Search Results

Search found 3983 results on 160 pages for 'partial trust'.

Page 51/160 | < Previous Page | 47 48 49 50 51 52 53 54 55 56 57 58  | Next Page >

• Is there a ppa or repository where we can update LibreOffice to version 3.6?

  - by josircg

  On http://www.libreoffice.org/download/ there is only RPM version - when great majority of Desktop Linux users are using systems based on APT... ppa:libreoffice/ppa seems to be very outdated with version 3.5 It's frustating to see several fixes on Windows version and Ubuntu versions so outdated... People generally reply as: we don't update due to security/stability reasons, etc example 1 example 2 why don't you compile yourself ? For those easy answers, I generally reply: let me decide which version to use at my own risk. I just want to try a newer version and I trust on LibreOffice devs. I understand that update a core lib is very dangerous but Libreoffice is an user application and it don't just break the whole system. Why don't I compile ? Because I am a regular user and don't have time to learn it. I would love to have this time but unfortunately, I don't have. Red Hat/Fedora guys have the same concerns but they update their LibreOffices...

  Read the article

• Why do we need private variables?

  - by rak

  Why do we need private variables in classes in the context of programming? Every book on programming I've read says this is a private variable, this is how you define it but stops there. The wording of these explanations always seemed to me like we really have a crisis of trust in our profession. The explanations always sounded like other programmers are out to mess up our code. Yet, there are many programming languages that do not have private variables. What do private variables help prevent? How do you decide if a particular of properties should be private or not? If by default every field SHOULD be private then why are there public data members in a class? Under what circumstances should a variable be made public?

  Read the article

• The fastest way to resize images from ASP.NET. And its (more) supported-ish.

  Ive shown before how to resize images using GDI, which is fairly common but is explicitly unsupported because we know of very real problems that this can cause. Still, many sites still use that method because those problems are fairly rare, and because most people assume its the only way to get the job done. Plus, it works in medium trust. More recently, Ive shown how you can use WPF APIs to do the same thing and get JPEG thumbnails, only 2.5 times faster than GDI (even now that GDI really ultimately...Did you know that DotNetSlackers also publishes .net articles written by top known .net Authors? We already have over 80 articles in several categories including Silverlight. Take a look: here.

  Read the article

• Effective Websites - Which Include Page Ranking

  Make your website design in such a way that website visitors would be able to get convinced about benefits of becoming your customers. Try to win their trust and develop their confidence in your products/services. Access to information from your website should be easy and hassle-free. For perfect lead generation identify the type of visitors you wish to visit your website and plan out the ways to attract them accordingly. Draft the site content in such a manner that they cater to the interests of particular section of visitors you target and get motivated to carry business dealings with your company.

  Read the article

• Best C++ Portable time library for game development

  - by Darkenor

  I'm venturing into the dark world of portable development and I'm looking for a nice library to keep track of system time for all game events. So far I've turned to trust boost and found: This boost library But I'm wondering if it there are some alternatives. I use boost a lot and (while I like it) I find that it sometimes takes me longer to figure out how to use the generic code than to write my own...not-so-generic code. (Ya, ya...I know. I should be less lazy). But anyway, advice appreciated! :)

  Read the article

• Getting warning about sensitive information that could be disclosed to 3rd parties - Asp.net MVC 2.0

  - by chobo2

  Hi I never gotten this message before I started to use asp.net mvc 2.0 and jquery 1.4. <title>This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.</title> <span><H1>Server Error in '/' Application.<hr width=100% size=1 color=silver></H1> <h2> <i>This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.</i> </h2></span> <font face="Arial, Helvetica, Geneva, SunSans-Regular, sans-serif "> <b> Description: </b>An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. <br><br> <b> Exception Details: </b>System.InvalidOperationException: This request has been blocked because sensitive information could be disclosed to third party web sites when this is used in a GET request. To allow GET requests, set JsonRequestBehavior to AllowGet.<br><br> So it makes me wondering what sensitive data could be disclosed and if so how to get around this? What I was trying to send back was a rendered string of a partial view(http://www.klopfenstein.net/lorenz.aspx/render-partial-view-to-string-in-asp-net-mvc) and a success msg.

  Read the article

• How to use multiple DisplayName attribute using Entity Framework and ASP.Net Mvc 2

  - by Picflight

  Depending on where I use my Class, I want to be able to show a different DisplayName. I have the following class: [MetadataType(typeof(PortalMetaData))] [System.Web.Mvc.Bind(Exclude = "PortalId")] public partial class Portal { public Portal() { this.Created = DateTime.Now; } } public class PortalMetaData { [Required(ErrorMessage = "Portal name is required")] [StringLength(50, ErrorMessage = "Portal name must be under 50 characters")] public object PortalName { get; set; } [Required(ErrorMessage = "Description is required")] public object Description { get; set; } } I have a corresponding Table in the database Portal I use the Portal table with a PortalController for the Site Admin to update the records in the Portal Table. I want another user with a different Role (AsstAdmin) to be able to update this table as well. To facilitate that I am thinking of creating a separate partial class that somehow links back to the Portal Model. This would allow me to display limited Fields for update by the AsstAdmin and I can display a different name for the Field as well. How can I accomplish this task? If I add the following class which inherits from Portal than I get an exception: Unable to cast object of type 'Project1.Mvc.Models.Portal' to type 'Prpject1.Mvc.Models.Site'. [MetadataType(typeof(SiteMetaData))] public class Site : Portal { public Site() { } } public class SiteMetaData { [Required(DisplayName = "Site Description")] public object Description { get; set; } }

  Read the article

• Bread Crumbs With C#

  - by kareemsaad

  I made Class And user Control In master.cs public partial class BreadCrumbs : System.Web.UI.UserControl { protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here bc1.PageTitle = HeaderText; } protected BreadCrumbs.ctrlBreadCrumbs bc1; private string _strHeaderText; public string HeaderText { get { return _strHeaderText; } set { _strHeaderText = value; } } } User Control: public partial class BreadCrumbs : System.Web.UI.UserControl { protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here bc1.PageTitle = HeaderText; } protected BreadCrumbs.ctrlBreadCrumbs bc1; private string _strHeaderText; public string HeaderText { get { return _strHeaderText; } set { _strHeaderText = value; } } } protected System.Web.UI.WebControls.Literal lblPageTitle; protected namespace.headerBreadCrumb header; ClsCategory clscategory = new ClsCategory(); protected void Page_Load(object sender, EventArgs e) { // Put user code to initialize the page here string PageTitle = "ASP.NET Breadcrumbs with C#"; lblPageTitle.Text = PageTitle; header.HeaderText = PageTitle; but it not work well i think problem here <%@ Register TagPrefix="bc" Namespace="BreadCrumbs" Assembly="BreadCrumbs" %> <bc:ctrlBreadCrumbs id="bc1" runat="server" />

  Read the article

• ASP.NET 4.0 UpdatePanel and UserControl with PlaceHolder

  - by Chris

  I don't know if this is ASP.NET 4.0 specific but I don't recall having this problem in previous versions. I have very simple user control called "TestModal" that contains a PlaceHolder control which I use to instantiate a template in. When I put an UpdatePanel inside this UserControl on the page the updatepanel only does full postbacks and not partial postbacks. What gives? USER CONTROL MARKUP: <%@ Control Language="C#" AutoEventWireup="true" CodeBehind="TestModal.ascx.cs" Inherits="MyProject.UserControls.TestModal" %> <div id="<%= this.ClientID %>"> <asp:PlaceHolder ID="plchContentTemplate" runat="server"></asp:PlaceHolder> </div> USER CONTROL CODE BEHIND: public partial class TestModal : System.Web.UI.UserControl { private ITemplate _contentTemplate; [TemplateInstance(TemplateInstance.Single)] [PersistenceMode(PersistenceMode.InnerProperty), TemplateContainer(typeof(TemplateControl))] public ITemplate ContentTemplate { get { return _contentTemplate; } set { _contentTemplate = value; } } protected override void OnInit(EventArgs e) { base.OnInit(e); if (_contentTemplate != null) _contentTemplate.InstantiateIn(plchContentTemplate); } } ASPX PAGE MARKUP: <ajaxToolkit:ToolkitScriptManager ID="scriptManager" EnablePartialRendering="true" AllowCustomErrorsRedirect="true" CombineScripts="true" EnablePageMethods="true" ScriptMode="Release" AsyncPostBackTimeout="180" runat="server"></ajaxToolkit:ToolkitScriptManager> <uc1:TestModal ID="testModal" ClientIDMode="Static" runat="server"> <ContentTemplate> <asp:UpdatePanel ID="upAttachments" UpdateMode="Conditional" ChildrenAsTriggers="true" runat="server"> <ContentTemplate> <asp:LinkButton ID="lnkRemoveAttachment" runat="server"><img src="/images/icons/trashcan.png" style="border: none;" /></asp:LinkButton> </ContentTemplate> </asp:UpdatePanel> </ContentTemplate> </uc1:TestModal>

