Search Results

Search found 14378 results on 576 pages for 'record count'.

Page 504/576 | < Previous Page | 500 501 502 503 504 505 506 507 508 509 510 511  | Next Page >

  • MACRO compilation PROBLEM

    - by wildfly
    i was given a primitive task to find out (and to put in cl) how many nums in an array are bigger than the following ones, (meaning if (arr[i] arr[i+1]) count++;) but i've problems as it has to be a macro. i am getting errors from TASM. can someone give me a pointer? SortA macro a, l LOCAL noes irp reg, <si,di,bx> push reg endm xor bx,bx xor si,si rept l-1 ;;also tried rept 3 : wont' compile mov bl,a[si] inc si cmp bl,arr[si] jb noes inc di noes: add di,0 endm mov cx,di irp reg2, <bx,di,si> pop reg2 endm endm dseg segment arr db 10,9,8,7 len = 4 dseg ends sseg segment stack dw 100 dup (?) sseg ends cseg segment assume ds:dseg, ss:sseg, cs:cseg start: mov ax, dseg mov ds,ax sortA arr,len cseg ends end start errors: Assembling file: sorta.asm **Error** sorta.asm(51) REPT(4) Expecting pointer type **Error** sorta.asm(51) REPT(6) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(10) Expecting pointer type **Error** sorta.asm(51) REPT(12) Symbol already different kind: NOES **Error** sorta.asm(51) REPT(16) Expecting pointer type **Error** sorta.asm(51) REPT(18) Symbol already different kind: NOES Error messages: 6

    Read the article

  • Help with SQL query (Calculate a ratio between two entitiess)

    - by Mestika
    Hi, I’m going to calculate a ratio between two entities but are having some trouble with the query. The principal is the same to, say a forum, where you say: A user gets points for every new thread. Then, calculate the ratio of points for the number of threads. Example: User A has 300 points. User A has started 6 thread. The point ratio is: 50:6 My schemas look as following: student(studentid, name, class, major) course(courseid, coursename, department) courseoffering(courseid, semester, year, instructor) faculty(name, office, salary) gradereport(studentid, courseid, semester, year, grade) The relations is a following: Faculity(name) = courseoffering(instructor) Student(studentid) = gradereport (studentid) Courseoffering(courseid) = course(courseid) Gradereport(courseid) = courseoffering(courseid) I have this query to select the faculty names there is teaching one or more students: SELECT COUNT(faculty.name) FROM faculty, courseoffering, gradereport, student WHERE faculty.name = courseoffering.instructor AND courseoffering.courseid = gradereport.courseid AND gradereport.studentid = student.studentid My problem is to find the ratio between the faculty members salary in regarding to the number of students they are teaching. Say, a teacher get 10.000 in salary and teaches 5 students, then his ratio should be 1:5. I hope that someone has an answer to my problem and understand what I'm having trouble with. Thanks Mestika

    Read the article

  • Delegate Methods Not Firing on Search Results Table

    - by Slinky
    All, I have a UITableView w/detail, with a Search bar, created from code. Works fine on selected items except it doesn't work when an item is clicked from the search results; no delegate methods fire. Never seen this type of behavior before so I don't know where the issue lies. I get the same behavior with standard table cells as well as custom table cells. Appreciate any guidance on this and thanks. Just Hangs Here //ViewController.h @interface SongsViewController : UITableViewController <UISearchBarDelegate,UISearchDisplayDelegate> { NSMutableArray *searchData; UISearchBar *searchBar; UISearchDisplayController *searchDisplayController; UITableViewCell *customSongCell; } //ViewController.m -(void)viewDidLoad { [super viewDidLoad]; CGRect screenRect = [[UIScreen mainScreen] bounds]; CGFloat screenWidth = screenRect.size.width; searchBar = [[UISearchBar alloc] initWithFrame:CGRectMake(0, 0, screenWidth, 88)]; [searchBar setShowsScopeBar:YES]; [searchBar setScopeButtonTitles:[[NSArray alloc] initWithObjects:@"Title",@"Style", nil]]; searchDisplayController = [[UISearchDisplayController alloc] initWithSearchBar:searchBar contentsController:self]; searchDisplayController.delegate = self; searchDisplayController.searchResultsDataSource = self; self.tableView.tableHeaderView = searchBar; //Load custom table cell UINib *songCellNib = [UINib nibWithNibName:@"SongItem" bundle:nil]; //Register this nib, which contains the cell [[self tableView] registerNib:songCellNib forCellReuseIdentifier:@"SongItemCell"]; // create a filtered list that will contain products for the search results table. SongStore *ps = [SongStore defaultStore]; NSArray *songObjects = [ps allSongs]; self.filteredListContent = [NSMutableArray arrayWithCapacity: [songObjects count]]; self.masterSongArr = [[NSMutableArray alloc] initWithArray:[ps allSongs]]; [self refreshData]; [self.tableView reloadData]; self.tableView.scrollEnabled = YES; }

    Read the article

  • Constructor initializer list: code from the C++ Primer, chapter 16

    - by Alexandros Gezerlis
    Toward the end of Chapter 16 of the "C++ Primer" I encountered the following code (I've removed a bunch of lines): class Sales_item { public: // default constructor: unbound handle Sales_item(): h() { } private: Handle<Item_base> h; // use-counted handle }; My problem is with the Sales_item(): h() { } line. For the sake of completeness, let me also quote the parts of the Handle class template that I think are relevant to my question (I think I don't need to show the Item_base class): template <class T> class Handle { public: // unbound handle Handle(T *p = 0): ptr(p), use(new size_t(1)) { } private: T* ptr; // shared object size_t *use; // count of how many Handles point to *ptr }; I would have expected something like either: a) Sales_item(): h(0) { } which is a convention the authors have used repeatedly in earlier chapters, or b) Handle<Item_base>() if the intention was to invoke the default constructor of the Handle class. Instead, what the book has is Sales_item(): h() { }. My gut reaction is that this is a typo, since h() looks suspiciously similar to a function declaration. On the other hand, I just tried compiling under g++ and running the example code that uses this class and it seems to be working correctly. Any thoughts?

