Search Results

Search found 17528 results on 702 pages for 'row height'.

Page 48/702 | < Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >

  • Can not delete row from MySQL

    - by Drew
    Howdy all, I've got a table, which won't delete a row. Specifically, when I try to delete any row with a GEO_SHAPE_ID over 150000000 it simply does not disappear from the DB. I have tried: SQLyog to erase it. DELETE FROM TABLE WHERE GEO_SHAPE_ID = 150000042 (0 rows affected). UNLOCK TABLES then 2. As far as I am aware, bigint is a valid candidate for auto_increment. Anyone know what could be up? You gotta help us, Doc. We’ve tried nothin’ and we’re all out of ideas! DJS. PS. Here is the table construct and some sample data just for giggles. CREATE TABLE `GEO_SHAPE` ( `GEO_SHAPE_ID` bigint(11) NOT NULL auto_increment, `RADIUS` float default '0', `LATITUDE` float default '0', `LONGITUDE` float default '0', `SHAPE_TYPE` enum('Custom','Region') default NULL, `PARENT_ID` int(11) default NULL, `SHAPE_POLYGON` polygon default NULL, `SHAPE_TITLE` varchar(45) default NULL, `SHAPE_ABBREVIATION` varchar(45) default NULL, PRIMARY KEY (`GEO_SHAPE_ID`) ) ENGINE=MyISAM AUTO_INCREMENT=150000056 DEFAULT CHARSET=latin1 CHECKSUM=1 DELAY_KEY_WRITE=1 ROW_FORMAT=DYNAMIC; SET FOREIGN_KEY_CHECKS = 0; LOCK TABLES `GEO_SHAPE` WRITE; INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (57, NULL, NULL, NULL, 'Region', 10, NULL, 'Washington', 'WA'); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (58, NULL, NULL, NULL, 'Region', 10, NULL, 'West Virginia', 'WV'); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (59, NULL, NULL, NULL, 'Region', 10, NULL, 'Wisconsin', 'WI'); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000042, 10, -33.8833, 151.217, 'Custom', NULL, NULL, 'Sydney%2C%20New%20South%20Wales%20%2810km%20r', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000043, 10, -33.8833, 151.167, 'Custom', NULL, NULL, 'Annandale%2C%20New%20South%20Wales%20%2810km%', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000048, 10, -27.5, 153.017, 'Custom', NULL, NULL, 'Brisbane%2C%20Queensland%20%2810km%20radius%2', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000045, 10, 43.1002, -75.2956, 'Custom', NULL, NULL, 'New%20York%20Mills%2C%20New%20York%20%2810km%', NULL); INSERT INTO `GEO_SHAPE` (`GEO_SHAPE_ID`, `RADIUS`, `LATITUDE`, `LONGITUDE`, `SHAPE_TYPE`, `PARENT_ID`, `SHAPE_POLYGON`, `SHAPE_TITLE`, `SHAPE_ABBREVIATION`) VALUES (150000046, 10, 40.1117, -78.9258, 'Custom', NULL, NULL, 'Region1', NULL); UNLOCK TABLES; SET FOREIGN_KEY_CHECKS = 1;

    Read the article

  • hierachical query to return final row

    - by jeff
    I have a hierarchical query that doesn't return an expected row (employee badge = 444). TABLE: hr_data badge fname supervisor_badge 111 Jeff 222 222 Joe 333 333 John 444 444 Tom 444 SQL: SELECT CONNECT_BY_ISCYCLE As IC, badge, fname, supervisor_badge FROM hr_data START WITH badge = '111' CONNECT BY NOCYCLE badge = PRIOR supervisor_badge What is Returned: IC badge fname supervisor_badge 0 111 Jeff 222 0 222 Joe 333 1 333 John 444 What is Expected: IC badge fname supervisor_badge 0 111 Jeff 222 0 222 Joe 333 **0** 333 John 444 **1** 444 Tom 444 How can I get this query to return the employee Tom and then stop?

    Read the article

  • Problems with sticky footer - CSS - main content wont go 100% height (float)

    - by Jamie
    I'm trying to implement hxxp://www.cssstickyfooter.com however I am having a few problems! See screenshot: hxxp://img22.imageshack.us/img22/2654/71161106.jpg The div "Content" contains both left and right columns. On smaller resolutions this is working as expected however once the user starts to increase there resolution the content doesn't expand as I intend it to. If you notice the blue box. That should stretch to the footer at the bottom of the page. If you notice that the blue divider line (right_container3-4) stops also at the same point. CODE HTML: hxxp://tinyurl.com/m39x52 CSS: hxxp://tinyurl.com/lb62ej I would apriciate any help at all! I've been racking my brains for ages on this one, its just a small site so I suppose it's not too much of an issue. But it's nice to know all the same! Thankyou P.S. Sorry about the URL formatting

