Search Results

Search found 230 results on 10 pages for 'vincent o'.

Page 5/10 | < Previous Page | 1 2 3 4 5 6 7 8 9 10  | Next Page >

  • Using Zend_HTTP_Client instead of CURL

    - by Vincent
    All, I want to use Zend_HTTP_CLient instead of CURL as there are issues with using curl on Solaris. I have the following curl code.. How will this code be written if I want to use Zend_HTTP_Client? $ch = curl_init(); $devnull = fopen('/tmp/cookie.txt', 'w'); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,800); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); $retVal = curl_exec($ch); print_r(curl_error($ch)); curl_close($ch); if ($devnull) { fclose($devnull); } Thanks

    Read the article

  • Android: Dialog themed activity not visible

    - by Vincent
    I have an activity which, when started, needs to check if the user is authenticated. If not, I need to display an interface to authenticate. I do this with another activity, which has a dialog theme, and I start it in onResume() with flags NO_HISTORY and EXCLUDE_FROM_RECENTS. Everything works fine when starting the application for the first time. But I have a feature that resets login after some time, if the user is not in an activity. When I test this, I start the applicatio, enter the password, then move back to home. Then when I enter the application again, the background darkens as if the dialog would show, but it doesn't. At this point, if I press the back button, the darkening from the background activity disappears for a second, then the dialog finally appears. I used logcat to investigate the case, and the activity lifecycle functions get called properly: //For the first start: onCreate background activity onStart background activity onResume background activity onPause background activity onCreate dialog onStart dialog onResume dialog //Enter password onPause dialog onResume background activity onStop dialog onDestroy dialog //navigating to homescreen onPause background activity onStop background activity //starting again onRestart background activity onStart background activity onResume background activity onPause background activity onCreate dialog onStart dialog onResume dialog //no dialog shown, only darkened background activity recieving no input //pressing back button onPause dialog onResume background activity onPause background activity onCreate NEW dialog onStart NEW dialog onResume NEW dialog onStop OLD dialog onDestroy OLD dialog //now the dialog is properly shown //entering password onPause NEW dialog onResume background activity onStop NEW dialog onDestroy NEW dialog Using the SINGLE_TOP flag makes no change. However, if I remove the dialog theme from the dialog activity, it IS shown after the restart. So far I didn't want to use a Dialog instead of an Activity, because I consider them problematic sometimes and less encapsulated and this part has to be quite secure. You may be able to convince me though.. Thank you in advance!

    Read the article

  • PHP Browser Detection and Redirection

    - by Vincent
    All, My application supports IE7+, MOZILLA and other modern browsers. Anybody know of a very good browser detection and redirection PHP class? I came across this, but I am not sure if anybody used this: http://chrisschuld.com/projects/browser-php-detecting-a-users-browser-from-php/#typicalusage Thanks

    Read the article

  • UVA #10410 Tree Reconstruction

    - by Vincent
    I have worked on UVA 10410 Tree Reconstruction several days. But I can't get the correct answer unitl now. I have used an algorithm similar to the one which we always use to recovery a binary tree through the preorder traversal and the inorder traversal. But it can't work. Can anyone help me? Thanks in advance.

    Read the article

  • Zend Server with xampp MySQL

    - by Vincent
    I am running Zend Server,Zend Studio (Trial versions) on Ubuntu 9.10. I am also using xampp to do most of my development. I plan to use Zend Server only to do URL profiling to know function level performance of my code. Is it possible to configure Zend Server to use XAMPP's MySQL database instead of installing a new mysql instance for Zend Server? Thanks

    Read the article

  • Zend DB MYSQL Wrapper

    - by Vincent
    All, I have a PHP application written in Zend Framework with MVC style. I plan to use Zend_DB to connect to the MySQL database and process queries. I am looking for a wrapper class which makes it easy to use Zend_DB class. This wrapper class will have a constructor that connects to the Mysql db using Zend_DB. It will also have a method to return a singleton instance for each and every db connection made. Something like: $pptDB = PPTDB::getInstance(); $pptDB->setFetchMode(PPTDB::FETCH_OBJ); $result = $pptDB->fetchRow('SELECT * FROM bugs WHERE bug_id = 2'); echo $result->bug_description; Where class PPTDB extends Zend_DB Is this something feasible to have? If not, how ls would you use Zend_DB in a major application? Thanks,

