Search Results

Search found 407 results on 17 pages for 'sequences'.

Page 5/17 | < Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >

  • Python: For loop problem

    - by Yasmin
    I have a simple for loop problem, when i run the code below it prints out series of 'blue green' sequences then a series of 'green' sequences. I want the output to be; if row[4] is equal to 1 to print blue else print green. for row in rows: for i in `row[4]`: if i ==`1`: print 'blue ' else: print 'green ' Any help would be grateful thanks Yas

    Read the article

  • Cleaning up a SQL SP with Regex

    - by Douglas Osborne
    1) If I am running a find and replace in SQL 2005 - what would be the regular expression to find tab and space sequences ( or space and tab sequences ) and replace them with just tab? 2) If I have a line which begins with a space - is there a regular expression to convert that leading space to a tab? 3) What would be the regular expression to remove all of the spaces before a CR/LF in a SQL statement? TIA for the help - I know this will be trivial to most of you, Doug

    Read the article

  • How can I manually interpolate string escapes in a Perl string?

    - by Ryan Thompson
    In perl suppose I have a string like 'hello\tworld\n', and what I want is: 'hello world ' That is, "hello", then a literal tab character, then "world", then a literal newline. Or equivalently, "hello\tworld\n" (note the double quotes). In other words, is there a function for taking a string with escape sequences and returning an equivalent string with all the escape sequences interpolated?

    Read the article

  • Can an algorithmic process ever give true random numbers ?

    - by Arkapravo
    I have worked with random functions in python,ruby, MATLAB, Bash and Java. Nearly every programming language has a function to generate Random numbers. However, these apparently random sequences are termed as pseudo-random number sequences as the generation follows a deterministic approach, and the sequence seems to repeat (usually with a very large period). My question, can an algorithmic/programming process ever yield true random numbers ? The questions probably is more of theoretical computer science than just programming !

    Read the article

  • Is it possible to store only a checksum of a large file in git?

    - by Andrew Grimm
    I'm a bioinformatician currently extracting normal-sized sequences from genomic files. Some genomic files are large enough that I don't want to put them into the main git repository, whereas I'm putting the extracted sequences into git. Is it possible to tell git "Here's a large file - don't store the whole file, just take its checksum, and let me know if that file is missing or modified." If that's not possible, I guess I'll have to either git-ignore the large files, or, as suggested in this question, store them in a submodule.

    Read the article

  • java regex: capture multiline sequence between tokens

    - by Guillaume
    I'm struggling with regex for splitting logs files into log sequence in order to match pattern inside these sequences. log format is: timestamp fieldA fieldB fieldn log message1 timestamp fieldA fieldB fieldn log message2 log message2bis timestamp fieldA fieldB fieldn log message3 The timestamp regex is known. I want to extract every log sequence (potentialy multiline) between timestamps. And I want to keep the timestamp. I want in the same time to keep the exact count of lines. What I need is how to decorate timestamp pattern to make it split my log file in log sequence. I can not split the whole file as a String, since the file content is provided in a CharBuffer Here is sample method that will be using this log sequence matcher: private void matches(File f, CharBuffer cb) { Matcher sequenceBreak = sequencePattern.matcher(cb); // sequence matcher int lines = 1; int sequences = 0; while (sequenceBreak.find()) { sequences++; String sequence = sequenceBreak.group(); if (filter.accept(sequence)) { System.out.println(f + ":" + lines + ":" + sequence); } //count lines Matcher lineBreak = LINE_PATTERN.matcher(sequence); while (lineBreak.find()) { lines++; } if (sequenceBreak.end() == cb.limit()) { break; } } }

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Idiomatic way to build a custom structure from XML zipper in Clojure

    - by Checkers
    Say, I'm parsing an RSS feed and want to extract a subset of information from it. (def feed (-> "http://..." clojure.zip/xml-zip clojure.xml/parse)) I can get links and titles separately: (xml-> feed :channel :item :link text) (xml-> feed :channel :item :title text) However I can't figure out the way to extract them at the same time without traversing the zipper more than once, e.g. (let [feed (-> "http://..." clojure.zip/xml-zip clojure.xml/parse)] (zipmap (xml-> feed :channel :item :link text) (xml-> feed :channel :item :title text))) ...or a variation of thereof, involving mapping multiple sequences to a function that incrementally builds a map with, say, assoc. Not only I have to traverse the sequence multiple times, the sequences also have separate states, so elements must be "aligned", so to speak. That is, in a more complex case than RSS, a sub-element may be missing in particular element, making one of sequences shorter by one (there are no gaps). So the result may actually be incorrect. Is there a better way or is it, in fact, the way you do it in Clojure?

    Read the article

  • Bash color prompt and long commands

    - by Eric J.
    I'm colorizing parts of my bash prompt using ANSI escape sequences. This works great, until the command I'm currently typing in is long enough that it has to wrap. Instead of the rest of the command displaying on the next line, it wraps back to column 1 of the current line, overwriting the beginning of the prompt. I get that behavior with this prompt: export PS1="[\u][\033[0;32;40mdemo \033[0;33;40m1.5.40.b\033[0;37;40m] \w> \033[0m" but it works correctly with the same prompt, ANSI sequences remove: export PS1="[\u][demo 1.5.40.b] \w> " I'm connecting using the current version of Putty, with default Putty settings. The OS is Ubuntu 8.10.

    Read the article

  • What is the minimum delay between two consecutive RS232 frames?

    - by Lord Loh.
    I have been working on creating a UART on an FPGA. I can successfully transmit and receive single characters typed on PuTTY. However, when I set my FPGA to constantly write a large sequences of "A", sometimes I end up with a sequences of "@" or some other characters until I reset the FPGA a few times. I believe the UART on the computer looses track of the difference between the start bit and a zero. The delay between the two "A" is ~ 30us (measured with a logic analyzer) and the baud rate is 115200 8N1. Is there a minimum delay that must be maintained between two consecutive RS232 frames?

    Read the article

  • Reading and conditionally updating N rows, where N > 100,000 for DNA Sequence processing

    - by makerofthings7
    I have a proof of concept application that uses Azure tables to associate DNA sequences to "something". Table 1 is the master table. It uniquely lists every DNA sequence. The PK is a load balanced hash of the RK. The RK is the unique encoded value of the DNA sequence. Additional tables are created per subject. Each subject has a list of N DNA sequences that have one reference in the Master table, where N is 100,000. It is possible for many tables to reference the same DNA sequence, but in this case only one entry will be present in the Master table. My Azure dilemma: I need to lock the reference in the Master table as I work with the data. I need to handle timeouts, and prevent other threads from overwriting my data as one C# thread is working with the information. Other threads need to realise that this is locked, and move onto other unlocked records and do the work. Ideally I'd like to get some progress report of how my computation is going, and have the option to cancel the process (and unwind the locks). Question What is the best approach for this? I'm looking at these code snippets for inspiration: http://blogs.msdn.com/b/jimoneil/archive/2010/10/05/azure-home-part-7-asynchronous-table-storage-pagination.aspx http://stackoverflow.com/q/4535740/328397

    Read the article

  • C#/.NET Little Wonders: Skip() and Take()

    - by James Michael Hare
    Once again, in this series of posts I look at the parts of the .NET Framework that may seem trivial, but can help improve your code by making it easier to write and maintain. The index of all my past little wonders posts can be found here. I’ve covered many valuable methods from System.Linq class library before, so you already know it’s packed with extension-method goodness.  Today I’d like to cover two small families I’ve neglected to mention before: Skip() and Take().  While these methods seem so simple, they are an easy way to create sub-sequences for IEnumerable<T>, much the way GetRange() creates sub-lists for List<T>. Skip() and SkipWhile() The Skip() family of methods is used to ignore items in a sequence until either a certain number are passed, or until a certain condition becomes false.  This makes the methods great for starting a sequence at a point possibly other than the first item of the original sequence.   The Skip() family of methods contains the following methods (shown below in extension method syntax): Skip(int count) Ignores the specified number of items and returns a sequence starting at the item after the last skipped item (if any).  SkipWhile(Func<T, bool> predicate) Ignores items as long as the predicate returns true and returns a sequence starting with the first item to invalidate the predicate (if any).  SkipWhile(Func<T, int, bool> predicate) Same as above, but passes not only the item itself to the predicate, but also the index of the item.  For example: 1: var list = new[] { 3.14, 2.72, 42.0, 9.9, 13.0, 101.0 }; 2:  3: // sequence contains { 2.72, 42.0, 9.9, 13.0, 101.0 } 4: var afterSecond = list.Skip(1); 5: Console.WriteLine(string.Join(", ", afterSecond)); 6:  7: // sequence contains { 42.0, 9.9, 13.0, 101.0 } 8: var afterFirstDoubleDigit = list.SkipWhile(v => v < 10.0); 9: Console.WriteLine(string.Join(", ", afterFirstDoubleDigit)); Note that the SkipWhile() stops skipping at the first item that returns false and returns from there to the rest of the sequence, even if further items in that sequence also would satisfy the predicate (otherwise, you’d probably be using Where() instead, of course). If you do use the form of SkipWhile() which also passes an index into the predicate, then you should keep in mind that this is the index of the item in the sequence you are calling SkipWhile() from, not the index in the original collection.  That is, consider the following: 1: var list = new[] { 1.0, 1.1, 1.2, 2.2, 2.3, 2.4 }; 2:  3: // Get all items < 10, then 4: var whatAmI = list 5: .Skip(2) 6: .SkipWhile((i, x) => i > x); For this example the result above is 2.4, and not 1.2, 2.2, 2.3, 2.4 as some might expect.  The key is knowing what the index is that’s passed to the predicate in SkipWhile().  In the code above, because Skip(2) skips 1.0 and 1.1, the sequence passed to SkipWhile() begins at 1.2 and thus it considers the “index” of 1.2 to be 0 and not 2.  This same logic applies when using any of the extension methods that have an overload that allows you to pass an index into the delegate, such as SkipWhile(), TakeWhile(), Select(), Where(), etc.  It should also be noted, that it’s fine to Skip() more items than exist in the sequence (an empty sequence is the result), or even to Skip(0) which results in the full sequence.  So why would it ever be useful to return Skip(0) deliberately?  One reason might be to return a List<T> as an immutable sequence.  Consider this class: 1: public class MyClass 2: { 3: private List<int> _myList = new List<int>(); 4:  5: // works on surface, but one can cast back to List<int> and mutate the original... 6: public IEnumerable<int> OneWay 7: { 8: get { return _myList; } 9: } 10:  11: // works, but still has Add() etc which throw at runtime if accidentally called 12: public ReadOnlyCollection<int> AnotherWay 13: { 14: get { return new ReadOnlyCollection<int>(_myList); } 15: } 16:  17: // immutable, can't be cast back to List<int>, doesn't have methods that throw at runtime 18: public IEnumerable<int> YetAnotherWay 19: { 20: get { return _myList.Skip(0); } 21: } 22: } This code snippet shows three (among many) ways to return an internal sequence in varying levels of immutability.  Obviously if you just try to return as IEnumerable<T> without doing anything more, there’s always the danger the caller could cast back to List<T> and mutate your internal structure.  You could also return a ReadOnlyCollection<T>, but this still has the mutating methods, they just throw at runtime when called instead of giving compiler errors.  Finally, you can return the internal list as a sequence using Skip(0) which skips no items and just runs an iterator through the list.  The result is an iterator, which cannot be cast back to List<T>.  Of course, there’s many ways to do this (including just cloning the list, etc.) but the point is it illustrates a potential use of using an explicit Skip(0). Take() and TakeWhile() The Take() and TakeWhile() methods can be though of as somewhat of the inverse of Skip() and SkipWhile().  That is, while Skip() ignores the first X items and returns the rest, Take() returns a sequence of the first X items and ignores the rest.  Since they are somewhat of an inverse of each other, it makes sense that their calling signatures are identical (beyond the method name obviously): Take(int count) Returns a sequence containing up to the specified number of items. Anything after the count is ignored. TakeWhile(Func<T, bool> predicate) Returns a sequence containing items as long as the predicate returns true.  Anything from the point the predicate returns false and beyond is ignored. TakeWhile(Func<T, int, bool> predicate) Same as above, but passes not only the item itself to the predicate, but also the index of the item. So, for example, we could do the following: 1: var list = new[] { 1.0, 1.1, 1.2, 2.2, 2.3, 2.4 }; 2:  3: // sequence contains 1.0 and 1.1 4: var firstTwo = list.Take(2); 5:  6: // sequence contains 1.0, 1.1, 1.2 7: var underTwo = list.TakeWhile(i => i < 2.0); The same considerations for SkipWhile() with index apply to TakeWhile() with index, of course.  Using Skip() and Take() for sub-sequences A few weeks back, I talked about The List<T> Range Methods and showed how they could be used to get a sub-list of a List<T>.  This works well if you’re dealing with List<T>, or don’t mind converting to List<T>.  But if you have a simple IEnumerable<T> sequence and want to get a sub-sequence, you can also use Skip() and Take() to much the same effect: 1: var list = new List<double> { 1.0, 1.1, 1.2, 2.2, 2.3, 2.4 }; 2:  3: // results in List<T> containing { 1.2, 2.2, 2.3 } 4: var subList = list.GetRange(2, 3); 5:  6: // results in sequence containing { 1.2, 2.2, 2.3 } 7: var subSequence = list.Skip(2).Take(3); I say “much the same effect” because there are some differences.  First of all GetRange() will throw if the starting index or the count are greater than the number of items in the list, but Skip() and Take() do not.  Also GetRange() is a method off of List<T>, thus it can use direct indexing to get to the items much more efficiently, whereas Skip() and Take() operate on sequences and may actually have to walk through the items they skip to create the resulting sequence.  So each has their pros and cons.  My general rule of thumb is if I’m already working with a List<T> I’ll use GetRange(), but for any plain IEnumerable<T> sequence I’ll tend to prefer Skip() and Take() instead. Summary The Skip() and Take() families of LINQ extension methods are handy for producing sub-sequences from any IEnumerable<T> sequence.  Skip() will ignore the specified number of items and return the rest of the sequence, whereas Take() will return the specified number of items and ignore the rest of the sequence.  Similarly, the SkipWhile() and TakeWhile() methods can be used to skip or take items, respectively, until a given predicate returns false.    Technorati Tags: C#, CSharp, .NET, LINQ, IEnumerable<T>, Skip, Take, SkipWhile, TakeWhile