    Read the article

  • Model value not being set on return from View to Controller

    - by sagesky36
    I have a boolean model variable who's value is supposed to be set to TRUE in order to perform a process on return back into the Controller. It works absolutely fine on my local machine, but not on the remote web server. Can somebody PLEASE inform me what I am missing? Below is the "proof of the pudding": The boolean value in quesion is "ShouldGeneratePdf"; MODEL: namespace PDFConverterModel.ViewModels { public partial class ViewModelTemplate_Guarantors { public ViewModelTemplate_Guarantors() { Templates = new List<PDFTemplate>(); Guarantors = new List<tGuarantor>(); } public int SelectedTemplateId { get; set; } public List<PDFTemplate> Templates { get; set; } public int SelectedGuarantorId { get; set; } public List<tGuarantor> Guarantors { get; set; } public string LoanId { get; set; } public string DepartmentId { get; set; } public bool isRepeat { get; set; } public string ddlDept { get; set; } public string SelectedDeptText { get; set; } public string LoanTypeId { get; set; } public string LoanType { get; set; } public string Error { get; set; } public string ErrorT { get; set; } public string ErrorG { get; set; } public bool ShowGeneratePDFBtn { get; set; } public bool ShouldGeneratePdf { get; set; } } } MasterPage: <!DOCTYPE html> <html> <head> <title>@ViewBag.Title</title> <link href="@Url.Content("~/Content/Site.css")" rel="stylesheet" type="text/css" /> <link href="@Url.Content("~/Content/kendo/2012.2.913/kendo.common.min.css")" rel="stylesheet" type="text/css" /> <link href="@Url.Content("~/Content/kendo/2012.2.913/kendo.dataviz.min.css")" rel="stylesheet" type="text/css" /> <link href="@Url.Content("~/Content/kendo/2012.2.913/kendo.blueopal.min.css")" rel="stylesheet" type="text/css" /> <script src="@Url.Content("~/Scripts/jquery-1.7.1.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.unobtrusive-ajax.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/modernizr-2.5.3.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/kendo/2012.2.913/kendo.all.min.js")"></script> <script src="@Url.Content("~/Scripts/kendo/2012.2.913/kendo.aspnetmvc.min.js")"></script> </head> <body> <div class="page"> <header> <div id="title"> <h1>BHG :: PDF Service Generator</h1> </div> </header> <section id="main"> @RenderBody() </section> <footer> </footer> </div> </body> </html> View: @model PDFConverterModel.ViewModels.ViewModelTemplate_Guarantors @using (Html.BeginForm("ProcessForm", "Home", new AjaxOptions { HttpMethod = "POST" })) { <table style="width: 1000px"> @Html.HiddenFor(x => x.ShouldGeneratePdf) <tr> <td> <img alt="BHG Logo" src="~/Images/logo.gif" /> </td> </tr> <tr> <td> @(Html.Kendo().IntegerTextBox() .Placeholder("Enter Loan Id") .Name("LoanId") .Format("{0:#######}") .Value(Convert.ToInt32(Model.LoanId)) ) </td> </tr> <tr> <td>@Html.Label("Loan Type: ") @Html.DisplayFor(model => Model.LoanType) </td> <td> <label for="ddlDept">Department:</label> @(Html.Kendo().DropDownListFor(model => Model.ddlDept) .Name("ddlDept") .DataTextField("DepartmentName") .DataValueField("DepartmentID") .Events(e => e.Change("Refresh")) .DataSource(source => { source.Read(read => { read.Action("GetDepartments", "Home"); }); }) .Value(Model.ddlDept.ToString()) ) </td> </tr> @if (Model.ShowGeneratePDFBtn == true) { if (Model.ErrorT == string.Empty) { <tr> <td> <u><b>@Html.Label("Templates:")</b></u> </td> </tr> <tr> @for (int i = 0; i < Model.Templates.Count; i++) { <td> @Html.CheckBoxFor(model => Model.Templates[i].IsChecked) @Html.DisplayFor(model => Model.Templates[i].TemplateId) </td> } </tr> } else { <tr> <td> <b>@Html.DisplayFor(model => Model.ErrorT)</b> </td> </tr> } if (Model.ErrorG == string.Empty) { <tr> <td> <u><b>@Html.Label("Guarantors:")</b></u> </td> </tr> <tr> @for (int i = 0; i < Model.Guarantors.Count; i++) { <td> @Html.CheckBoxFor(model => Model.Guarantors[i].isChecked) @Html.DisplayFor(model => Model.Guarantors[i].GuarantorFirstName)&nbsp;@Html.DisplayFor(model => Model.Guarantors[i].GuarantorLastName) </td> } </tr> } else { <tr> <td> <b>@Html.DisplayFor(model => Model.ErrorG)</b> </td> </tr> } } <tr> <td> <input type="submit" name="submitbutton" id="btnRefresh" value='Refresh' /> </td> @if (Model.ShowGeneratePDFBtn == true) { <td> <input type="submit" name="submitbutton" id="btnGeneratePDF" value='Generate PDF' /> </td> } </tr> <tr> <td style="color: red; font: bold"> @Model.Error </td> </tr> </table> } <script type="text/javascript"> $('#btnRefresh').click(function () { Refresh(); }); function Refresh() { var LoanID = $("#LoanID").val(); if (parseInt(LoanID) != 0) { $('#ShouldGeneratePdf').val(false) document.forms[0].submit(); } else { alert("Please enter a LoanId"); } } //$(function () { // //DOM loaded // $('#btnGeneratePDF').click(function () { // DisableGeneratePDF(); // $('#ShouldGeneratePdf').val(true) // }); //}); //function DisableGeneratePDF() { // $('#btnGeneratePDF').attr("disabled", true); // $('#btnRefresh').attr("disabled", true); //} $('#btnGeneratePDF').click(function () { alert("inside click function"); DisableGeneratePDF(); $('#ShouldGeneratePdf').val(true) tof = $('#ShouldGeneratePdf').val(); alert("ShouldGeneratePdf set to " + tof); }); function DisableGeneratePDF() { alert("begin DisableGeneratePDF function"); $('#btnGeneratePDF').attr("disabled", true); $('#btnRefresh').attr("disabled", true); alert("end DisableGeneratePDF function"); } </script> Controller: [HttpPost] public ActionResult ProcessForm(string submitbutton, ViewModelTemplate_Guarantors model, FormCollection collection) if ((submitbutton == "Refresh") || (submitbutton == null) && (model.ShouldGeneratePdf == false)) { } else if ((submitbutton == "Generate PDF") || (model.ShouldGeneratePdf == true)) { } The "Alerts" in the script above come out to exactly what they should be on the remote server. The last alert shows that the value of the bool variable is "true". However, when I do page source views of the hidden variable, below is the result. The values of the hidden variable when the page loads and when the last alert button finishes are as follows: My local machine: The remote machine: As you can see, the value on my machine is set to true when the process executes. However, on the remote machine, it is set to false where it then doesn't excute. Why isn't the value in the model being returned as TRUE on the remote machine?

    Read the article

  • Multidimensional data structure?

    - by Austin Truong
    I need a multidimensional data structure with a row and a column. Must be able to insert elements any location in the data structure. Example: {A , B} I want to insert C in between A and B. {A, C, B}. Dynamic: I do not know the size of the data structure. Another example: I know the [row][col] of where I want to insert the element. EX. insert("A", 1, 5), where A is the element to be inserted, 1 is the row, 5 is the column. EDIT I want to be able to insert like this. static void Main(string[] args) { Program p = new Program(); List<string> list = new List<string>(); list.Insert(1, "HELLO"); list.Insert(5, "RAWR"); for (int i = 0; i < list.Count; i++) { Console.WriteLine(list[i]); } Console.ReadKey(); } And of course this crashes with an out of bounds error. So in a sense I will have a user who will choose which ROW and COL to insert the element to.

    Read the article

  • Stored Procedure: Reducing Table Data

    - by SumGuy
    Hi Guys, A simple question about Stored Procedures. I have one stored procedure collecting a whole bunch of data in a table. I then call this procedure from within another stored procedure. I can copy the data into a new table created in the calling procedure but as far as I can see the tables have to be identical. Is this right? Or is there a way to insert only the data I want? For example.... I have one procedure which returns this: SELECT @batch as Batch, @Count as Qty, pd.Location, cast(pd.GL as decimal(10,3)) as [Length], cast(pd.GW as decimal(10,3)) as Width, cast(pd.GT as decimal(10,3)) as Thickness FROM propertydata pd GROUP BY pd.Location, pd.GL, pd.GW, pd.GT I then call this procedure but only want the following data: DECLARE @BatchTable TABLE ( Batch varchar(50), [Length] decimal(10,3), Width decimal(10,3), Thickness decimal(10,3), ) INSERT @BatchTable (Batch, [Length], Width, Thickness) EXEC dbo.batch_drawings_NEW @batch So in the second command I don't want the Qty and Location values. However the code above keeps returning the error: "Insert Error: Column name or number of supplied values does not match table"

    Read the article

  • Easiest way to remove Keys from a 2D Array?

    - by dbemerlin
    Hi, I have an Array that looks like this: array( 0 => array( 'key1' => 'a', 'key2' => 'b', 'key3' => 'c' ), 1 => array( 'key1' => 'c', 'key2' => 'b', 'key3' => 'a' ), ... ) I need a function to get an array containing just a (variable) number of keys, i.e. reduce_array(array('key1', 'key3')); should return: array( 0 => array( 'key1' => 'a', 'key3' => 'c' ), 1 => array( 'key1' => 'c', 'key3' => 'a' ), ... ) What is the easiest way to do this? If possible without any additional helper function like array_filter or array_map as my coworkers already complain about me using too many functions. The source array will always have the given keys so it's not required to check for existance. Bonus points if the values are unique (the keys will always be related to each other, meaning that if key1 has value a then the other key(s) will always have value b). My current solution which works but is quite clumsy (even the name is horrible but can't find a better one): function get_unique_values_from_array_by_keys(array $array, array $keys) { $result = array(); $found = array(); if (count($keys) > 0) { foreach ($array as $item) { if (in_array($item[$keys[0]], $found)) continue; array_push($found, $item[$keys[0]]); $result_item = array(); foreach ($keys as $key) { $result_item[$key] = $item[$key]; } array_push($result, $result_item); } } return $result; } Addition: PHP Version is 5.1.6.

    Read the article

  • Help ! How do I get the total number rows from my mssql paging procedure ?

    - by The_AlienCoder
    Ok I have a table in my MSSQL database that stores comments. My desire is to be able to page though the records using [Back],[Next], page numbers & [Last] buttons in my datalist. I figured the most efficient way was to use a stored procedure that only returns a certain number of rows within a partcular range. Here is what I came up with @PageIndex INT, @PageSize INT, @postid int AS SET NOCOUNT ON begin WITH tmp AS ( SELECT comments.*, ROW_NUMBER() OVER (ORDER BY dateposted ASC) AS Row FROM comments WHERE (comments.postid = @postid)) SELECT tmp.* FROM tmp WHERE Row between (@PageIndex - 1) * @PageSize + 1 and @PageIndex*@PageSize end RETURN Now everything works fine and I have been able implement [Next] and [Back] buttons in my datalist pager.Now I need the total number of all comments(not in the cuurent page) so that I can implement my page numbers and the[Last] button on my pager. In other words I want to return the total number of rows in my first select statement i.e WITH tmp AS ( SELECT comments.*, ROW_NUMBER() OVER (ORDER BY dateposted ASC) AS Row FROM comments WHERE (comments.postid = @postid)) set @TotalRows = @@rowcount @@rowcount doesnt work and raises an error.I also cant get count.* to work either. Is there another way to get the total amount of rows or is my approach doomed.

    Read the article

  • Eliminate full table scan due to BETWEEN (and GROUP BY)

    - by Dave Jarvis
    Description According to the explain command, there is a range that is causing a query to perform a full table scan (160k rows). How do I keep the range condition and reduce the scanning? I expect the culprit to be: Y.YEAR BETWEEN 1900 AND 2009 AND Code Here is the code that has the range condition (the STATION_DISTRICT is likely superfluous). SELECT COUNT(1) as MEASUREMENTS, AVG(D.AMOUNT) as AMOUNT, Y.YEAR as YEAR, MAKEDATE(Y.YEAR,1) as AMOUNT_DATE FROM CITY C, STATION S, STATION_DISTRICT SD, YEAR_REF Y FORCE INDEX(YEAR_IDX), MONTH_REF M, DAILY D WHERE -- For a specific city ... -- C.ID = 10663 AND -- Find all the stations within a specific unit radius ... -- 6371.009 * SQRT( POW(RADIANS(C.LATITUDE_DECIMAL - S.LATITUDE_DECIMAL), 2) + (COS(RADIANS(C.LATITUDE_DECIMAL + S.LATITUDE_DECIMAL) / 2) * POW(RADIANS(C.LONGITUDE_DECIMAL - S.LONGITUDE_DECIMAL), 2)) ) <= 50 AND -- Get the station district identification for the matching station. -- S.STATION_DISTRICT_ID = SD.ID AND -- Gather all known years for that station ... -- Y.STATION_DISTRICT_ID = SD.ID AND -- The data before 1900 is shaky; insufficient after 2009. -- Y.YEAR BETWEEN 1900 AND 2009 AND -- Filtered by all known months ... -- M.YEAR_REF_ID = Y.ID AND -- Whittled down by category ... -- M.CATEGORY_ID = '003' AND -- Into the valid daily climate data. -- M.ID = D.MONTH_REF_ID AND D.DAILY_FLAG_ID <> 'M' GROUP BY Y.YEAR Update The SQL is performing a full table scan, which results in MySQL performing a "copy to tmp table", as shown here: +----+-------------+-------+--------+-----------------------------------+--------------+---------+-------------------------------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+-------+--------+-----------------------------------+--------------+---------+-------------------------------+--------+-------------+ | 1 | SIMPLE | C | const | PRIMARY | PRIMARY | 4 | const | 1 | | | 1 | SIMPLE | Y | range | YEAR_IDX | YEAR_IDX | 4 | NULL | 160422 | Using where | | 1 | SIMPLE | SD | eq_ref | PRIMARY | PRIMARY | 4 | climate.Y.STATION_DISTRICT_ID | 1 | Using index | | 1 | SIMPLE | S | eq_ref | PRIMARY | PRIMARY | 4 | climate.SD.ID | 1 | Using where | | 1 | SIMPLE | M | ref | PRIMARY,YEAR_REF_IDX,CATEGORY_IDX | YEAR_REF_IDX | 8 | climate.Y.ID | 54 | Using where | | 1 | SIMPLE | D | ref | INDEX | INDEX | 8 | climate.M.ID | 11 | Using where | +----+-------------+-------+--------+-----------------------------------+--------------+---------+-------------------------------+--------+-------------+ Related http://dev.mysql.com/doc/refman/5.0/en/how-to-avoid-table-scan.html http://dev.mysql.com/doc/refman/5.0/en/where-optimizations.html http://stackoverflow.com/questions/557425/optimize-sql-that-uses-between-clause Thank you!

    Read the article

  • jQuery preventing RedirectToAction from working?

    - by DaveDev
    I'm trying to redirect the user if they login successfully but the code I have on my page seems to be preventing the redirection from working. If I remove the jQuery below the redirection works. Can somebody tell me tell me if there's something I'm doing wrong? Thanks I have the following Action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Login(User user) { var myErrors = new Dictionary<string, string>(); try { if (ModelState.IsValid) { if (userRepository.ValidUser(user)) { return RedirectToAction("Index", "Group", new {page = (int?)null}); } else { return Json("Username or password seems to be incorrect"); } } else { foreach (KeyValuePair<string, ModelState> keyValuePair in ViewData.ModelState) { if (keyValuePair.Value.Errors.Count > 0) { List<string> errors = new List<string>(); myErrors.Add(keyValuePair.Key, keyValuePair.Value.Errors[0].ErrorMessage); } } return Json(myErrors); } } catch (Exception) { return Json("Invalid"); } } and the following code on my page: <script language="javascript" type="text/javascript"> $(document).ready(function() { $("#SaveSuccess").hide(); $("#btnLogin").click(function() { $("form").submit(function(event) { var formData = $(this).serialize(); $.post($(this).attr("action"), formData, function(res) { ShowErrors(res); if (res == true) { $("#SaveSuccess").text("Saved"); } else { $("#divError").html(res); } $("#SaveSuccess").fadeIn(100); }, "json"); return false; }); }); }); </script>

    Read the article

  • Testing ActionMailer's receive method (Rails)

    - by Brian Armstrong
    There is good documentation out there on testing ActionMailer send methods which deliver mail. But I'm unable to figure out how to test a receive method that is used to parse incoming mail. I want to do something like this: require 'test_helper' class ReceiverTest < ActionMailer::TestCase test "parse incoming mail" do email = TMail::Mail.parse(File.open("test/fixtures/emails/example1.txt",'r').read) assert_difference "ProcessedMail.count" do Receiver.receive email end end end But I get the following error on the line which calls Receiver.receive NoMethodError: undefined method `index' for #<TMail::Mail:0x102c4a6f0> /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/stringio.rb:128:in `gets' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:392:in `parse_header' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:139:in `initialize' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/stringio.rb:43:in `open' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/port.rb:340:in `ropen' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:138:in `initialize' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:123:in `new' /Library/Ruby/Gems/1.8/gems/tmail-1.2.7.1/lib/tmail/mail.rb:123:in `parse' /Library/Ruby/Gems/1.8/gems/actionmailer-2.3.4/lib/action_mailer/base.rb:417:in `receive' Tmail is parsing the test file I have correctly. So that's not it. Thanks!

    Read the article

  • Conversion failed when converting datetime from character string

    - by salvationishere
    I am developing a C# VS 2008 / SQL Server 2005 Express website application. I have tried some of the fixes for this problem but my call stack differs from others. And these fixes did not fix my problem. What steps can I take to troubleshoot this? Here is my error: System.Data.SqlClient.SqlException was caught Message="Conversion failed when converting datetime from character string." Source=".Net SqlClient Data Provider" ErrorCode=-2146232060 LineNumber=10 Number=241 Procedure="AppendDataCT" Server="\\\\.\\pipe\\772EF469-84F1-43\\tsql\\query" State=1 StackTrace: at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection) at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection) at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj) at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj) at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString) at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async) at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result) at System.Data.SqlClient.SqlCommand.InternalExecuteNonQuery(DbAsyncResult result, String methodName, Boolean sendToPipe) at System.Data.SqlClient.SqlCommand.ExecuteNonQuery() at ADONET_namespace.ADONET_methods.AppendDataCT(DataTable dt, Dictionary`2 dic) in c:\Documents and Settings\Admin\My Documents\Visual Studio 2008\WebSites\Jerry\App_Code\ADONET methods.cs:line 102 And here is the related code. When I debugged this code, "dic" only looped through the 3 column names, but did not look into row values which are stored in "dt", the Data Table. public static string AppendDataCT(DataTable dt, Dictionary<string, string> dic) { if (dic.Count != 3) throw new ArgumentOutOfRangeException("dic can only have 3 parameters"); string connString = ConfigurationManager.ConnectionStrings["AW3_string"].ConnectionString; string errorMsg; try { using (SqlConnection conn2 = new SqlConnection(connString)) { using (SqlCommand cmd = conn2.CreateCommand()) { cmd.CommandText = "dbo.AppendDataCT"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; foreach (string s in dic.Keys) { SqlParameter p = cmd.Parameters.AddWithValue(s, dic[s]); p.SqlDbType = SqlDbType.VarChar; } conn2.Open(); cmd.ExecuteNonQuery(); conn2.Close(); errorMsg = "The Person.ContactType table was successfully updated!"; } } }