    Read the article

  • Select First Row as default in UITableView [Urgent]

    - by tushar
    hi , ihave application that is viewbased and i am adding tableview as subview to main view and i have taken UITableViewDelegate to respond the table methods everything is working fine but i want to select first row or UITableView as default selected(Highlighted) plz help me if possible then send me sample code and where i have to place that code means in which method or event Thanks In Advance

    Read the article

  • Editing a row in a gridview

    - by chaitanya
    I have a two text boxes named region id and region name..and a button control I enter some values into those text boxes and click the button to insert those values into the "gridview"and a "data table" associated with the gridview. The gridview has the "enable editing" set to true..but when i click the "edit" button of a particular row in a gridview i get no response...i.e i do not get editable textboxes as it happens normally... What is the solution for this?

    Read the article

  • How to draw the graph in android based on its height and size

    - by Rakesh
    i want to draw a graph in a area and i used a linear layout as area.i want to set the size of the graph area,which should be compatible to small,medium ,default emulators etc.i need to set the size for graph area,how can i do it in xml file for eg in blackberry we use Display.getWidth();Similar is there way to get the width of the display either programmatically or in xml Regards Rakesh Shankar.p

    Read the article

  • WPF DataGrid cannot Add a row when datasource is empty

    - by Trindaz
    CanUserAddRows="True" only 'works' when there's already data in the itemsource of the data grid. If it just so happens that there are no rows in the original list of items, then the datagrid doesn't display a 'placeholder' row for entering new items, even though I've set CanUserAddRows="True". Why?! Thanks in advance, Trindaz

    Read the article

  • IText can't keep rows together, second row spans multiple pages but won't stick with first row.

    - by J2SE31
    I am having trouble keeping my first and second rows of my main PDFPTable together using IText. My first row consists of a PDFPTable with some basic search criteria. My second row consists of a PdfPTable that contains all of the tabulated results. Everytime the tabulated results becomes too big and spans multiple pages, it is kicked to the second page automatically rather than showing up directly below the search criteria and then paging to the next page. How can I avoid this problem? I have tried using setSplitRows(false), but I simply get a blank document (see commented lines 117 and 170). How can I keep my tabulated data (second row) up on the first page? An example of my code is shown below (you should be able to just copy/paste). public class TestHelper{ private TestEventHelper helper; public TestHelper(){ super(); helper = new TestEventHelper(); } public TestEventHelper getHelper() { return helper; } public void setHelper(TestEventHelper helper) { this.helper = helper; } public static void main(String[] args){ TestHelper test = new TestHelper(); TestEventHelper helper = test.getHelper(); FileOutputStream file = null; Document document = null; PdfWriter writer = null; try { file = new FileOutputStream(new File("C://Documents and Settings//All Users//Desktop//pdffile2.pdf")); document = new Document(PageSize.A4.rotate(), 36, 36, 36, 36); writer = PdfWriter.getInstance(document, file); // writer.setPageEvent(templateHelper); writer.setPdfVersion(PdfWriter.PDF_VERSION_1_7); writer.setUserunit(1f); document.open(); List<Element> pages = null; try { pages = helper.createTemplate(); } catch (Exception e) { e.printStackTrace(); } Iterator<Element> iterator = pages.iterator(); while (iterator.hasNext()) { Element element = iterator.next(); if (element instanceof Phrase) { document.newPage(); } else { document.add(element); } } } catch (Exception de) { de.printStackTrace(); // log.debug("Exception " + de + " " + de.getMessage()); } finally { if (document != null) { document.close(); } if (writer != null) { writer.close(); } } System.out.println("Done!"); } private class TestEventHelper extends PdfPageEventHelper{ // The PdfTemplate that contains the total number of pages. protected PdfTemplate total; protected BaseFont helv; private static final float SMALL_MARGIN = 20f; private static final float MARGIN = 36f; private final Font font = new Font(Font.HELVETICA, 12, Font.BOLD); private final Font font2 = new Font(Font.HELVETICA, 10, Font.BOLD); private final Font smallFont = new Font(Font.HELVETICA, 10, Font.NORMAL); private String[] datatableHeaderFields = new String[]{"Header1", "Header2", "Header3", "Header4", "Header5", "Header6", "Header7", "Header8", "Header9"}; public TestEventHelper(){ super(); } public List<Element> createTemplate() throws Exception { List<Element> elementList = new ArrayList<Element>(); float[] tableWidths = new float[]{1.0f, 1.0f, 1.0f, 1.0f, 1.0f, 1.25f, 1.25f, 1.25f, 1.25f}; // logger.debug("entering create reports template..."); PdfPTable splitTable = new PdfPTable(1); splitTable.setSplitRows(false); splitTable.setWidthPercentage(100f); PdfPTable pageTable = new PdfPTable(1); pageTable.setKeepTogether(true); pageTable.setWidthPercentage(100f); PdfPTable searchTable = generateSearchFields(); if(searchTable != null){ searchTable.setSpacingAfter(25f); } PdfPTable outlineTable = new PdfPTable(1); outlineTable.setKeepTogether(true); outlineTable.setWidthPercentage(100f); PdfPTable datatable = new PdfPTable(datatableHeaderFields.length); datatable.setKeepTogether(false); datatable.setWidths(tableWidths); generateDatatableHeader(datatable); for(int i = 0; i < 100; i++){ addCell(datatable, String.valueOf(i), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+1), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+2), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+3), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+4), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+5), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+6), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+7), 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, smallFont, true); addCell(datatable, String.valueOf(i+8), 1, Rectangle.NO_BORDER, Element.ALIGN_RIGHT, smallFont, true); } PdfPCell dataCell = new PdfPCell(datatable); dataCell.setBorder(Rectangle.BOX); outlineTable.addCell(dataCell); PdfPCell searchCell = new PdfPCell(searchTable); searchCell.setVerticalAlignment(Element.ALIGN_TOP); PdfPCell outlineCell = new PdfPCell(outlineTable); outlineCell.setVerticalAlignment(Element.ALIGN_TOP); addCell(pageTable, searchCell, 1, Rectangle.NO_BORDER, Element.ALIGN_LEFT, null, null); addCell(pageTable, outlineCell, 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, null, null); PdfPCell pageCell = new PdfPCell(pageTable); pageCell.setVerticalAlignment(Element.ALIGN_TOP); addCell(splitTable, pageCell, 1, Rectangle.NO_BORDER, Element.ALIGN_CENTER, null, null); elementList.add(pageTable); // elementList.add(splitTable); return elementList; } public void onOpenDocument(PdfWriter writer, Document document) { total = writer.getDirectContent().createTemplate(100, 100); total.setBoundingBox(new Rectangle(-20, -20, 100, 100)); try { helv = BaseFont.createFont(BaseFont.HELVETICA, BaseFont.WINANSI, BaseFont.NOT_EMBEDDED); } catch (Exception e) { throw new ExceptionConverter(e); } } public void onEndPage(PdfWriter writer, Document document) { //TODO } public void onCloseDocument(PdfWriter writer, Document document) { total.beginText(); total.setFontAndSize(helv, 10); total.setTextMatrix(0, 0); total.showText(String.valueOf(writer.getPageNumber() - 1)); total.endText(); } private PdfPTable generateSearchFields(){ PdfPTable searchTable = new PdfPTable(2); for(int i = 0; i < 6; i++){ addCell(searchTable, "Search Key" +i, 1, Rectangle.NO_BORDER, Element.ALIGN_RIGHT, font2, MARGIN, true); addCell(searchTable, "Search Value +i", 1, Rectangle.NO_BORDER, Element.ALIGN_LEFT, smallFont, null, true); } return searchTable; } private void generateDatatableHeader(PdfPTable datatable) { if (datatableHeaderFields != null && datatableHeaderFields.length != 0) { for (int i = 0; i < datatableHeaderFields.length; i++) { addCell(datatable, datatableHeaderFields[i], 1, Rectangle.BOX, Element.ALIGN_CENTER, font2); } } } private PdfPCell addCell(PdfPTable table, String cellContent, int colspan, int cellBorder, int horizontalAlignment, Font font) { return addCell(table, cellContent, colspan, cellBorder, horizontalAlignment, font, null, null); } private PdfPCell addCell(PdfPTable table, String cellContent, int colspan, int cellBorder, int horizontalAlignment, Font font, Boolean noWrap) { return addCell(table, cellContent, colspan, cellBorder, horizontalAlignment, font, null, noWrap); } private PdfPCell addCell(PdfPTable table, String cellContent, Integer colspan, Integer cellBorder, Integer horizontalAlignment, Font font, Float paddingLeft, Boolean noWrap) { PdfPCell cell = new PdfPCell(new Phrase(cellContent, font)); return addCell(table, cell, colspan, cellBorder, horizontalAlignment, paddingLeft, noWrap); } private PdfPCell addCell(PdfPTable table, PdfPCell cell, int colspan, int cellBorder, int horizontalAlignment, Float paddingLeft, Boolean noWrap) { cell.setColspan(colspan); cell.setBorder(cellBorder); cell.setHorizontalAlignment(horizontalAlignment); if(paddingLeft != null){ cell.setPaddingLeft(paddingLeft); } if(noWrap != null){ cell.setNoWrap(noWrap); } table.addCell(cell); return cell; } } }

    Read the article

  • How to add 1 to the value of a column of an existing row in mysql

    - by mithun1538
    Hello everyone, I have a table called pollData. It will always contain only 1 row. It has columns option1, option2, option3, option4, option5 each of type int. In the beginning, these columns have 0 as their value. How do I add 1 to any column, say option2? I mean do i retrieve the value of that column first, perform addition, and store back, or is there any auto increment function?

    Read the article

  • Ball bouncing at a certain angle and efficiency computations

    - by X Y
    I would like to make a pong game with a small twist (for now). Every time the ball bounces off one of the paddles i want it to be under a certain angle (between a min and a max). I simply can't wrap my head around how to actually do it (i have some thoughts and such but i simply cannot implement them properly - i feel i'm overcomplicating things). Here's an image with a small explanation . One other problem would be that the conditions for bouncing have to be different for every edge. For example, in the picture, on the two small horizontal edges i do not want a perfectly vertical bounce when in the middle of the edge but rather a constant angle (pi/4 maybe) in either direction depending on the collision point (before the middle of the edge, or after). All of my collisions are done with the Separating Axes Theorem (and seem to work fine). I'm looking for something efficient because i want to add a lot of things later on (maybe polygons with many edges and such). So i need to keep to a minimum the amount of checking done every frame. The collision algorithm begins testing whenever the bounding boxes of the paddle and the ball intersect. Is there something better to test for possible collisions every frame? (more efficient in the long run,with many more objects etc, not necessarily easy to code). I'm going to post the code for my game: Paddle Class public class Paddle : Microsoft.Xna.Framework.DrawableGameComponent { #region Private Members private SpriteBatch spriteBatch; private ContentManager contentManager; private bool keybEnabled; private bool isLeftPaddle; private Texture2D paddleSprite; private Vector2 paddlePosition; private float paddleSpeedY; private Vector2 paddleScale = new Vector2(1f, 1f); private const float DEFAULT_Y_SPEED = 150; private Vector2[] Normals2Edges; private Vector2[] Vertices = new Vector2[4]; private List<Vector2> lst = new List<Vector2>(); private Vector2 Edge; #endregion #region Properties public float Speed { get {return paddleSpeedY; } set { paddleSpeedY = value; } } public Vector2[] Normal2EdgesVector { get { NormalsToEdges(this.isLeftPaddle); return Normals2Edges; } } public Vector2[] VertexVector { get { return Vertices; } } public Vector2 Scale { get { return paddleScale; } set { paddleScale = value; NormalsToEdges(this.isLeftPaddle); } } public float X { get { return paddlePosition.X; } set { paddlePosition.X = value; } } public float Y { get { return paddlePosition.Y; } set { paddlePosition.Y = value; } } public float Width { get { return (Scale.X == 1f ? (float)paddleSprite.Width : paddleSprite.Width * Scale.X); } } public float Height { get { return ( Scale.Y==1f ? (float)paddleSprite.Height : paddleSprite.Height*Scale.Y ); } } public Texture2D GetSprite { get { return paddleSprite; } } public Rectangle Boundary { get { return new Rectangle((int)paddlePosition.X, (int)paddlePosition.Y, (int)this.Width, (int)this.Height); } } public bool KeyboardEnabled { get { return keybEnabled; } } #endregion private void NormalsToEdges(bool isLeftPaddle) { Normals2Edges = null; Edge = Vector2.Zero; lst.Clear(); for (int i = 0; i < Vertices.Length; i++) { Edge = Vertices[i + 1 == Vertices.Length ? 0 : i + 1] - Vertices[i]; if (Edge != Vector2.Zero) { Edge.Normalize(); //outer normal to edge !! (origin in top-left) lst.Add(new Vector2(Edge.Y, -Edge.X)); } } Normals2Edges = lst.ToArray(); } public float[] ProjectPaddle(Vector2 axis) { if (Vertices.Length == 0 || axis == Vector2.Zero) return (new float[2] { 0, 0 }); float min, max; min = Vector2.Dot(axis, Vertices[0]); max = min; for (int i = 1; i < Vertices.Length; i++) { float p = Vector2.Dot(axis, Vertices[i]); if (p < min) min = p; else if (p > max) max = p; } return (new float[2] { min, max }); } public Paddle(Game game, bool isLeftPaddle, bool enableKeyboard = true) : base(game) { contentManager = new ContentManager(game.Services); keybEnabled = enableKeyboard; this.isLeftPaddle = isLeftPaddle; } public void setPosition(Vector2 newPos) { X = newPos.X; Y = newPos.Y; } public override void Initialize() { base.Initialize(); this.Speed = DEFAULT_Y_SPEED; X = 0; Y = 0; NormalsToEdges(this.isLeftPaddle); } protected override void LoadContent() { spriteBatch = new SpriteBatch(GraphicsDevice); paddleSprite = contentManager.Load<Texture2D>(@"Content\pongBar"); } public override void Update(GameTime gameTime) { //vertices array Vertices[0] = this.paddlePosition; Vertices[1] = this.paddlePosition + new Vector2(this.Width, 0); Vertices[2] = this.paddlePosition + new Vector2(this.Width, this.Height); Vertices[3] = this.paddlePosition + new Vector2(0, this.Height); // Move paddle, but don't allow movement off the screen if (KeyboardEnabled) { float moveDistance = Speed * (float)gameTime.ElapsedGameTime.TotalSeconds; KeyboardState newKeyState = Keyboard.GetState(); if (newKeyState.IsKeyDown(Keys.Down) && Y + paddleSprite.Height + moveDistance <= Game.GraphicsDevice.Viewport.Height) { Y += moveDistance; } else if (newKeyState.IsKeyDown(Keys.Up) && Y - moveDistance >= 0) { Y -= moveDistance; } } else { if (this.Y + this.Height > this.GraphicsDevice.Viewport.Height) { this.Y = this.Game.GraphicsDevice.Viewport.Height - this.Height - 1; } } base.Update(gameTime); } public override void Draw(GameTime gameTime) { spriteBatch.Begin(SpriteSortMode.Texture,null); spriteBatch.Draw(paddleSprite, paddlePosition, null, Color.White, 0f, Vector2.Zero, Scale, SpriteEffects.None, 0); spriteBatch.End(); base.Draw(gameTime); } } Ball Class public class Ball : Microsoft.Xna.Framework.DrawableGameComponent { #region Private Members private SpriteBatch spriteBatch; private ContentManager contentManager; private const float DEFAULT_SPEED = 50; private float speedIncrement = 0; private Vector2 ballScale = new Vector2(1f, 1f); private const float INCREASE_SPEED = 50; private Texture2D ballSprite; //initial texture private Vector2 ballPosition; //position private Vector2 centerOfBall; //center coords private Vector2 ballSpeed = new Vector2(DEFAULT_SPEED, DEFAULT_SPEED); //speed #endregion #region Properties public float DEFAULTSPEED { get { return DEFAULT_SPEED; } } public Vector2 ballCenter { get { return centerOfBall; } } public Vector2 Scale { get { return ballScale; } set { ballScale = value; } } public float SpeedX { get { return ballSpeed.X; } set { ballSpeed.X = value; } } public float SpeedY { get { return ballSpeed.Y; } set { ballSpeed.Y = value; } } public float X { get { return ballPosition.X; } set { ballPosition.X = value; } } public float Y { get { return ballPosition.Y; } set { ballPosition.Y = value; } } public Texture2D GetSprite { get { return ballSprite; } } public float Width { get { return (Scale.X == 1f ? (float)ballSprite.Width : ballSprite.Width * Scale.X); } } public float Height { get { return (Scale.Y == 1f ? (float)ballSprite.Height : ballSprite.Height * Scale.Y); } } public float SpeedIncreaseIncrement { get { return speedIncrement; } set { speedIncrement = value; } } public Rectangle Boundary { get { return new Rectangle((int)ballPosition.X, (int)ballPosition.Y, (int)this.Width, (int)this.Height); } } #endregion public Ball(Game game) : base(game) { contentManager = new ContentManager(game.Services); } public void Reset() { ballSpeed.X = DEFAULT_SPEED; ballSpeed.Y = DEFAULT_SPEED; ballPosition.X = Game.GraphicsDevice.Viewport.Width / 2 - ballSprite.Width / 2; ballPosition.Y = Game.GraphicsDevice.Viewport.Height / 2 - ballSprite.Height / 2; } public void SpeedUp() { if (ballSpeed.Y < 0) ballSpeed.Y -= (INCREASE_SPEED + speedIncrement); else ballSpeed.Y += (INCREASE_SPEED + speedIncrement); if (ballSpeed.X < 0) ballSpeed.X -= (INCREASE_SPEED + speedIncrement); else ballSpeed.X += (INCREASE_SPEED + speedIncrement); } public float[] ProjectBall(Vector2 axis) { if (axis == Vector2.Zero) return (new float[2] { 0, 0 }); float min, max; min = Vector2.Dot(axis, this.ballCenter) - this.Width/2; //center - radius max = min + this.Width; //center + radius return (new float[2] { min, max }); } public void ChangeHorzDirection() { ballSpeed.X *= -1; } public void ChangeVertDirection() { ballSpeed.Y *= -1; } public override void Initialize() { base.Initialize(); ballPosition.X = Game.GraphicsDevice.Viewport.Width / 2 - ballSprite.Width / 2; ballPosition.Y = Game.GraphicsDevice.Viewport.Height / 2 - ballSprite.Height / 2; } protected override void LoadContent() { spriteBatch = new SpriteBatch(GraphicsDevice); ballSprite = contentManager.Load<Texture2D>(@"Content\ball"); } public override void Update(GameTime gameTime) { if (this.Y < 1 || this.Y > GraphicsDevice.Viewport.Height - this.Height - 1) this.ChangeVertDirection(); centerOfBall = new Vector2(ballPosition.X + this.Width / 2, ballPosition.Y + this.Height / 2); base.Update(gameTime); } public override void Draw(GameTime gameTime) { spriteBatch.Begin(); spriteBatch.Draw(ballSprite, ballPosition, null, Color.White, 0f, Vector2.Zero, Scale, SpriteEffects.None, 0); spriteBatch.End(); base.Draw(gameTime); } } Main game class public class gameStart : Microsoft.Xna.Framework.Game { GraphicsDeviceManager graphics; SpriteBatch spriteBatch; public gameStart() { graphics = new GraphicsDeviceManager(this); Content.RootDirectory = "Content"; this.Window.Title = "Pong game"; } protected override void Initialize() { ball = new Ball(this); paddleLeft = new Paddle(this,true,false); paddleRight = new Paddle(this,false,true); Components.Add(ball); Components.Add(paddleLeft); Components.Add(paddleRight); this.Window.AllowUserResizing = false; this.IsMouseVisible = true; this.IsFixedTimeStep = false; this.isColliding = false; base.Initialize(); } #region MyPrivateStuff private Ball ball; private Paddle paddleLeft, paddleRight; private int[] bit = { -1, 1 }; private Random rnd = new Random(); private int updates = 0; enum nrPaddle { None, Left, Right }; private nrPaddle PongBar = nrPaddle.None; private ArrayList Axes = new ArrayList(); private Vector2 MTV; //minimum translation vector private bool isColliding; private float overlap; //smallest distance after projections private Vector2 overlapAxis; //axis of overlap #endregion protected override void LoadContent() { spriteBatch = new SpriteBatch(GraphicsDevice); paddleLeft.setPosition(new Vector2(0, this.GraphicsDevice.Viewport.Height / 2 - paddleLeft.Height / 2)); paddleRight.setPosition(new Vector2(this.GraphicsDevice.Viewport.Width - paddleRight.Width, this.GraphicsDevice.Viewport.Height / 2 - paddleRight.Height / 2)); paddleLeft.Scale = new Vector2(1f, 2f); //scale left paddle } private bool ShapesIntersect(Paddle paddle, Ball ball) { overlap = 1000000f; //large value overlapAxis = Vector2.Zero; MTV = Vector2.Zero; foreach (Vector2 ax in Axes) { float[] pad = paddle.ProjectPaddle(ax); //pad0 = min, pad1 = max float[] circle = ball.ProjectBall(ax); //circle0 = min, circle1 = max if (pad[1] <= circle[0] || circle[1] <= pad[0]) { return false; } if (pad[1] - circle[0] < circle[1] - pad[0]) { if (Math.Abs(overlap) > Math.Abs(-pad[1] + circle[0])) { overlap = -pad[1] + circle[0]; overlapAxis = ax; } } else { if (Math.Abs(overlap) > Math.Abs(circle[1] - pad[0])) { overlap = circle[1] - pad[0]; overlapAxis = ax; } } } if (overlapAxis != Vector2.Zero) { MTV = overlapAxis * overlap; } return true; } protected override void Update(GameTime gameTime) { updates += 1; float ftime = 5 * (float)gameTime.ElapsedGameTime.TotalSeconds; if (updates == 1) { isColliding = false; int Xrnd = bit[Convert.ToInt32(rnd.Next(0, 2))]; int Yrnd = bit[Convert.ToInt32(rnd.Next(0, 2))]; ball.SpeedX = Xrnd * ball.SpeedX; ball.SpeedY = Yrnd * ball.SpeedY; ball.X += ftime * ball.SpeedX; ball.Y += ftime * ball.SpeedY; } else { updates = 100; ball.X += ftime * ball.SpeedX; ball.Y += ftime * ball.SpeedY; } //autorun :) paddleLeft.Y = ball.Y; //collision detection PongBar = nrPaddle.None; if (ball.Boundary.Intersects(paddleLeft.Boundary)) { PongBar = nrPaddle.Left; if (!isColliding) { Axes.Clear(); Axes.AddRange(paddleLeft.Normal2EdgesVector); //axis from nearest vertex to ball's center Axes.Add(FORMULAS.NormAxisFromCircle2ClosestVertex(paddleLeft.VertexVector, ball.ballCenter)); } } else if (ball.Boundary.Intersects(paddleRight.Boundary)) { PongBar = nrPaddle.Right; if (!isColliding) { Axes.Clear(); Axes.AddRange(paddleRight.Normal2EdgesVector); //axis from nearest vertex to ball's center