
    I am using IBM Websphere Application Server v6 and Java 1.4 and am trying to write large CSV files to the ServletOutputStream for a user to download. Files are ranging from a 50-750MB at the moment. The smaller files aren't causing too much of a problem but with the larger files it appears that it is being written into the heap which is then causing an OutOfMemory error and bringing down the entire server. These files can only be served out to authenticated users over https which is why I am serving them through a Servlet instead of just sticking them in Apache. The code I am using is (some fluff removed around this): resp.setHeader("Content-length", "" + fileLength); resp.setContentType("application/vnd.ms-excel"); resp.setHeader("Content-Disposition","attachment; filename=\"export.csv\""); FileInputStream inputStream = null; try { inputStream = new FileInputStream(path); byte[] buffer = new byte[1024]; int bytesRead = 0; do { bytesRead = inputStream.read(buffer, offset, buffer.length); resp.getOutputStream().write(buffer, 0, bytesRead); } while (bytesRead == buffer.length); resp.getOutputStream().flush(); } finally { if(inputStream != null) inputStream.close(); } The FileInputStream doesn't seem to be causing a problem as if I write to another file or just remove the write completly the memory usage doesn't appear to be a problem. What I am thinking is that the resp.getOutputStream().write is being stored in memory until the data can be sent through to the client. So the entire file might be read and stored in the resp.getOutputStream() causing my memory issues and crashing! I have tried Buffering these streams and also tried using Channels from java.nio, none of which seems to make any bit of difference to my memory issues. I have also flushed the outputstream once per iteration of the loop and after the loop, which didn't help.

    Read the article

  • Dynamically add files to visual studio deployment project.

    - by Graeme Yeo
    I've been desperately looking for the answer to this and I feel I'm missing something obvious. I need to copy a folder full of data files into the TARGETDIR of my deployment project at compile time. I can see how I would add individual files (ie. right click in File System and go to Add-File) but I have a folder full of data files which constantly get added to. I'd prefer not to have to add the new files each time I compile. I have tried using a PreBuildEvent to copy the files: copy $(ProjectDir)..\Data*.* $(TargetDir)Data\ which fails with error code 1 when I build. I can't help but feel I'm missing the point here though. Any suggestions? Thanks in advance. Graeme

    Read the article

  • How to merge a "branch" that isn't really a branch (wasn't created by an svn copy)

    - by MatrixFrog
    I'm working on a team with lots of people who are pretty unfamiliar with the concepts of version control systems, and are just kind of doing whatever seems to work, by trial and error. Someone created a "branch" from the trunk that is not ancestrally related to the trunk. My guess is it went something like this: They created a folder in branches. They checked out all the code from the trunk to somewhere on their desktop. They added all that code to the newly created folder as though it was a bunch of brand new files. So the repository isn't aware that all that code is actually just a copy of the trunk. When I look at the history of that branch in TortoiseSVN, and uncheck the "Stop on copy/rename" box, there is no revision that has the trunk (or any other path) under the "Copy from path" column. Then they made lots of changes on their "branch". Meanwhile, others were making lots of changes on the trunk. We tried to do a merge and of course it doesn't work. Because, the trunk and the fake branch are not ancestrally related. I can see only two ways to resolve this: Go through the logs on the "branch", look at every change that was made, and manually apply each change to the trunk. Go through the logs on the trunk, look at every change that was made between revision 540 (when the "branch" was created) and HEAD, and manually apply each change to the "branch". This involves 7 revisions one way or 11 revisions the other way, so neither one is really that terrible. But is there any way to cause the repository to "realize" that the branch really IS ancestrally related even though it was created incorrectly, so that we can take advantage of the built-in merging functionality in Eclipse/TortoiseSVN? (You may be wondering: Why did your company hire these people and allow them to access the SVN repository without making sure they knew how to use it properly first?! We didn't -- this is a school assignment, which is a collaboration between two different classes -- the ones in the lower class were given a very quick hand-wavey "overview" of SVN which didn't really teach them anything. I've asked everyone in the group to please PLEASE read the svn book, and I'll make sure we (the slightly more experienced half of the team) keep a close eye on the repository to ensure this doesn't happen again.)

    Read the article

  • How to copy or duplicate gtk widgets?

    - by PP
    Hi, How to copy or duplicate gtk widgets? In my application I have one huge GtkComboBox created with one long for loop which eats up so much of time and I am using this combo at two places in one single screen. So, what I want to do is create this combo for one time and duplicate/copy it in another one so it will save my time. If I try to add same combo box pointer two times, gtk gives me error "child-paren != NULL" cause in gtk widget can have only single parent. So what to do? Thanks, PP.

    Read the article

  • copy file from unix system to windows using ant

    - by vishu
    can any one help me how to copy file from unix Windoes system to windows UNIX using ant? Thanks in advance EDIT Let me explain in detail what I am looking for I want to copy file from windows to unix machine (correcting my previous question not from unix to windows) using ANT. I thought of using ftp task. Before that as a check I tried to ftp unix sever from windows but it gave connection refused error(Do I need to provide my username and password,if that is the case what is the syntax). But I am able to connect through putty which asks for my user name and password. Does putty uses a different protocol. So if that is the case does ftp task works for me in ANT?. If not what task I need to use?

    Read the article

  • Mercurial: pull changes from unversioned copy

    - by Austin Hyde
    I am currently maintaining a Mercurial repository of the project I am working on. The rest of the team, however, doesn't. There is a "good" (unversioned) copy of the code base that I can access by SSH. What I would like to do is be able to do something like an hg pull from that good copy into my master repository whenever it gets updated. As far as I can tell, there's no obvious way to do this, as hg pull requires you have a source hg repository. I suppose I could use a utility like rsync to update my repository, then commit, but I was wondering: Is there was an easier/less contrived way to do this?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >