Search Results

Search found 13788 results on 552 pages for 'instance caging'.

Page 510/552 | < Previous Page | 506 507 508 509 510 511 512 513 514 515 516 517  | Next Page >

  • Perl: Compare and edit underlying structure in hash

    - by Mahfuzur Rahman Pallab
    I have a hash of complex structure and I want to perform a search and replace. The first hash is like the following: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"], 456 => ["as", "sd", "df"] }, mno => { 987 => ["lk", "dm", "sd"] }, } and I want to iteratively search for all '123'/'456' elements, and if a match is found, I need to do a comparison of the sublayer, i.e. of ['ab','cd','ef'] and ['as','sd','df'] and in this case, keep only the one with ['ab','cd','ef']. So the output will be as follows: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"] }, mno => { 987 => ["lk", "dm", "sd"] }, } So the deletion is based on the substructure, and not index. How can it be done? Thanks for the help!! Lets assume that I will declare the values to be kept, i.e. I will keep 456 = ["ab", "cd", "ef"] based on a predeclared value of ["ab", "cd", "ef"] and delete any other instance of 456 anywhere else. The search has to be for every key. so the code will go through the hash, first taking 123 = ["xx", "yy", "zy"] and compare it against itself throughout the rest of the hash, if no match is found, do nothing. If a match is found, like in the case of 456 = ["ab", "cd", "ef"], it will compare the two, and as I have said that in case of a match the one with ["ab", "cd", "ef"] would be kept, it will keep 456 = ["ab", "cd", "ef"] and discard any other instances of 456 anywhere else in the hash, i.e. it will delete 456 = ["as", "sd", "df"] in this case.

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • XML pass values to timer, AS3

    - by VideoDnd
    My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

    Read the article

  • IOC/Autofac problem

    - by Krazzy
    I am currently using Autofac, but am open to commentary regarding other IOC containers as well. I would prefer a solution using Autofac if possible. I am also somewhat new to IOC so I may be grossly misunderstanding what I should be using an IOC container for. Basically, the situation is as follows: I have a topmost IOC container for my app. I have a tree of child containers/scopes where I would like the same "service" (IWhatever) to resolve differently depending on which level in the tree it is resolved. Furthermore if a service is not registered at some level in the tree I would like the tree to be transversed upward until a suitable implementation is found. Furthermore, when constructing a given component, it is quite possible that I will need access to the parent container/scope. In many cases the component that I'm registering will have a dependency on the same or a different service in a parent scope. Is there any way to express this dependency with Autofac? Something like: builder.Register(c=> { var parentComponent = ?.Resolve<ISomeService>(); var childComponent = new ConcreteService(parentComponent, args...); return childComponent; }).As<ISomeService>(); I can't get anything similar to the above pseudocode to work for serveral reasons: A) It seems that all levels in the scope tree share a common set of registrations. I can't seem to find a way to make a given registration confined a certain "scope". B) I can't seem to find a way to get a hold of the parent scope of a given scope. I CAN resolve ILifetimeScope in the container and then case it to a concrete LifetimeScope instance which provides its parent scope, but I'm guessing it is probably note meant to be used this way. Is this safe? C) I'm not sure how to tell Autofac which container owns the resolved object. For many components I would like component to be "owned" by the scope in which it is constructed. Could tagged contexts help me here? Would I have to tag every level of the tree with a unique tag? This would be difficult because the tree depth is determined at runtime. Sorry for the extremely lengthy question. In summary: 1) Is there any way to do what I want to do using Autofac? 2) Is there another container more suited to this kind of dependency structure? 3) Is IOC the wrong tool for this altogether?