  Read the article

• How to clone a Model using Entity Framework and ASP.Net Mvc 2

  - by Picflight

  I have the following class: [MetadataType(typeof(PortalMetaData))] [System.Web.Mvc.Bind(Exclude = "PortalId")] public partial class Portal { public Portal() { this.Created = DateTime.Now; } } public class PortalMetaData { [Required(ErrorMessage = "Portal name is required")] [StringLength(50, ErrorMessage = "Portal name must be under 50 characters")] public object PortalName { get; set; } [Required(ErrorMessage = "Description is required")] public object Description { get; set; } } I have a corresponding Table in the database Portal I use the Portal table with a PortalController for the Site Admin to update the records in the Portal Table. I want another user with a different Role (AsstAdmin) to be able to update this table as well. To facilitate that I am thinking of creating a separate partial class that somehow links back to the Portal Model. This would allow me to display limited Fields for update by the AsstAdmin and I can display a different name for the Field as well. How can I accomplish this task? If I add the following class which inherits from Portal than I get an exception: Unable to cast object of type 'Project1.Mvc.Models.Portal' to type 'Prpject1.Mvc.Models.Site'. [MetadataType(typeof(SiteMetaData))] public class Site : Portal { public Site() { } } public class SiteMetaData { [Required(DisplayName = "Site Description")] public object Description { get; set; } }

  Read the article

• Ajax actionlinks straight from a DropDownList

  - by Ingó Vals

  I've got a small linkbox on the side of my page that is rendered as a PartialView. In it I have a dropDownlist the should change the routing value of the links in the box but I'm having difficulty doing so. My current plan is to call on something similar to a Ajax.ActionLink to reload the partial view into the with a different parameter based on the value of the dropdown selection. However I'm having multiple problems with this, for example as a novice in using dropdownlists I have no idea how to call on the selected value for example. <%= Html.DropDownList("DropDownList1", new SelectList(Model, "ID", "Name"), "--Pick--", new { AutoPostBack = "true", onchange = "maybe something here" })%> I tried putting in the sys.mvc.AsyncHyperlink into the onchange attribute and that worked except I don't know how to put in the route value for it. Sys.Mvc.AsyncHyperlink.handleClick(this, new Sys.UI.DomEvent(event), { insertionMode: Sys.Mvc.InsertionMode.replace, updateTargetId: 'SmallMenu' } Is there no straight Ajax drop down list that fires events onchange? Any way this is possible? I have later in the Partial view the Ajax actionlinks but they need to have their id's updated by the value in the dropdownlist and if I could do that somehow else I would appreciate a suggestion.

  Read the article

• Primefaces, JavaScript, and JSF does not work well together or am I doing something wrong

  - by Harry Pham

  Here is something so simple <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <input id="tom"/> When u click on the Tom, the textbox get focus. Great, now try this <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <h:inputText id="tom"/> <br/> when I click nothing happen, I check firebug, I see document.getElementById("tom") is null When I try to use jQuery $('#tom').focus(), nothing happen, no error, but did not get focus either. This is the response (not sure if this is the response from the server) when I see from firebug <?xml version="1.0" encoding="utf-8"?> <partial-response> <changes> <update id="javax.faces.ViewState"><![CDATA[455334589763307998:-2971181471269134244]]></update> </changes> <extension primefacesCallbackParam="validationFailed">{"validationFailed":false}</extension> </partial-response>

  Read the article

• Problem with custom Equality in Entity Framework

  - by Shimmy

  Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

  Read the article

• Automatic INotifyPropertyChanged Implementation through T4 code generation?

  - by chrischu

  I'm currently working on setting up a new project of mine and was wondering how I could achieve that my ViewModel classes do have INotifyPropertyChanged support while not having to handcode all the properties myself. I looked into AOP frameworks but I think they would just blow up my project with another dependency. So I thought about generating the property implementations with T4. The setup would be this: I have a ViewModel class that declares just its Properties background variables and then I use T4 to generate the Property Implementations from it. For example this would be my ViewModel: public partial class ViewModel { private string p_SomeProperty; } Then T4 would go over the source file and look for member declarations named "p_" and generate a file like this: public partial class ViewModel { public string SomeProperty { get { return p_SomeProperty; } set { p_SomeProperty= value; NotifyPropertyChanged("SomeProperty"); } } } This approach has some advantages but I'm not sure if it can really work. So I wanted to post my idea here on StackOverflow as a question to get some feedback on it and maybe some advice how it can be done better/easier/safer.

  Read the article

• ASP.NET MVC 2 validation LINQ to SQL

  - by Chino

  Currently I have a DataModel object which contains my linq to sql classes(a dmbl file). Currently I use a partial class to validate the incoming input. For example public partial class User : IEntity { public NameValueCollection CheckModel() { return GetRuleViolations(); } /// <summary> /// Method validates incoming data, by given rules in the if statement. /// </summary> /// <returns>NameValueCollection</returns> private NameValueCollection GetRuleViolations() { NameValueCollection errors = new NameValueCollection(); if (string.IsNullOrEmpty(Username)) errors.Add("Username", "A username is required"); // and so on return errors; } } Now what I want to try to do is add validation attributes to the fields. For example I want to try to add the required attribute to the field Username instead/in addtion of using the validation I currently have. My question is how can I achieve this because the dmbl file is auto generated. Or maybe it is not possible and should I use a different approach?

  Read the article

• entity framework POCO template in a n-tiers design question

  - by bryan

  HI all I was trying to follow the POCO Template walkthrough . And now I am having problems using it in n-tiers design. By following the article, I put my edmx model, and the template generated context.tt in my DAL project, and moved the generated model.tt entity classes to my Business Logic layer (BLL) project. By doing this, I could use those entities inside my BLL without referencing the DAL, I guess that is the idea of PI; without knowing anything about the data source. Now, I want to extend the entities (inside the model.tt) to perform some CUD action in the BLL project,so I added a new partial class same name as the one generated from template, public partial class Company { public static IEnumerable AllCompanies() { using(var context = new Entities()){ var q = from p in context.Companies select p; return q.ToList(); } } } however visual studio won't let me do that, and I think it was because the context.tt is in the DAL project, and the BLL project could not add a reference to the DAL project as DAL has already reference to the BLL. So I tried to added this class to the DAL and it compiled, but intelisense won't show up the BLL.Company.AllCompanies() in my web service method from my webservice project which has reference to my BLL project. What should I do now? I want to add CUD methods to the template generated entities in my BLL project, and call them in my web services from another project. I have been looking for this answer a few days already, and I really need some guides from here please. Bryan

  Read the article

• Rails 3 - yield return or callback won't call in view <%= yield(:sidebar) || render('shared/sidebar'