    Read the article

  • pulling a value from NSMutableDictionary

    - by Jared Gross
    I have a dictionary array with a key:@"titleLabel". I am trying to load a pickerView with ONE instance of each @"titleLabel" key so that if there are multiple objects with the same @"titleLabel" only one title will be displayed. I've done some research on this forum and looked at apples docs but haven't been able to put the puzzle together. Below is my code but I am having trouble pulling the values. Right now when I run this code it throws an error Incompatible pointer types sending 'PFObject *' to parameter of type 'NSString' which i understand but am just not sure how to remedy. Cheers! else { // found messages! self.objectsArray = objects; NSMutableDictionary *dict = [[NSMutableDictionary alloc] init]; for(id obj in self.objectsArray){ PFObject *key = [self.objectsArray valueForKey:@"titleLabel"]; if(![dict objectForKey:@"titleLabel"]){ [dict setValue:obj forKey:key]; } } for (id key in dict) { NSLog(@"Objects array is %d", [self.objectsArray count]); NSLog(@"key: %@, value: %@ \n", key, [dict objectForKey:key]); } [self.pickerView reloadComponent:0]; } }];` Here is where I define the PFObject and keys: PFObject *image = [PFObject objectWithClassName:@"Images"]; [image setObject:file forKey:@"file"]; [image setObject:fileType forKey:@"fileType"]; [image setObject:title forKey:@"titleLabel"]; [image setObject:self.recipients forKey:@"recipientIds"]; [image setObject:[[PFUser currentUser] objectId] forKey:@"senderId"]; [image setObject:[[PFUser currentUser] username] forKey:@"senderName"]; [image saveInBackground];

    Read the article

  • NSOutlineView not redrawing

    - by Septih
    Hello, I have an NSOutlineView with checkboxes. I have the checkbox state bound to a node item with the key shouldBeCopied. In the node item I have the getters and setters like so: -(BOOL)shouldBeCopied { if([[self parent] shouldBeCopied]) return YES; return shouldBeCopied; } -(void)setShouldBeCopied:(BOOL)value { shouldBeCopied = value; if(value && [[self children] count] > 0) [[self delegate] reloadData]; } The idea here is that if the parent is checked, so should the children. The problem I'm having is that when I check the parent, it does not update that view of the children if they are already expanded. I can understand that it should not be updated by the bindings because i'm not actually changing the value. But should reloadData not cause the bindings to re-get the value, thus calling -shouldBeCopied for the children? I have tried a few other things such as -setNeedsDisplay and -reloadItem:nil reloadChildren:YES but none work. I've noticed that the display gets refreshed when I swap to xcode and then back again and that's all I want, so how do I get it to behave that way?

    Read the article

  • How to find whole graph coverage path in dynamic state-flow diagram?

    - by joseph
    Hello, As I've been researching algorithms for path finding in graph, I found interesting problem. Definition of situation: 1)State diagram can have p states, and s Boolean Fields, and z Int Fields 2)Every state can have q ingoing and r outgoing transitions, and h Int fields (h belongs to z - see above) 3)Every transition can have only 1 event, and only 1 action 4)every action can change n Boolean Fields, and x Int Fields 5)every event can have one trigger from combination of any count of Boolean Fields in diagram 6)Transition can be in OPEN/CLOSED form. If the transition is open/closed depends on trigger2 compounded from 0..c Boolean fields. 7) I KNOW algorithm for finding shortest paths from state A to state B. 8) I KNOW algorithm for finding path that covers all states and transitions of whole state diagram, if all transitions are OPEN. Now, what is the goal: I need to find shortest path that covers all states and transitions in dynamically changing state diagram described above. When an action changes some int field, the algorithm should go through all states that have changed int field. The algorithm should also be able to open and close transition (by going through transitions that open and close another transitions by action) in the way that the founded path will be shortest and covers all transitions and states. Any idea how to solve it? I will be really pleased for ANY idea. Thanks for answers.

    Read the article

  • Programmatically filtering contacts in Outlook 2010 Add-In

    - by Leon Havin
    I am trying to programmatically filter Outlook contacts in the Contacts folder in Outlook 2010. I followed DASL filter rules, but it seems working for Find function and throws exception when I assign this filter to view.Filter = FilterString. Any ideas what I am doing wrong? The correct result would display filtered contacts in the existing contacts view. Outlook.Application myApp = ThisAddIn.myApp; Outlook.NameSpace myNamespace = ThisAddIn.nSpace; Outlook.MAPIFolder myContactsFolder = ThisAddIn.contactsFolder; if (myContactsFolder == null) { Log.Verbose("Contacts folder not found"); return null; } Outlook.Items contactItems = ThisAddIn.contactItems; //use filter to take only contact and not DistListItem Outlook.Items outlookContacts = contactItems.Restrict("[MessageClass] = 'IPM.Contact'"); Outlook.ContactItem contact = null; int iOutlookContacts = contactItems.Count; if (iOutlookContacts > 0) { string FilterString = "[FullName]='" + param + "'"; // Find works with this filter contact = (Outlook.ContactItem)outlookContacts.Find(FilterString); if (contact != null) { // need to display in contacts search window Outlook.View currentView = myApp.ActiveExplorer().CurrentView; currentView.Filter = FilterString; // cannot parse exception occurs here currentView.Save(); currentView.Apply(); } }

    Read the article

  • identifier ... is undefined when trying to run pure C code in Cuda using nvcc

    - by Lostsoul
    I'm new and learning Cuda. A approach that I'm trying to use to learn is to write code in C and once I know its working start converting it to Cuda since I read that nvcc compiles Cuda code but complies everything else using plain old c. My code works in c(using gcc) but when I try to compile it using nvcc(after changing the file name from main.c to main.cu) I get main.cu(155): error: identifier "num_of_rows" is undefined main.cu(155): error: identifier "num_items_in_row" is undefined 2 errors detected in the compilation of "/tmp/tmpxft_00002898_00000000-4_main.cpp1.ii". Basically in my main method I send data to a function like this: process_list(count, countListItem, list); the first two items are ints and the last item(list) is a matrix. Then I create my function like this: void process_list(int num_of_rows, int num_items_in_row, int current_list[num_of_rows][num_items_in_row]) { This line is where I get my errors when using nvcc(line 155). I need to convert this code to cuda anyway so no need to troubleshoot this specific issue(plus code is quite large) but I'm wondering if I'm wrong about nvcc treating the C part of your code like plain C. In the book cuda by example I just used nvcc to compile but do I need any extra flags when just using pure c?