    Read the article

  • Help with listView in Android

    - by jul
    Hi, I'm just starting with Android and can't find how to display a list in my activity. I get some restaurant data from a web service and I'd like to show the results in a list. The activity, the restaurant class and the layout main.xml are shown below. How can I display, for instance, the list of the restaurant names in the ListView 'list' of my layout? thank you Jul public class Atable extends ListActivity { RestaurantList restaurantList; public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); //Here I set restaurantList //Now how can I display, for example, the list of the names of the restaurants } main.xml <LinearLayout android:orientation="horizontal" android:layout_width="fill_parent" android:layout_height="wrap_content"> <TextView android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/search" /> <EditText android:id="@+id/search" android:layout_width="wrap_content" android:layout_height="wrap_content" android:layout_weight="1"/> </LinearLayout> <LinearLayout android:orientation="vertical" android:layout_width="wrap_content" android:layout_height="wrap_content"> <ListView android:id="@+id/android:list" android:layout_width="wrap_content" android:layout_height="wrap_content"/> <TextView android:id="@+id/android:empty" android:layout_width="wrap_content" android:layout_height="wrap_content" android:text="@string/noresults"/> </LinearLayout> </LinearLayout> Restaurant list class package org.digitalfarm.atable; import java.util.List; public class RestaurantList { private List<Restaurant> restaurants; public List<Restaurant> getRestaurants() { return restaurants; } public void setRestaurants(List<Restaurant> restaurants) { this.restaurants = restaurants; } } Restaurant class package org.digitalfarm.atable; public class Restaurant { private String name; private float latitude; private float longitude; public String getName() { return name; } public void setName(String name) { this.name = name; } public float getLatitude() { return latitude; } public void setLatitude(float latitude) { this.latitude = latitude; } public float getLongitude() { return longitude; } public void setLongitude(float longitude) { this.longitude = longitude; } }

    Read the article

  • Using Core Data Concurrently and Reliably

    - by John Topley
    I'm building my first iOS app, which in theory should be pretty straightforward but I'm having difficulty making it sufficiently bulletproof for me to feel confident submitting it to the App Store. Briefly, the main screen has a table view, upon selecting a row it segues to another table view that displays information relevant for the selected row in a master-detail fashion. The underlying data is retrieved as JSON data from a web service once a day and then cached in a Core Data store. The data previous to that day is deleted to stop the SQLite database file from growing indefinitely. All data persistence operations are performed using Core Data, with an NSFetchedResultsController underpinning the detail table view. The problem I am seeing is that if you switch quickly between the master and detail screens several times whilst fresh data is being retrieved, parsed and saved, the app freezes or crashes completely. There seems to be some sort of race condition, maybe due to Core Data importing data in the background whilst the main thread is trying to perform a fetch, but I'm speculating. I've had trouble capturing any meaningful crash information, usually it's a SIGSEGV deep in the Core Data stack. The table below shows the actual order of events that happen when the detail table view controller is loaded: Main Thread Background Thread viewDidLoad Get JSON data (using AFNetworking) Create child NSManagedObjectContext (MOC) Parse JSON data Insert managed objects in child MOC Save child MOC Post import completion notification Receive import completion notification Save parent MOC Perform fetch and reload table view Delete old managed objects in child MOC Save child MOC Post deletion completion notification Receive deletion completion notification Save parent MOC Once the AFNetworking completion block is triggered when the JSON data has arrived, a nested NSManagedObjectContext is created and passed to an "importer" object that parses the JSON data and saves the objects to the Core Data store. The importer executes using the new performBlock method introduced in iOS 5: NSManagedObjectContext *child = [[NSManagedObjectContext alloc] initWithConcurrencyType:NSPrivateQueueConcurrencyType]; [child setParentContext:self.managedObjectContext]; [child performBlock:^{ // Create importer instance, passing it the child MOC... }]; The importer object observes its own MOC's NSManagedObjectContextDidSaveNotification and then posts its own notification which is observed by the detail table view controller. When this notification is posted the table view controller performs a save on its own (parent) MOC. I use the same basic pattern with a "deleter" object for deleting the old data after the new data for the day has been imported. This occurs asynchronously after the new data has been fetched by the fetched results controller and the detail table view has been reloaded. One thing I am not doing is observing any merge notifications or locking any of the managed object contexts or the persistent store coordinator. Is this something I should be doing? I'm a bit unsure how to architect this all correctly so would appreciate any advice.