Axes.Add(FORMULAS.NormAxisFromCircle2ClosestVertex(paddleRight.VertexVector, ball.ballCenter)); } } if (PongBar != nrPaddle.None && !isColliding) switch (PongBar) { case nrPaddle.Left: if (ShapesIntersect(paddleLeft, ball)) { isColliding = true; if (MTV != Vector2.Zero) ball.X += MTV.X; ball.Y += MTV.Y; ball.ChangeHorzDirection(); } break; case nrPaddle.Right: if (ShapesIntersect(paddleRight, ball)) { isColliding = true; if (MTV != Vector2.Zero) ball.X += MTV.X; ball.Y += MTV.Y; ball.ChangeHorzDirection(); } break; default: break; } if (!ShapesIntersect(paddleRight, ball) && !ShapesIntersect(paddleLeft, ball)) isColliding = false; ball.X += ftime * ball.SpeedX; ball.Y += ftime * ball.SpeedY; //check ball movement if (ball.X > paddleRight.X + paddleRight.Width + 2) { //IncreaseScore(Left); ball.Reset(); updates = 0; return; } else if (ball.X < paddleLeft.X - 2) { //IncreaseScore(Right); ball.Reset(); updates = 0; return; } base.Update(gameTime); } protected override void Draw(GameTime gameTime) { GraphicsDevice.Clear(Color.Aquamarine); spriteBatch.Begin(SpriteSortMode.BackToFront, BlendState.AlphaBlend); spriteBatch.End(); base.Draw(gameTime); } } And one method i've used: public static Vector2 NormAxisFromCircle2ClosestVertex(Vector2[] vertices, Vector2 circle) { Vector2 temp = Vector2.Zero; if (vertices.Length > 0) { float dist = (circle.X - vertices[0].X) * (circle.X - vertices[0].X) + (circle.Y - vertices[0].Y) * (circle.Y - vertices[0].Y); for (int i = 1; i < vertices.Length;i++) { if (dist > (circle.X - vertices[i].X) * (circle.X - vertices[i].X) + (circle.Y - vertices[i].Y) * (circle.Y - vertices[i].Y)) { temp = vertices[i]; //memorize the closest vertex dist = (circle.X - vertices[i].X) * (circle.X - vertices[i].X) + (circle.Y - vertices[i].Y) * (circle.Y - vertices[i].Y); } } temp = circle - temp; temp.Normalize(); } return temp; } Thanks in advance for any tips on the 4 issues. EDIT1: Something isn't working properly. The collision axis doesn't come out right and the interpolation also seems to have no effect. I've changed the code a bit: private bool ShapesIntersect(Paddle paddle, Ball ball) { overlap = 1000000f; //large value overlapAxis = Vector2.Zero; MTV = Vector2.Zero; foreach (Vector2 ax in Axes) { float[] pad = paddle.ProjectPaddle(ax); //pad0 = min, pad1 = max float[] circle = ball.ProjectBall(ax); //circle0 = min, circle1 = max if (pad[1] < circle[0] || circle[1] < pad[0]) { return false; } if (Math.Abs(pad[1] - circle[0]) < Math.Abs(circle[1] - pad[0])) { if (Math.Abs(overlap) > Math.Abs(-pad[1] + circle[0])) { overlap = -pad[1] + circle[0]; overlapAxis = ax * (-1); } //to get the proper axis } else { if (Math.Abs(overlap) > Math.Abs(circle[1] - pad[0])) { overlap = circle[1] - pad[0]; overlapAxis = ax; } } } if (overlapAxis != Vector2.Zero) { MTV = overlapAxis * Math.Abs(overlap); } return true; } And part of the Update method: if (ShapesIntersect(paddleRight, ball)) { isColliding = true; if (MTV != Vector2.Zero) { ball.X += MTV.X; ball.Y += MTV.Y; } //test if (overlapAxis.X == 0) //collision with horizontal edge { } else if (overlapAxis.Y == 0) //collision with vertical edge { float factor = Math.Abs(ball.ballCenter.Y - paddleRight.Y) / paddleRight.Height; if (factor > 1) factor = 1f; if (overlapAxis.X < 0) //left edge? ball.Speed = ball.DEFAULTSPEED * Vector2.Normalize(Vector2.Reflect(ball.Speed, (Vector2.Lerp(new Vector2(-1, -3), new Vector2(-1, 3), factor)))); else //right edge? ball.Speed = ball.DEFAULTSPEED * Vector2.Normalize(Vector2.Reflect(ball.Speed, (Vector2.Lerp(new Vector2(1, -3), new Vector2(1, 3), factor)))); } else //vertex collision??? { ball.Speed = -ball.Speed; } } What seems to happen is that "overlapAxis" doesn't always return the right one. So instead of (-1,0) i get the (1,0) (this happened even before i multiplied with -1 there). Sometimes there isn't even a collision registered even though the ball passes through the paddle... The interpolation also seems to have no effect as the angles barely change (or the overlapAxis is almost never (-1,0) or (1,0) but something like (0.9783473, 0.02743843)... ). What am i missing here? :(