    Read the article

  • Listview not being populated

    - by Luke
    I have put some console.writeline code in to test, but they arent appearing in the output box? public static ArrayList myDeliveries = new ArrayList(); public mainForm() { InitializeComponent(); } private void mainForm_Load(object sender, EventArgs e) { if (!File.Exists("../../MealDeliveries.txt")) { MessageBox.Show("File not found!"); return; } using (StreamReader sr = new StreamReader("../../MealDeliveries.txt")) { //first line is delivery name string strDeliveryName = sr.ReadLine(); Console.WriteLine("some tetttttttttt23423423423423423ttttttttttttttttttttttt"); while (strDeliveryName != null) { //other lines Delivery d = new Delivery(strDeliveryName, sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine()); mainForm.myDeliveries.Add(d); //check for further values strDeliveryName = sr.ReadLine(); } } displayDeliveries(); } private void displayDeliveries() { lstDeliveryDetails.Items.Clear(); Console.WriteLine("some tettttttttttttttttttttttttttttttttt"); Console.WriteLine(mainForm.myDeliveries.Count); foreach (Delivery d in mainForm.myDeliveries) { lstDeliveryDetails.Items.Add(d.DeliveryName); } } Can anyone help??

    Read the article

  • In a Windows forms application, how can I setup can I set up the SelectedIndexChanged handle for 4 d

    - by Alex
    In a Windows forms application, within a DataGridView, I have 4 different DataGridCombobox controlshow can I set up the handler SelectedIndexChanged handler for the first combobox via the EditingControlShowing event. I added code for a second combobox but the SelectedIndexChanged didn't get wired up. Here's my code. Any advice would be appreciated. private ComboBox countryCombo; private EventHandler countryHandler; private ComboBox partCombo; private EventHandler partHandler; private void dataGridView2_EditingControlShowing(object sender, DataGridViewEditingControlShowingEventArgs e) { countryCombo = e.Control as ComboBox; if (countryCombo != null) { //remove any existing handler if there is one countryCombo.SelectedIndexChanged -= countryHandler; //add the new handler countryCombo.SelectedIndexChanged += new EventHandler(countryCombo_SelectedIndexChanged); } if (partCombo != null) { partCombo.SelectedIndexChanged -= partHandler; partCombo.SelectedIndexChanged += new EventHandler(partCombo_SelectedIndexChanged); } } private void countryCombo_SelectedIndexChanged(object sender, EventArgs e) { ComboBox box = (ComboBox) sender; //MessageBox.Show(box.Items.Count.ToString()); int rowNum = dataGridView2.CurrentCell.RowIndex; dataGridView2.BeginEdit(false); dataGridView2.Rows[0].Cells[2].Value = "abcdef"; dataGridView2.EndEdit(); } private void dataGridView2_CellContentClick(object sender, DataGridViewCellEventArgs e) { int cellColumn = e.ColumnIndex; //MessageBox.Show("Column is: " + cellColumn.ToString()); } private void partCombo_SelectedIndexChanged(object sender, EventArgs e) { ComboBox box = (ComboBox)sender; string partNumber = box.SelectedValue as string; // ToDo: now we need to get the HTSUS from the database so we can //populate the field int rowNum = dataGridView2.CurrentCell.RowIndex; dataGridView2.BeginEdit(false); dataGridView2.Rows[0].Cells[2].Value = "abcdef"; dataGridView2.EndEdit(); } } Al D.

    Read the article

  • PHP modifying and combining array

    - by Industrial
    Hi everyone, I have a bit of an array headache going on. The function does what I want, but since I am not yet to well acquainted with PHP:s array/looping functions, so thereby my question is if there's any part of this function that could be improved from a performance-wise perspective? I tried to be as complete as possible in my descriptions in each stage of the functions which shortly described prefixes all keys in an array, fill up eventual empty/non-valid keys with '' and removes the prefixes before returning the array: $var = myFunction ( array('key1', 'key2', 'key3', '111') ); function myFunction ($keys) { $prefix = 'prefix_'; $keyCount = count($keys); // Prefix each key and remove old keys for($i=0;$i<$keyCount; $i++){ $keys[] = $prefix.$keys[$i]; unset($keys[$i]); } // output: array('prefix_key1', 'prefix_key2', 'prefix_key3', '111) // Get all keys from memcached. Only returns valid keys $items = $this->memcache->get($keys); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3) // note: key 111 was not found in memcache. // Fill upp eventual keys that are not valid/empty from memcache $return = $items + array_fill_keys($keys, ''); // output: array('prefix_key1' => 'value1', 'prefix_key2' => 'value2', 'prefix_key3'=>'value3, 'prefix_111' => '') // Remove the prefixes for each result before returning array to application foreach ($return as $k => $v) { $expl = explode($prefix, $k); $return[$expl[1]] = $v; unset($return[$k]); } // output: array('key1' => 'value1', 'key2' => 'value2', 'key3'=>'value3, '111' => '') return $return; } Thanks a lot!