    Read the article

  • Perfomance of 8 bit operations on 64 bit architechture

    - by wobbily_col
    I am usually a Python / Database programmer, and I am considering using C for a problem. I have a set of sequences, 8 characters long with 4 possible characters. My problem involves combining sets of these sequences and filtering which sets match a criteria. The combinations of 5 run into billions of rows and takes around an hour to run. So I can represent each sequence as 2 bytes. If I am working on a 64 bit architechture will I gain any advantage by keeping these data structures as 2 bytes when I generate the combinations, or will I be as well storing them as 8 bytes / double ? (64 bit = 8 x 8) If I am on a 64 bit architecture, all registers will be 64 bit, so in terms of operations that shouldn´t be any faster (please correct me if I am wrong). Will I gain anything from the smaller storage requirements - can I fit more combinations in memory, or will they all take up 64 bits anyway? And finally, am I likley to gain anything coding in C. I have a first version, which stores the sequence as a small int in a MySQL database. It then self joins the tabe to itself a number of times in order to generate all the possible combinations. The performance is acceptable, depending on how many combinations are generated. I assume the database must involve some overhead.

    Read the article

  • Configuring an Engenius 3500

    - by dsiddens
    The title speaks to only half of the issue: the other half are the settings in Ubuntu and the sequences therein. The computer in this issue does receive internet with the external antenna jack at the back being fed with a simple magnetic base antenna designed for putting on the roof of an automobile. However, that signal is weak and the Engenius with an external antenna (Rootenna ~15db gain) and ehternet wire will supply a stronger, faster signal. I've set the Engenius to the desired source and entered the correct WEP password. The lights on the Engenius indicate that it's connected to the access point. At the Ubuntu side of this I've worked to no avail changing settings with "Edit Connections" to the point I'm Ask(ing)Ubuntu for help. I have and have RTFM for Engenius 3500 There is an embarrassing side note to this issue: At one time I had the Engenius working! It seems that I can't recall the settings and sequences I used way back when. And I may as well confess to not knowing the Command Line. I'm a GUI guy. Thank you for your time, Doug

    Read the article

  • LLBLGen Pro feature highlights: automatic element name construction

    - by FransBouma
    (This post is part of a series of posts about features of the LLBLGen Pro system) One of the things one might take for granted but which has a huge impact on the time spent in an entity modeling environment is the way the system creates names for elements out of the information provided, in short: automatic element name construction. Element names are created in both directions of modeling: database first and model first and the more names the system can create for you without you having to rename them, the better. LLBLGen Pro has a rich, fine grained system for creating element names out of the meta-data available, which I'll describe more in detail below. First the model element related element naming features are highlighted, in the section Automatic model element naming features and after that I'll go more into detail about the relational model element naming features LLBLGen Pro has to offer in the section Automatic relational model element naming features. Automatic model element naming features When working database first, the element names in the model, e.g. entity names, entity field names and so on, are in general determined from the relational model element (e.g. table, table field) they're mapped on, as the model elements are reverse engineered from these relational model elements. It doesn't take rocket science to automatically name an entity Customer if the entity was created after reverse engineering a table named Customer. It gets a little trickier when the entity which was created by reverse engineering a table called TBL_ORDER_LINES has to be named 'OrderLine' automatically. Automatic model element naming also takes into effect with model first development, where some settings are used to provide you with a default name, e.g. in the case of navigator name creation when you create a new relationship. The features below are available to you in the Project Settings. Open Project Settings on a loaded project and navigate to Conventions -> Element Name Construction. Strippers! The above example 'TBL_ORDER_LINES' shows that some parts of the table name might not be needed for name creation, in this case the 'TBL_' prefix. Some 'brilliant' DBAs even add suffixes to table names, fragments you might not want to appear in the entity names. LLBLGen Pro offers you to define both prefix and suffix fragments to strip off of table, view, stored procedure, parameter, table field and view field names. In the example above, the fragment 'TBL_' is a good candidate for such a strip pattern. You can specify more than one pattern for e.g. the table prefix strip pattern, so even a really messy schema can still be used to produce clean names. Underscores Be Gone Another thing you might get rid of are underscores. After all, most naming schemes for entities and their classes use PasCal casing rules and don't allow for underscores to appear. LLBLGen Pro can automatically strip out underscores for you. It's an optional feature, so if you like the underscores, you're not forced to see them go: LLBLGen Pro will leave them alone when ordered to to so. PasCal everywhere... or not, your call LLBLGen Pro can automatically PasCal case names on word breaks. It determines word breaks in a couple of ways: a space marks a word break, an underscore marks a word break and a case difference marks a word break. It will remove spaces in all cases, and based on the underscore removal setting, keep or remove the underscores, and upper-case the first character of a word break fragment, and lower case the rest. Say, we keep the defaults, which is remove underscores and PasCal case always and strip the TBL_ fragment, we get with our example TBL_ORDER_LINES, after stripping TBL_ from the table name two word fragments: ORDER and LINES. The underscores are removed, the first character of each fragment is upper-cased, the rest lower-cased, so this results in OrderLines. Almost there! Pluralization and Singularization In general entity names are singular, like Customer or OrderLine so LLBLGen Pro offers a way to singularize the names. This will convert OrderLines, the result we got after the PasCal casing functionality, into OrderLine, exactly what we're after. Show me the patterns! There are other situations in which you want more flexibility. Say, you have an entity Customer and an entity Order and there's a foreign key constraint defined from the target of Order and the target of Customer. This foreign key constraint results in a 1:n relationship between the entities Customer and Order. A relationship has navigators mapped onto the relationship in both entities the relationship is between. For this particular relationship we'd like to have Customer as navigator in Order and Orders as navigator in Customer, so the relationship becomes Customer.Orders 1:n Order.Customer. To control the naming of these navigators for the various relationship types, LLBLGen Pro defines a set of patterns which allow you, using macros, to define how the auto-created navigator names will look like. For example, if you rather have Customer.OrderCollection, you can do so, by changing the pattern from {$EndEntityName$P} to {$EndEntityName}Collection. The $P directive makes sure the name is pluralized, which is not what you want if you're going for <EntityName>Collection, hence it's removed. When working model first, it's a given you'll create foreign key fields along the way when you define relationships. For example, you've defined two entities: Customer and Order, and they have their fields setup properly. Now you want to define a relationship between them. This will automatically create a foreign key field in the Order entity, which reflects the value of the PK field in Customer. (No worries if you hate the foreign key fields in your classes, on NHibernate and EF these can be hidden in the generated code if you want to). A specific pattern is available for you to direct LLBLGen Pro how to name this foreign key field. For example, if all your entities have Id as PK field, you might want to have a different name than Id as foreign key field. In our Customer - Order example, you might want to have CustomerId instead as foreign key name in Order. The pattern for foreign key fields gives you that freedom. Abbreviations... make sense of OrdNr and friends I already described word breaks in the PasCal casing paragraph, how they're used for the PasCal casing in the constructed name. Word breaks are used for another neat feature LLBLGen Pro has to offer: abbreviation support. Burt, your friendly DBA in the dungeons below the office has a hate-hate relationship with his keyboard: he can't stand it: typing is something he avoids like the plague. This has resulted in tables and fields which have names which are very short, but also very unreadable. Example: our TBL_ORDER_LINES example has a lovely field called ORD_NR. What you would like to see in your fancy new OrderLine entity mapped onto this table is a field called OrderNumber, not a field called OrdNr. What you also like is to not have to rename that field manually. There are better things to do with your time, after all. LLBLGen Pro has you covered. All it takes is to define some abbreviation - full word pairs and during reverse engineering model elements from tables/views, LLBLGen Pro will take care of the rest. For the ORD_NR field, you need two values: ORD as abbreviation and Order as full word, and NR as abbreviation and Number as full word. LLBLGen Pro will now convert every word fragment found with the word breaks which matches an abbreviation to the given full word. They're case sensitive and can be found in the Project Settings: Navigate to Conventions -> Element Name Construction -> Abbreviations. Automatic relational model element naming features Not everyone works database first: it may very well be the case you start from scratch, or have to add additional tables to an existing database. For these situations, it's key you have the flexibility that you can control the created table names and table fields without any work: let the designer create these names based on the entity model you defined and a set of rules. LLBLGen Pro offers several features in this area, which are described in more detail below. These features are found in Project Settings: navigate to Conventions -> Model First Development. Underscores, welcome back! Not every database is case insensitive, and not every organization requires PasCal cased table/field names, some demand all lower or all uppercase names with underscores at word breaks. Say you create an entity model with an entity called OrderLine. You work with Oracle and your organization requires underscores at word breaks: a table created from OrderLine should be called ORDER_LINE. LLBLGen Pro allows you to do that: with a simple checkbox you can order LLBLGen Pro to insert an underscore at each word break for the type of database you're working with: case sensitive or case insensitive. Checking the checkbox Insert underscore at word break case insensitive dbs will let LLBLGen Pro create a table from the entity called Order_Line. Half-way there, as there are still lower case characters there and you need all caps. No worries, see below Casing directives so everyone can sleep well at night For case sensitive databases and case insensitive databases there is one setting for each of them which controls the casing of the name created from a model element (e.g. a table created from an entity definition using the auto-mapping feature). The settings can have the following values: AsProjectElement, AllUpperCase or AllLowerCase. AsProjectElement is the default, and it keeps the casing as-is. In our example, we need to get all upper case characters, so we select AllUpperCase for the setting for case sensitive databases. This will produce the name ORDER_LINE. Sequence naming after a pattern Some databases support sequences, and using model-first development it's key to have sequences, when needed, to be created automatically and if possible using a name which shows where they're used. Say you have an entity Order and you want to have the PK values be created by the database using a sequence. The database you're using supports sequences (e.g. Oracle) and as you want all numeric PK fields to be sequenced, you have enabled this by the setting Auto assign sequences to integer pks. When you're using LLBLGen Pro's auto-map feature, to create new tables and constraints from the model, it will create a new table, ORDER, based on your settings I previously discussed above, with a PK field ID and it also creates a sequence, SEQ_ORDER, which is auto-assigns to the ID field mapping. The name of the sequence is created by using a pattern, defined in the Model First Development setting Sequence pattern, which uses plain text and macros like with the other patterns previously discussed. Grouping and schemas When you start from scratch, and you're working model first, the tables created by LLBLGen Pro will be in a catalog and / or schema created by LLBLGen Pro as well. If you use LLBLGen Pro's grouping feature, which allows you to group entities and other model elements into groups in the project (described in a future blog post), you might want to have that group name reflected in the schema name the targets of the model elements are in. Say you have a model with a group CRM and a group HRM, both with entities unique for these groups, e.g. Employee in HRM, Customer in CRM. When auto-mapping this model to create tables, you might want to have the table created for Employee in the HRM schema but the table created for Customer in the CRM schema. LLBLGen Pro will do just that when you check the setting Set schema name after group name to true (default). This gives you total control over where what is placed in the database from your model. But I want plural table names... and TBL_ prefixes! For now we follow best practices which suggest singular table names and no prefixes/suffixes for names. Of course that won't keep everyone happy, so we're looking into making it possible to have that in a future version. Conclusion LLBLGen Pro offers a variety of options to let the modeling system do as much work for you as possible. Hopefully you enjoyed this little highlight post and that it has given you new insights in the smaller features available to you in LLBLGen Pro, ones you might not have thought off in the first place. Enjoy!

    Read the article

  • stanford pos tagger runs out of memory?

    - by goh
    my stanford tagger ran out of memory. Is it because the text has to be properly formatted? This is because i use it to tag html contents, with the tags stripped, but there may have quite a excessive amount of newlines. here is the error: BlockquoWARNING: Untokenizable: ? (char in decimal: 9829) Exception in thread "main" java.lang.OutOfMemoryError: Java heap space at edu.stanford.nlp.sequences.ExactBestSequenceFinder.bestSequenceNew(Ex actBestSequenceFinder.java:175) at edu.stanford.nlp.sequences.ExactBestSequenceFinder.bestSequence(Exact BestSequenceFinder.java:98) at edu.stanford.nlp.tagger.maxent.TestSentence.runTagInference(TestSente nce.java:277) at edu.stanford.nlp.tagger.maxent.TestSentence.testTagInference(TestSent ence.java:258) at edu.stanford.nlp.tagger.maxent.TestSentence.tagSentence(TestSentence. java:110) at edu.stanford.nlp.tagger.maxent.MaxentTagger.tagSentence(MaxentTagger. java:825) at edu.stanford.nlp.tagger.maxent.MaxentTagger.runTagger(MaxentTagger.ja va:1319) at edu.stanford.nlp.tagger.maxent.MaxentTagger.runTagger(MaxentTagger.ja va:1225) at edu.stanford.nlp.tagger.maxent.MaxentTagger.runTagger(MaxentTagger.ja va:1183) at edu.stanford.nlp.tagger.maxent.MaxentTagger.main(MaxentTagger.java:13 58)

    Read the article

  • How to find the longest contiguous subsequence whose reverse is also a subsequence

    - by iecut
    Suppose I have a sequence x1,x2,x3.....xn, and I want to find the longest contiguous subsequence xi,xi+1,xi+2......xi+k, whose reverse is also a subsequence of the given sequence. And if there are multiple such subsequences, then I also have to find the first. ex:- consider the sequences: abcdefgedcg here i=3 and k=2 aabcdddd here i=5, k=3 I tried looking at the original longest common subsequence problem, but that is used to compare the two sequences to find the longest common subsequence.... but here is only one sequence from which we have to find the subsequences. Please let me know what is the best way to approach this problem, to find the optimal solution.

    Read the article

  • How to find the longest continuous subsequence whose reverse is also a subsequence

    - by iecut
    Suppose I have a sequence x1,x2,x3.....xn, and I want to find the longest continuous subsequence xi,xi+1,xi+2......xi+k, whose reverse is also a subsequence of the given sequence. And if there are multiple such subsequences, then I also have to find the first. ex:- consider the sequences: abcdefgedcg here i=3 and k=2 aabcdddd here i=5, k=3 I tried looking at the original longest common subsequence problem, but that is used to compare the two sequences to find the longest common subsequence.... but here is only one sequence from which we have to find the subsequences. Please let me know what is the best way to approach this problem, to find the optimal solution.

    Read the article

  • How can I turn a string of text into a BigInteger representation for use in an El Gamal cryptosystem

    - by angstrom91
    I'm playing with the El Gamal cryptosystem, and my goal is to be able to encipher and decipher long sequences of text. I have come up with a method that works for short sequences, but does not work for long sequences, and I cannot figure out why. El Gamal requires the plaintext to be an integer. I have turned my string into a byte[] using the .getBytes() method for Strings, and then created a BigInteger out of the byte[]. After encryption/decryption, I turn the BigInteger into a byte[] using the .toByteArray() method for BigIntegers, and then create a new String object from the byte[]. This works perfectly when i call ElGamalEncipher with strings up to 129 characters. With 130 or more characters, the output produced is garbled. Can someone suggest how to solve this issue? Is this an issue with my method of turning the string into a BigInteger? If so, is there a better way to turn my string of text into a BigInteger and back? Below is my encipher/decipher code. public static BigInteger[] ElGamalEncipher(String plaintext, BigInteger p, BigInteger g, BigInteger r) { // returns a BigInteger[] cipherText // cipherText[0] is c // cipherText[1] is d BigInteger[] cipherText = new BigInteger[2]; BigInteger pText = new BigInteger(plaintext.getBytes()); // 1: select a random integer k such that 1 <= k <= p-2 BigInteger k = new BigInteger(p.bitLength() - 2, sr); // 2: Compute c = g^k(mod p) BigInteger c = g.modPow(k, p); // 3: Compute d= P*r^k = P(g^a)^k(mod p) BigInteger d = pText.multiply(r.modPow(k, p)).mod(p); // C =(c,d) is the ciphertext cipherText[0] = c; cipherText[1] = d; return cipherText; } public static String ElGamalDecipher(BigInteger c, BigInteger d, BigInteger a, BigInteger p) { //returns the plaintext enciphered as (c,d) // 1: use the private key a to compute the least non-negative residue // of an inverse of (c^a)' (mod p) BigInteger z = c.modPow(a, p).modInverse(p); BigInteger P = z.multiply(d).mod(p); byte[] plainTextArray = P.toByteArray(); String output = null; try { output = new String(plainTextArray, "UTF8"); } catch (Exception e) { } return output; }

    Read the article

  • Using LINQ to find a common prefix?