    Read the article

  • VB.NET looping through XML to store in singleton

    - by rockinthesixstring
    I'm having a problem with looping through an XML file and storing the value in a singleton My XML looks like this <values> <value></value> <value>$1</value> <value>$5,000</value> <value>$10,000</value> <value>$15,000</value> <value>$25,000</value> <value>$50,000</value> <value>$75,000</value> <value>$100,000</value> <value>$250,000</value> <value>$500,000</value> <value>$750,000</value> <value>$1,000,000</value> <value>$1,250,000</value> <value>$1,500,000</value> <value>$1,750,000</value> <value>$2,000,000</value> <value>$2,500,000</value> <value>$3,000,000</value> <value>$4,000,000</value> <value>$5,000,000</value> <value>$7,500,000</value> <value>$10,000,000</value> <value>$15,000,000</value> <value>$25,000,000</value> <value>$50,000,000</value> <value>$100,000,000</value> <value>$100,000,000+</value> </values> And my function looks like this Public Class LoadValues Private Shared SearchValuesInstance As List(Of SearchValues) = Nothing Public Shared ReadOnly Property LoadSearchValues As List(Of SearchValues) Get Dim sv As New List(Of SearchValues) If SearchValuesInstance Is Nothing Then Dim objDoc As XmlDocument = New XmlDataDocument Dim objRdr As XmlTextReader = New XmlTextReader(HttpContext.Current.Server.MapPath("~/App_Data/Search-Values.xml")) objRdr.Read() objDoc.Load(objRdr) Dim root As XmlElement = objDoc.DocumentElement Dim itemNodes As XmlNodeList = root.SelectNodes("/values") For Each n As XmlNode In itemNodes sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) Next SearchValuesInstance = sv Else : sv = SearchValuesInstance End If Return sv End Get End Property End Class My problem is that I'm getting an object not set to an instance of an object on the sv.Add(New SearchValues(n("@value").InnerText, n("@value").InnerText)) line.

    Read the article

  • Find a base case for a recursive void method

    - by Evan S
    I am doing homework. I would like to build a base case for a recursion where ordering given numbers (list2) in ascending order. Purpose of writing this codes is that when all numbers are in ascending order then should stop calling a method called ascending(list2, list1); and all values in list2 should be shipped to list1. For instance, list2 = 6,5,4,3,2,1 then list2 becomes empty and list1 should be 1,2,3,4,5,6. I am trying to compare result with previous one and if matches then stop. But I can't find the base case to stop it. In addition, Both ascending() and fixedPoint() are void method. Anybody has idea? lol Took me 3 days... When I run my code then 6,5,4,3,2,1 5,6,4,3,2,1 4,5,6,3,2,1 3,4,5,6,2,1 2,3,4,5,6,1 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 infinite............. public class Flipper { public static void main(String[] args) { Flipper aFlipper = new Flipper(); List<Integer> content = Arrays.asList(6,5,4,3,2,1); ArrayList<Integer> l1 = new ArrayList<Integer>(content); ArrayList<Integer> l2 = new ArrayList<Integer>(); // empty list aFlipper.fixedPoint(l2,l1); System.out.println("fix l1 is "+l1); System.out.println("fix l2 is "+l2); } public void fixedPoint(ArrayList<Integer> list1, ArrayList<Integer> list2) { // data is in list2 ArrayList<Integer> temp1 = new ArrayList<Integer>(); // empty list if (temp1.equals(list2)) { System.out.println("found!!!"); } else { ascending(list2, list1); // data, null temp1 = list1; // store processed value System.out.println("st list1 is "+list1); System.out.println("st list2 is "+list2); } fixedPoint(list2, list1); // null, processed data }

    Read the article

  • Voicexml how to store input into a global variable

    - by Tyzak
    Hello, I'm creating a voicexml appliacation. I want to store an user input into a global variable. I wondered, the input should be stored in the fieldvar. shouldn't it? After I tried it with this, i tried to store it in an global variable: <assign name="myvar" expr="'myinput'"/> but somehow it didn't work. I used value expr="var" as expr. <?xml version="1.0" encoding="UTF-8"?> <vxml xmlns="http://www.w3.org/2001/vxml" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.w3.org/2001/vxml http://www.w3.org/TR/voicexml20/vxml.xsd" version="2.0"> <var name="myProdukt" /> <form id="test"> <field name="var"> <prompt bargein="true" bargeintype="hotword" >Sagen Sie ein Produkt</prompt> <grammar root="main" version="1.0" xml:lang="de-DE"> <rule id="main" scope="public"> <one-of> <item> p1 </item> <item> p2 </item> <item> p3 </item> <item> p4 </item> </one-of> </rule> </grammar> <filled> <assign name="myProdukt" expr="<value expr="var"/>"/> </filled> </field> </form> <<!--[...] Here i want to use the input.--> </vxml> thanks in advance

    Read the article

  • SQL Invalid Object Name 'AddressType'

    - by salvationishere
    I am getting the above error in my VS 2008 C# method when I try to invoke the SQL getColumnNames stored procedure from VS. This SP accepts one input parameter, the table name, and works successfully from SSMS. Currently I am selecting the AdventureWorks AddressType table for it to pull the column names from this table. I can see teh AdventureWorks table available in VS from my Server Explorer / Data Connection. And I see both the AddressType table and getColumnNames SP showing in Server Explorer. But I am still getting this error listed above. Here is the C# code snippet I use to execute this: public static DataTable DisplayTableColumns(string tt) { SqlDataReader dr = null; string TableName = tt; string connString = "Data Source=.;AttachDbFilename=\"C:\Program Files\Microsoft SQL Server\MSSQL10.MSSQLSERVER\MSSQL\DATA\AdventureWorks_Data.mdf\";Initial Catalog=AdventureWorks;Integrated Security=True;Connect Timeout=30;User Instance=False"; string errorMsg; SqlConnection conn2 = new SqlConnection(connString); SqlCommand cmd = conn2.CreateCommand(); try { cmd.CommandText = "dbo.getColumnNames"; cmd.CommandType = CommandType.StoredProcedure; cmd.Connection = conn2; SqlParameter parm = new SqlParameter("@TableName", SqlDbType.VarChar); parm.Value = TableName; parm.Direction = ParameterDirection.Input; cmd.Parameters.Add(parm); conn2.Open(); dr = cmd.ExecuteReader(); } catch (Exception ex) { errorMsg = ex.Message; } And when I examine the errorMsg it says the following: " at System.Data.SqlClient.SqlConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.SqlInternalConnection.OnError(SqlException exception, Boolean breakConnection)\r\n at System.Data.SqlClient.TdsParser.ThrowExceptionAndWarning(TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.TdsParser.Run(RunBehavior runBehavior, SqlCommand cmdHandler, SqlDataReader dataStream, BulkCopySimpleResultSet bulkCopyHandler, TdsParserStateObject stateObj)\r\n at System.Data.SqlClient.SqlDataReader.ConsumeMetaData()\r\n at System.Data.SqlClient.SqlDataReader.get_MetaData()\r\n at System.Data.SqlClient.SqlCommand.FinishExecuteReader(SqlDataReader ds, RunBehavior runBehavior, String resetOptionsString)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result)\r\n at System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method)\r\n at System.Data.SqlClient.SqlCommand.ExecuteReader()\r\n at ADONET_namespace.ADONET_methods.DisplayTableColumns(String tt) in C:\Documents and Settings\Admin\My Documents\Visual Studio 2008\Projects\AddFileToSQL\AddFileToSQL\ADONET methods.cs:line 35" Where line 35 is dr = cmd.ExecuteReader();

    Read the article

  • Stored procedure performance randomly plummets; trivial ALTER fixes it. Why?

    - by gWiz
    I have a couple of stored procedures on SQL Server 2005 that I've noticed will suddenly take a significantly long time to complete when invoked from my ASP.NET MVC app running in an IIS6 web farm of four servers. Normal, expected completion time is less than a second; unexpected anomalous completion time is 25-45 seconds. The problem doesn't seem to ever correct itself. However, if I ALTER the stored procedure (even if I don't change anything in the procedure, except to perhaps add a space to the script created by SSMS Modify command), the completion time reverts to expected completion time. IIS and SQL Server are running on separate boxes, both running Windows Server 2003 R2 Enterprise Edition. SQL Server is Standard Edition. All machines have dual Xeon E5450 3GHz CPUs and 4GB RAM. SQL Server is accessed using its TCP/IP protocol over gigabit ethernet (not sure what physical medium). The problem is present from all web servers in the web farm. When I invoke the procedure from a query window in SSMS on my development machine, the procedure completes in normal time. This is strange because I was under the impression that SSMS used the same SqlClient driver as in .NET. When I point my development instance of the web app to the production database, I again get the anomalous long completion time. If my SqlCommand Timeout is too short, I get System.Data.SqlClient.SqlException: Timeout expired. The timeout period elapsed prior to completion of the operation or the server is not responding. Question: Why would performing ALTER on the stored procedure, without actually changing anything in it, restore the completion time to less than a second, as expected? Edit: To clarify, when the procedure is running slow for the app, it simultaneously runs fine in SSMS with the same parameters. The only difference I can discern is login credentials (next time I notice the behavior, I'll be checking from SSMS with the same creds). The ultimate goal is to get the procs to sustainably run with expected speed without requiring occasional intervention. Resolution: I wanted to to update this question in case others are experiencing this issue. Following the leads of the answers below, I was able to consistently reproduce this behavior. In order to test, I utilize sp_recompile and pass it one of the susceptible sprocs. I then initiate a website request from my browser that will invoke the sproc with atypical parameters. Lastly, I initiate a website request to a page that invokes the sproc with typical parameters, and observe that the request does not complete because of a SQL timeout on the sproc invocation. To resolve this on SQL Server 2005, I've added OPTIMIZE FOR hints to my SELECT. The sprocs that were vulnerable all have the "all-in-one" pattern described in this article. This pattern is certainly not ideal but was a necessary trade-off given the timeframe for the project.