  - by rzar

  Hey folks, I'm migrating a Website from Rails 2 (latest) to Rails 3 (beta2). Testing with Ruby 1.9.1p378 and Ruby 1.9.2dev (2010-04-05 trunk 27225) Stuck in a situation, i don't know which part will work well. Suspect yield is the problem, but don't know exactly. In my Layout Files I use the following technique quite often: app/views/layouts/application.html.erb: <%= yield(:sidebar) || render('shared/sidebar') %> For Example the partial look like: app/views/shared/_sidebar.html.erb: <p>Default sidebar Content. Bla Bla</p> Now it is time for the key part! In any view, I want to create a content_for block (optional). This can contain a pice of HTML etc. example below. If this block is set, the pice HTML inside should render in application.html.erb. If not, Rails should render the Partial at shared/_sidebar.html.erb on the right hand side. app/views/books/index.html.erb: <% content_for :sidebar do %> <strong>You have to read REWORK, a book from 37signals!</strong> <% end %> So you've got the idea. Hopefully. This technique worked well in any Rails 2.x Application. Now, in Rails 3 (beta2) only the yield Part is working. || render('shared/sidebar') The or side will not process by rails or maybe ruby. Thanks for input and time!

  Read the article

• can't get jquery livequery to with an update panel

  - by Jeremy

  I have some basic html inside an asp.net update panel. Using livequery, I set up autocomplete, blur and keydown events so that they all continue to be wired up after the update panel does a partial page load. When the page initially loads, all the events work fine but after the update panel does a partial page reload, none of the events wired up with livequery continue to work. Are there known issues with livequery and update panels? Html: <asp:UpdatePanel ID="upData" runat="server" UpdateMode="Conditional"> <ContentTemplate> <asp:DataList ID="dlData" runat="server" DataSource='<%# this.Data %>' DataKeyField="ID"> <ItemTemplate> <table> <tr> <th class="required">Location</th> <td><asp:TextBox ID="txtFromLocation" MaxLength="10" CssClass="searchlocation fromlocation required" runat="server" Text='<%# Eval("FromLocation")%>'/><asp:RequiredFieldValidator ID="rvalFromLocation" runat="server" ControlToValidate="txtFromLocation" ValidationGroup="leg">*</asp:RequiredFieldValidator></td> </tr> </table> </ItemTemplate> </asp:DataList> </ContentTemplate> </asp:UpdatePanel> And then I have my javascript. Normally it has a bunch of other code, but I can reduce it down to this and still have the problem: $(document).ready(function() { $(".searchlocation").livequery(function() { $(this).keydown(function(event) {alert('test');}); }); });

  Read the article

• ASP.NET Content Web Form - content from placeholder disappears

  - by Naeem Sarfraz

  I'm attempting to set a class on the body tag in my asp.net site which uses a master page and content web forms. I simply want to be able to do this by adding a bodycssclass property (see below) to the content web form page directive. It works through the solution below but when i attempt to view Default.aspx the Content1 control loses its content. Any ideas why? Here is how I'm doing it. I have a master page with the following content: <%@ Master Language="C#" ... %> <html><head>...</head> <body id=ctlBody runat=server> <asp:ContentPlaceHolder ID="cphMain" runat="server" /> </body> </html> it's code behind looks like: public partial class Site : MasterPageBase { public override string BodyCssClass { get { return ctlBody.Attributes["class"]; } set { ctlBody.Attributes["class"] = value; } } } it inherits from: public abstract class MasterPageBase : MasterPage { public abstract string BodyCssClass { get; set; } } my default.aspx is defined as: <%@ Page Title="..." [master page definition etc..] bodycssclass="home" %> <asp:Content ID="Content1" ContentPlaceHolderID="cphMain" runat="server"> Some content </asp:Content> the code behind for this file looks like: public partial class Default : PageBase { ... } and it inherits from : public class PageBase : Page { public string BodyCssClass { get { MasterPageBase mpbCurrent = this.Master as MasterPageBase; return mpbCurrent.BodyCssClass; } set { MasterPageBase mpbCurrent = this.Master as MasterPageBase; mpbCurrent.BodyCssClass = value; } } }

  Read the article

• How to copy the shipping address to billing address

  - by Jerry

  Hi all I like to know if I can copy the shipping address to billing address. I got most of the parts done but I am not sure how to copy select menu (states) value to billing address. I really appreciate any helps. My code $(document).ready(function(){ Jquery $('#same').click(function(){ if($('#same').attr('checked')){ $('#bfName').val($('#fName').val()); $('#blName').val($('#lName').val()); $('#baddress1').val($('#address1').val()); $('#baddress2').val($('#address2').val()); $('#bcity').val($('#city').val()); alert(($('#state option:selected').val())); //not sure what to do here $('#bzip').val($('#zip').val()); }; }); Html <td><select name="state"> //shipping states......only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> <td><select name="bstate"> //billing state................only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> Thanks a lot!