    - by Roger Lipscombe
    I've got two sequences: IEnumerable<string> x = new[] { "a", "b", "c" }; IEnumerable<string> y = new[] { "a", "b", "d", "e" }; I'd like to find the common prefix of these two sequences (i.e. "a", "b"). Is there a succinct way to do this in LINQ? Bear in mind that these aren't really IEnumerable<string>; they're IEnumerable<PathComponent>, where I have an implementation of IEqualityComparer<PathComponent>.

    Read the article

  • Using the "naked" attribute for functions in GCC

    - by Art Spasky
    GCC documentation (http://gcc.gnu.org/onlinedocs/gcc/Function-Attributes.html) states in 6.29 Declaring Attributes of Functions "naked Use this attribute on the ARM, AVR, IP2K, RX and SPU ports to indicate that the specified function does not need prologue/epilogue sequences generated by the compiler. It is up to the programmer to provide these sequences. The only statements that can be safely included in naked functions are asm statements that do not have operands. All other statements, including declarations of local variables, if statements, and so forth, should be avoided. Naked functions should be used to implement the body of an assembly function, while allowing the compiler to construct the requisite function declaration for the assembler." Can I safely call functions using C syntax from naked functions, or only by using asm?

    Read the article

  • Future proof Primary Key design in postgresql

    - by John P
    I've always used either auto_generated or Sequences in the past for my primary keys. With the current system I'm working on there is the possibility of having to eventually partition the data which has never been a requirement in the past. Knowing that I may need to partition the data in the future, is there any advantage of using UUIDs for PKs instead of the database's built-in sequences? If so, is there a design pattern that can safely generate relatively short keys (say 6 characters instead of the usual long one e6709870-5cbc-11df-a08a-0800200c9a66)? 36^6 keys per-table is more than sufficient for any table I could imagine. I will be using the keys in URLs so conciseness is important.

    Read the article

  • What is it about Fibonacci numbers?

    - by Ian Bishop
    Fibonacci numbers have become a popular introduction to recursion for Computer Science students and there's a strong argument that they persist within nature. For these reasons, many of us are familiar with them. They also exist within Computer Science elsewhere too; in surprisingly efficient data structures and algorithms based upon the sequence. There are two main examples that come to mind: Fibonacci heaps which have better amortized running time than binomial heaps. Fibonacci search which shares O(log N) running time with binary search on an ordered array. Is there some special property of these numbers that gives them an advantage over other numerical sequences? Is it a density quality? What other possible applications could they have? It seems strange to me as there are many natural number sequences that occur in other recursive problems, but I've never seen a Catalan heap.

    Read the article

  • Does the XML specification states that parser need to convert \n\r to \n always, even when \n\r appe

    - by mic.sca
    Hi, I've stumbled in a problem handling the \line-feed and \carriage-return characters in xml. I know that, according to http://www.w3.org/TR/REC-xml/#sec-line-ends, xml processors are required to replace any "\n\r" or lone "\r" sequences with "\n". The specification states that this has to be the behaviour for handling any "external parsed entity", does this apply to CDATA sections inside of an element as well? thank you, Michele I'm sure that msxml library for example converts every \n\r" or lone "\r" sequences to "\n", regardless of their being in a cdata section or not.

    Read the article

  • Getting deadlocks in MySQL

    - by at
    We're very frustratingly getting deadlocks in MySQL. It isn't because of exceeding a lock timeout as the deadlocks happen instantly when they do happen. Here's the SQL code that is executing on 2 separate threads (with 2 separate connections from the connection pool) that produces a deadlock: UPDATE Sequences SET Counter = LAST_INSERT_ID(Counter + 1) WHERE Sequence IS NULL Sequences table has 2 columns: Sequence and Counter The LAST_INSERT_ID allows us to retrieve this updated counter value as per MySQL's recommendation. That works perfect for us, but we get these deadlocks! Why are we getting them and how can we avoid them?? Thanks so much for any help with this.

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10 11 12  | Next Page >