    Read the article

  • SQL - fetch the row which has the Max value for a column

    - by Umang
    Table: UserId, Value, Date. I want to get the UserId, Value for the max(Date) for each UserId. That is, the Value for each UserId that has the latest date. Is there a way to do this simply in SQL? (Preferably Oracle) Thank in advance! [Update:] Apologies for any ambiguity: I need to get ALL the UserIds. But for each UserId, only that row where that user has the latest date.

    Read the article

  • Row level user permissions, help with design

    - by bambam
    Hi, Say I am creating a forums application, I understand how to design a forum level permission system with Groups. i.e. you create a forum to group mapping, and assign users to a group to give them access to a particular forum. How can I refine the permissions to allow for row level permissions (or in forum terms, post level).

    Read the article

  • Unable to get my webpage height in javascript?

    - by Rajesh Vaddepally
    I have a different problem , when user clicks on page and dragging to some location, then with that co-ordinates i should draw a rectangle div... But it working fine, when user doesn't scroll the window.. If he scroll the window. then he trying to creating a rectangle means ,then it is coming to upper positions.. how can i solve this problem.. i don't have much knowledge on javascript.. If i could not explain you in detail. feel free to ask me.. thanks Rajesh

    Read the article

  • Change column height as other column gets longer

    - by Infiniti Fizz
    Hi, I have tried a few things to solve this problem but I can't seem to get it working. The problem is that I have 2 columns as the main part of my website, right and left. On some pages, there is a lot of text in the left column, therefore it is very long, the problem is that the right column doesn't elongate with the left column. Both columns have the same background colour and a footer s displayed across the width of both columns after the columns finish. My first thought was to put both columns inside a div which would have the same background colour as them and therefore if the left column became 1500px long in total and the right column stayed at around 600px (due to the elements inside it) then this wouldn't show as the new, outer div would elongate along with the left column. But for some reason this didn't work. Could it be because the columns are floated? Does anyone have any other ideas? Here is the website (Obviously not finished yet): Beansheaf Hotel I have chosen a page where there is a lot of text in the left column so the problem is apparent. Thanks in advance, InfinitiFizz

    Read the article

  • Add Dynamic ListView Row

    - by soclose
    Hi, I could intercept ContentObserver changes at any time. In these time, I'd like to add a dynamic listview row with or without opening my application but i don't know how to implement it. Please share me some hints. Thank you.

    Read the article

  • loading multiple line query in one row

    - by bharath
    Hi, How to load a multiple line query in one row using mysql.The data is stored in a text file. For example: "GGAGTTGTGGGAGTGGAGGAGGAAGAGGCGGTGGGGAGTACGGGGGCTGGTCCCAGAAGATGGCGGAGGC GGGGGATTTCTGGTAGGTCCTACTTTAGGACAAGATGTGGTGGTACTGTTGAAGCGTCAGTCTTTGATTC" Thanks in advance.

    Read the article

  • format dojo DataGrid header row

    - by Alan Seiden
    I want to assign a background color to my programmatically created Dojo DataGrid's header row. I've tried to override the defaults by adding .dojoxGridHeader or .dojoxGrid-Header to my style sheet, but these have no effect. Is there another way, such as with a Dojo event or property? If my style sheet is the only way to go, am I using the wrong class? Thanks! Alan

    Read the article

< Previous Page | 44 45 46 47 48 49 50 51 52 53 54 55  | Next Page >