    Read the article

  • Application Code Redesign to reduce no. of Database Hits from Performance Perspective

    - by Rachel
    Scenario I want to parse a large CSV file and inserts data into the database, csv file has approximately 100K rows of data. Currently I am using fgetcsv to parse through the file row by row and insert data into Database and so right now I am hitting database for each line of data present in csv file so currently database hit count is 100K which is not good from performance point of view. Current Code: public function initiateInserts() { //Open Large CSV File(min 100K rows) for parsing. $this->fin = fopen($file,'r') or die('Cannot open file'); //Parsing Large CSV file to get data and initiate insertion into schema. while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) { $query = "INSERT INTO dt_table (id, code, connectid, connectcode) VALUES (:id, :code, :connectid, :connectcode)"; $stmt = $this->prepare($query); // Then, for each line : bind the parameters $stmt->bindValue(':id', $data[0], PDO::PARAM_INT); $stmt->bindValue(':code', $data[1], PDO::PARAM_INT); $stmt->bindValue(':connectid', $data[2], PDO::PARAM_INT); $stmt->bindValue(':connectcode', $data[3], PDO::PARAM_INT); // Execute the statement $stmt->execute(); $this->checkForErrors($stmt); } } I am looking for a way wherein instead of hitting Database for every row of data, I can prepare the query and than hit it once and populate Database with the inserts. Any Suggestions !!! Note: This is the exact sample code that I am using but CSV file has more no. of field and not only id, code, connectid and connectcode but I wanted to make sure that I am able to explain the logic and so have used this sample code here. Thanks !!!

    Read the article

  • Call to a member function get_segment() error

    - by hogofwar
    I'm having this problem with this piece of PHP code: class Core { public function start() { require("funk/funks/libraries/uri.php"); $this->uri = new uri(); require("funk/core/loader.php"); $this->load = new loader(); if($this->uri->get_segment(1) != "" and file_exists("funk/pages/".$uri->get_segment(1).".php")){ Only a snippet of the code The best way I can explain it is that it is a class calling upon another class (uri.php) and i am getting the error: Fatal error: Call to a member function get_segment() on a non-object in /home/eeeee/public_html/private/funkyphp/funk/core/core.php on line 11 (the if($this-uri-get_segment(1) part) I'm having this problem a lot and it is really bugging me. the library code is: <?php class uri { private $server_path_info = ''; private $segment = array(); private $segments = 0; public function __construct() { $segment_temp = array(); $this->server_path_info = preg_replace("/\?/", "", $_SERVER["PATH_INFO"]); $segment_temp = explode("/", $this->server_path_info); foreach ($segment_temp as $key => $seg) { if (!preg_match("/([a-zA-Z0-9\.\_\-]+)/", $seg) || empty($seg)) unset($segment_temp[$key]); } foreach ($segment_temp as $k => $value) { $this->segment[] = $value; } unset($segment_temp); $this->segments = count($this->segment); } public function segment_exists($id = 0) { $id = (int)$id; if (isset($this->segment[$id])) return true; else return false; } public function get_segment($id = 0) { $id--; $id = (int)$id; if ($this->segment_exists($id) === true) return $this->segment[$id]; else return false; } } ?>

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How to reload a tableView i.e call the viewDidLoad method if a condition is met

    - by Kquane Ingram
    The problem is this i need a way to basically erase all the entry data a user placed into my arrays if a condition is met. Im new to Objective-C and iOS programming, but i believed the solution might be in calling the viewDidLoad method, thus it would virtually refresh the applications with the values of the array reset to default. If there is any other logical way of doing this i would appreciate the help. In short i need to refresh the arrays as they were when the application first launched and the user did not select anything. This is the part where i need it to refresh. if ([gradeRecieved objectAtIndex:i]==nil) { break; // if this condition is met the program must begin anew. Edit* I need to recall the - (void)viewDidLoad method here is more of the code. -(IBAction)button:(id)sender{ int i = 0; int sum = 0; int gradeEarned; int creditHours = 3; for ( i=0;i<8 ; i++) { if ([[points objectAtIndex:i] tag]==GradeA.intValue) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeA]; } if ([[points objectAtIndex:i]tag]==GradeB.intValue) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeB]; } if ([[points objectAtIndex:i]tag]==GradeC.intValue){ [gradeRecieved replaceObjectAtIndex:i withObject:GradeC]; } if ([gradeRecieved objectAtIndex:i]==nil) { break; // if this condition is met the program must restart. } } while ( i<[gradeRecieved count]) { if ([gradeRecieved objectAtIndex:i] == GradeA ) { [finArray replaceObjectAtIndex:i withObject:GradeA]; i++; continue; } if ([gradeRecieved objectAtIndex:i] == GradeB ) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeB]; i++; continue; } if ([gradeRecieved objectAtIndex:i] == GradeC ) { [gradeRecieved replaceObjectAtIndex:i withObject:GradeC]; i++; continue; } }

    Read the article

< Previous Page | 500 501 502 503 504 505 506 507 508 509 510 511  | Next Page >