  Read the article

• How can I render a list of objects using DisplayFor but from the controller in ASP.NET MVC?

  - by Darragh

  Here's the scenaio, I have an Employee object and a Company object which has a list of employees. I have Company.aspx which inherits from ViewPage<Company>. In Company.aspx I call Html.DisplayFor(m => m.Employees). I have an Employee.ascx partial view which inherits from ViewUserControl<Employee in my DisplayTemplates folder. Everything works fine and Company.aspx renders the Employee.ascx partial for each employee. Now I have two additional methods on my controller called GetEmployees and GetEmployee(Id). In the GetEmployee(Id) action I want to return the markup to display this one employee, and in GetEmployees() I want to render the markup to display all the employees (these two action methods will be called via AJAX). In the GetEmployee action I call return PartialView("DisplayTemplates\Employee", employee) This works, although I'd prefer something like return PartialViewFor(employee) which would determine the view name by convention. Anwyay, my question is how should I implement the GetEmployees() action? I don't want to create any more views, because frankly, I don't see why I should have to. I've tried the following which fails miserably :) return Content(New HtmlHelper<IList<Of DebtDto>>(null, null).DisplayFor(m => debts)); However if I could create an instance of an HtmlHelper object in my controller, I suppose I could get it to work, but it feels wrong. Any ideas? Have i missed something obvious?

  Read the article

• Ajax.BeginForm driving me crazy

  - by Fabio Milheiro

  ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

  Read the article

• WPF binding fails with custom add and remove accessors for INotifyPropertyChanged.PropertyChanged

  - by emddudley

  I have a scenario which is causing strange behavior with WPF data binding and INotifyPropertyChanged. I want a private member of the data binding source to handle the INotifyPropertyChanged.PropertyChanged event. I get some exceptions which haven't helped me debug, even when I have "Enable .NET Framework source stepping" checked in Visual Studio's options: A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.InvalidOperationException' occurred in PresentationCore.dll Here's the source code: XAML <Window xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="TestApplication.MainWindow" DataContext="{Binding RelativeSource={RelativeSource Self}}" Height="100" Width="100"> <StackPanel> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="A" /> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="B" /> </StackPanel> </Window> Normal implementation works public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; public MainWindow() { InitializeComponent(); } } Desired implementation doesn't work public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged { add { lock (this.mHandler) { this.mHandler.PropertyChanged += value; } } remove { lock (this.mHandler) { this.mHandler.PropertyChanged -= value; } } } public bool CheckboxIsChecked { get { return this.mHandler.CheckboxIsChecked; } set { this.mHandler.CheckboxIsChecked = value; } } private HandlesPropertyChangeEvents mHandler = new HandlesPropertyChangeEvents(); public MainWindow() { InitializeComponent(); } public class HandlesPropertyChangeEvents : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; } }

  Read the article

• Rails 3.2 Ajax Update Div when Text Field Populated

  - by ctilley79

  In the end I would like a text field that passes a client_id to the partial. I would like to do this asynchronously so the shipment_products partial would dynamically change when the textfield value was updated. What is the best way to do this? In index.html.erb <!-- Text Field Here--> <div id="available_products"> <%= render "shipment_products" %> </div> In _shipment_products.html.erb <div id="shipment_products_container"> <h3>Assign Products to Ship<\h3> <ul class="shipment_products" id="shipment_products"> <% Product.by_client(client_id).each do |product|%> <!-- TextField value passed here --> <%= content_tag_for :li, product, :value => product.id do %> <%= hidden_field_tag("shipment[product_ids][]", product.id) %> <%= product.product_name %> <% end %> <% end %> <\ul> </div> This is similar to what I want in the end.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

< Previous Page | 47 48 49 50 51 52 53 54 55 56 57 58  | Next Page >