    Read the article

  • CURL - HTTPS Wierd error

    - by Vincent
    All, I am having trouble requesting info from HTTPS site using CURL and PHP. I am using Solaris 10. It so happens that sometimes it works and sometimes it doesn't. I am not sure what is the cause. If it doesn't work, this is the entry recorded in the verbose log: * About to connect() to 10.10.101.12 port 443 (#0) * Trying 10.10.101.12... * connected * Connected to 10.10.101.12 (10.10.101.12) port 443 (#0) * error setting certificate verify locations, continuing anyway: * CAfile: /etc/opt/webstack/curl/curlCA CApath: none * error:80089077:lib(128):func(137):reason(119) * Closing connection #0 If it works, this is the entry recorded in the verbose log: * About to connect() to 10.10.101.12 port 443 (#0) * Trying 10.10.101.12... * connected * Connected to 10.10.101.12 (10.10.101.12) port 443 (#0) * error setting certificate verify locations, continuing anyway: * CAfile: /etc/opt/webstack/curl/curlCA CApath: none * SSL connection using DHE-RSA-AES256-SHA * Server certificate: * subject: C=CA, ST=British Columnbia, L=Vancouver, O=google, OU=FDN, CN=g.googlenet.com, [email protected] * start date: 2007-07-24 23:06:32 GMT * expire date: 2027-09-07 23:06:32 GMT * issuer: C=US, ST=California, L=Sunnyvale, O=Google, OU=Certificate Authority, CN=support, [email protected] * SSL certificate verify result: unable to get local issuer certificate (20), continuing anyway. > POST /gportal/gpmgr HTTP/1.1^M Host: 10.10.101.12^M Accept: */*^M Accept-Encoding: gzip,deflate^M Content-Length: 1623^M Content-Type: application/x-www-form-urlencoded^M Expect: 100-continue^M ^M < HTTP/1.1 100 Continue^M < HTTP/1.1 200 OK^M < Date: Wed, 28 Apr 2010 21:56:15 GMT^M < Server: Apache^M < Cache-Control: no-cache^M < Pragma: no-cache^M < Vary: Accept-Encoding^M < Content-Encoding: gzip^M < Content-Length: 1453^M < Content-Type: application/json^M < ^M * Connection #0 to host 10.10.101.12 left intact * Closing connection #0 My CURL options are as under: $ch = curl_init(); $devnull = fopen('/tmp/curlcookie.txt', 'w'); $fp_err = fopen('/tmp/verbose_file.txt', 'ab+'); fwrite($fp_err, date('Y-m-d H:i:s')."\n\n"); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,120); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); curl_setopt($ch, CURLOPT_VERBOSE,1); curl_setopt($ch, CURLOPT_FAILONERROR, true); curl_setopt($ch, CURLOPT_STDERR, $fp_err); $ret = curl_exec($ch); Anybody has any idea, why it works sometimes but fails mostly? Thanks

    Read the article

  • CURL - https - solaris

    - by Vincent
    All, I am receiving the following error when I use PHP to curl to a https site. Both PHP and the https site are hosted on Solaris. This error seems to occur occassionally but frequently. error:80089077:lib(128):func(137):reason(119) This is the curl code I am using: $ch = curl_init(); $devnull = fopen('/tmp/cookie.txt', 'w'); curl_setopt($ch, CURLOPT_STDERR, $devnull); curl_setopt($ch, CURLOPT_POST, 1); curl_setopt($ch, CURLOPT_URL, $desturl); curl_setopt($ch, CURLOPT_RETURNTRANSFER, 1); curl_setopt($ch, CURLOPT_SSL_VERIFYPEER, false); curl_setopt($ch, CURLOPT_SSL_VERIFYHOST, false); curl_setopt($ch, CURLOPT_HEADER, false); curl_setopt($ch, CURLOPT_FOLLOWLOCATION, 0); curl_setopt($ch, CURLOPT_CONNECTTIMEOUT,800); curl_setopt($ch, CURLOPT_AUTOREFERER, true); curl_setopt($ch, CURLOPT_ENCODING, 'gzip,deflate'); curl_setopt($ch, CURLOPT_POSTFIELDS, $postdata); $retVal = curl_exec($ch); print_r(curl_error($ch)); curl_close($ch); if ($devnull) { fclose($devnull); } How can I fix this error? If not, is there an alternative to curl?

    Read the article

  • Solve the IE select overlap bug

    - by Vincent Robert
    When using IE, you cannot put an absolutely positioned div over a select input element. That's because the select element is considered an ActiveX object and is on top of every HTML element in the page. I already saw people hiding selects when opening a popup div, that leads to pretty bad user experience having controls disappearing. FogBugz actually had a pretty smart solution (before v6) of turning every select into text boxes when a popup was displayed. This solved the bug and tricked the user eye but the behavior was not perfect. Another solution is in FogBugz 6 where they no more use the select element and recoded it everywhere. Last solution I currently use is messing up the IE rendering engine and force it to render the absolutely positioned div as an ActiveX element too, ensuring it can live over a select element. This is achieved by placing an invisible iframe inside the div and styling it with: #MyDiv iframe { position: absolute; z-index: -1; filter: mask(); border: 0; margin: 0; padding: 0; top: 0; left: 0; width: 9999px; height: 9999px; overflow: hidden; } Anyone has a even better solution than this one ? EDIT: The purpose of this question is as much informative as it is a real question. I find the iframe trick to be a good solution but I am still looking for improvement like removing this ugly useless iframe tag that degrade accessibility.

    Read the article

  • Jquery - Loop through Checkboxes and Multiple elements

    - by Vincent
    All, I have a set of elements like this in a form: <input type="checkbox" name="chk[140]"> <input type="hidden" value="3" name="ctcount[140]"> <input type="hidden" value="Apples" name="catname[140]"> <input type="checkbox" name="chk[142]"> <input type="hidden" value="20" name="ctcount[142]"> <input type="hidden" value="Bananas" name="catname[142]"> <input type="checkbox" name="chk[144]"> <input type="hidden" value="200" name="ctcount[144]"> <input type="hidden" value="Strawberries" name="catname[144]"> <input type="checkbox" name="chk[145]"> <input type="hidden" value="0" name="ctcount[145]"> <input type="hidden" value="Carrots" name="catname[145]"> When a user clicks a button, I want the Javascript to: 1. Loop through all the checkboxes 2. For all the checked checkboxes, 2a. Get ctcount value 2b. Get catname value 2c. If ctcount value > 50, alert a message saying "Unable to add item as max limit for 'catname' has reached. 2d. Break the loop after it encountered first ctcount value that is greater than 50. I am new to JQuery..have the following code so far: var checklimit = 50; $('#frmTest input:checkbox:checked').each(function(i) { alert(this.value); }); How do I do this using JQuery? Thanks

    Read the article

  • Zend_Soap_Client - Ignore HTTPS verification

    - by Vincent
    All, I want to use Zend_Soap_Client class to load WSDL from an HTTPS url. Currently, if I call like this, it gives me an error even if the WSDL is perfectly valid: $wsdlUrl = "https://abc.xyz.com/webservices/WeatherService.php?wsdl"; $soapClient = new Zend_Soap_Client($wsdlUrl); The error I receive is: SOAP-ERROR: Parsing WSDL: Couldn't load from 'https://abc.xyz.com/webservices /WeatherService.php?wsdl' : Start tag expected, '<' not found If I browse to the WSDL url in the browser, it loads up the WSDL just fine. I think Zend_Soap_Client is trying to validate the certificate and failing. Is there a way to set the SOAP option to ignore the HTTPS verification and just load the WSDL? Thanks

    Read the article

  • How to debug packet loss ?

    - by Gene Vincent
    I wrote a C++ application (running on Linux) that serves an RTP stream of about 400 kbps. To most destinations this works fine, but some destinations expericence packet loss. The problematic destinations seem to have a slower connection in common, but it should be plenty fast enough for the stream I'm sending. Since these destinations are able to receive similar RTP streams for other applications without packet loss, my application might be at fault. I already verified a few things: - in a tcpdump, I see all RTP packets going out on the sending machine - there is a UDP send buffer in place (I tried sizes between 64KB and 300KB) - the RTP packets mostly stay below 1400 bytes to avoid fragmentation What can a sending application do to minimize the possibility of packet loss and what would be the best way to debug such a situation ?

    Read the article

  • CSS for https urls

    - by Vincent
    Hello, looking for some help with images referenced within the stylesheet. I have no problems with these from non secure locations within the site but only from https. The stylesheet loads fine and displays everything correctly except for the images. example: body { margin: 0; padding: 0; background: url(/img/background_tile.gif) top left repeat-x; text-align: center; background-color: #fff; } All my css files and other image paths inside the code use relative urls to images. How can I make sure they all work fine without hard coding my image paths with https or http? I want the code to work fine with http and https. Thanks

    Read the article

  • merge() multiple data frames (do.call ?)

    - by Vincent
    Hi everyone, here's my very simple question: merge() only takes two data frames as input. I need to merge a series of data frames from a list, using the same keys for every merge operation. Given a list named "test", I want to do something like: do.call("merge", test). I could write some kind of loop, but I'm wondering if there's a standard or built-in way to do this more efficiently. Any advice is appreciated. Thanks! Here's a subset of the dataset in dput format (note that merging on country is trivial in this case, but that there are more countries in the original data): test <- list(structure(list(country = c("United States", "United States", "United States", "United States", "United States"), NY.GNS.ICTR.GN.ZS = c(13.5054687, 14.7608697, 14.1115876, 13.3389063, 12.9048351), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GNS.ICTR.GN.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NE.TRD.GNFS.ZS = c(29.3459277, 28.352838, 26.9861939, 25.6231246, 23.6615328), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NE.TRD.GNFS.ZS", "year"), row.names = c(NA, 5L), class = "data.frame"), structure(list( country = c("United States", "United States", "United States", "United States", "United States"), NY.GDP.MKTP.CD = c(1.37416e+13, 1.31165e+13, 1.23641e+13, 1.16309e+13, 1.0908e+13), year = c(2007, 2006, 2005, 2004, 2003)), .Names = c("country", "NY.GDP.MKTP.CD", "year"), row.names = c(NA, 5L), class = "data.frame"))

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Pear SOAP and XAMPP on Ubuntu

    - by Vincent
    All, I have installed xampp for linux on ubuntu 9.10. The installation directory is /opt/lampp. The xampp website says PEAR comes with the installation.. I am relatively new to PEAR and want to know the answers for following: Is PEAR installed with xampp or need to be installed separately using synaptic package manager? I browse to /opt/lampp/bin directory and see "pear" there, but when i type it in the command line, it says "The program 'pear' is currently not installed. You can install it by typing: sudo apt-get install php-pear pear: command not found " I want to use PEAR:SOAP package in my PHP code. How to use that? Do I need to set any paths to the pear in my php.ini? Thanks

    Read the article

  • Launch Apple's Stocks app, with a particular stock selected

    - by Vincent Gable
    I would like to launch Apple's Stocks app to show information for a particular stock, on a non-jailbroken phone. I'm not interesting in how to get a quote or graph a stock myself, just opening Stocks.app. I was hoping that the Stocks app would have a custom URL format, so opening a URL like stocks://AAPL would do the trick. But I haven't found anything documenting such a scheme, and suspect it doesn't exist. Any other ideas, or is it impossible to integrate with the native Stocks app?

    Read the article

  • Graceful termination of NSApplication with Core Data and Grand Central Dispatch (GCD)

    - by Vincent Mac
    I have an Cocoa Application (Mac OS X SDK 10.7) that is performing some processes via Grand Central Dispatch (GCD). These processes are manipulating some Core Data NSManagedObjects (non-document-based) in a manner that I believe is thread safe (creating a new managedObjectContext for use in this thread). The problem I have is when the user tries to quit the application while the dispatch queue is still running. The NSApplication delegate is being called before actually quitting. - (NSApplicationTerminateReply)applicationShouldTerminate:(NSApplication *)sender I get an error "Could not merge changes." Which is somewhat expected since there are still operations being performed through the different managedObjectContext. I am then presented with the NSAlert from the template that is generated with a core data application. In the Threading Programming Guide there is a section called "Be Aware of Thread Behaviors at Quit Time" which alludes to using replyToApplicationShouldTerminate: method. I'm having a little trouble implementing this. What I would like is for my application to complete processing the queued items and then terminate without presenting an error message to the user. It would also be helpful to update the view or use a sheet to let the user know that the app is performing some action and will terminate when the action is complete. Where and how would I implement this behavior?

    Read the article

  • JQuery - Nested AJAX

    - by Vincent
    All, I am trying to perform a nested AJAX call using the following code. The nested call doesn't seem to work. Am I doing anything wrong? $.ajax({ type: 'GET', url: "/public/customcontroller/dosomething", cache: false, dataType: "html", success: function(html_input) { $.ajax({ type: 'GET', url: "/public/customcontroller/getjobstatus", cache: false, dataType: "html", success: function(html_input){ alert(html_input); } }); } }); Thanks

    Read the article

  • Updating with Related Entities - Entity Framework v4

    - by Vincent BOUZON
    Hi, I use Entity Framework V4 and i want to update Customer who have Visits. My code : EntityKey key; object originalItem; key = this._modelContainer.CreateEntityKey("Customers", customer); if (this._modelContainer.TryGetObjectByKey(key, out originalItem)) { this._modelContainer.ApplyCurrentValues(key.EntitySetName, customer); } this._modelContainer.SaveChanges(); It works for Scalar Property only. The customers.Visits collection is not updated. Best Regards :)

    Read the article

  • Ruby use method only if condition is true

    - by Vincent
    So I have this code: class Door # ... def info attr = "" return { "width" => @width, "height" => @height, "color" => @color }[attr] if attr != "" end end mydoor = Door.new(100, 100, "red") puts mydoor.info("width") puts mydoor.info The method "info" should return the hash if no argument is provided, otherwise the value of the argument in the hash. How can I achieve that?

    Read the article

< Previous Page | 1 2 3 4 5 6 7 8 9 10  | Next Page >