    Read the article

  • Windows phone app xaml error

    - by thewarri0r9
    i am developing an app for windows phone 8 and i stuck on this code which visual studio showing invalid xaml. But Code compiles and works well. Invalid xaml Code is : <DataTemplate x:Key="AddrBookItemTemplate"> <StackPanel Margin="0,0,0,2" Orientation="Horizontal"> <StackPanel Width="80" Orientation="Horizontal" Height="80"> <Ellipse Margin="0" Height="70" Width="70" HorizontalAlignment="Left" Stroke="{x:Null}"> <Ellipse.Fill> <ImageBrush Stretch="Fill" ImageSource="{Binding imageBytes, Converter={StaticResource BytesToImageConverter}}"/> </Ellipse.Fill> </Ellipse> </StackPanel> <StackPanel Height="80" Margin="0" Width="380" HorizontalAlignment="Left"> <TextBlock FontWeight="Bold" Text="{Binding FirstName}" FontFamily="Segoe WP Semibold" FontSize="30" VerticalAlignment="Top" Margin="5,0,0,0" HorizontalAlignment="Left" /> <TextBlock Text="{Binding Phone}" FontFamily="Segoe WP" FontSize="24" Foreground="{StaticResource PhoneTextBoxReadOnlyBrush}" Margin="5,0,0,-12" Width="320" HorizontalAlignment="Left" VerticalAlignment="Top"/> </StackPanel> </StackPanel> </DataTemplate> I am serializing image by converting it to byte, it works fine but if image is null it gives an error. code behind: if (e.Results != null) { List<AddressBook> source = new List<AddressBook>(); foreach (var result in e.Results) { if (result.PhoneNumbers.FirstOrDefault() != null && result.GetPicture()!=null) { BitmapImage bmp = new BitmapImage(); BitmapImage nullbmp = new BitmapImage(); if (result.GetPicture() == null) { bmp.UriSource = new Uri(@"/Images/ci2.png", UriKind.RelativeOrAbsolute); } else { bmp.SetSource(result.GetPicture()); } listobj.Add(new AddressBook() { FirstName = result.DisplayName != null ? result.DisplayName : "", imageBytes = AddressBook.imageConvert(bmp), EmailAddress = "", LastName = "", Phone = result.PhoneNumbers.FirstOrDefault() != null ? result.PhoneNumbers.FirstOrDefault().PhoneNumber : "", }); } } Above code show an error "object reference not set to instance of an object". I want to show the default image (or color) in ellipse when image is null.What should I do?

    Read the article

  • Is there a way to enforce/preserve order of XML elements in an XML Schema?

    - by MarcoS
    Let's consider the following XML Schema: <?xml version="1.0" encoding="UTF-8"?> <schema targetNamespace="http://www.example.org/library" elementFormDefault="qualified" xmlns="http://www.w3.org/2001/XMLSchema" xmlns:lib="http://www.example.org/library"> <element name="library" type="lib:libraryType"></element> <complexType name="libraryType"> <sequence> <element name="books" type="lib:booksType"></element> </sequence> </complexType> <complexType name="booksType"> <sequence> <element name="book" type="lib:bookType" maxOccurs="unbounded" minOccurs="1"></element> </sequence> </complexType> <complexType name="bookType"> <attribute name="title" type="string"></attribute> </complexType> </schema> and a corresponding XML example: <?xml version="1.0" encoding="UTF-8"?> <lib:library xmlns:lib="http://www.example.org/library" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.example.org/library src/library.xsd "> <lib:books> <lib:book title="t1"/> <lib:book title="t2"/> <lib:book title="t3"/> </lib:books> </lib:library> Is there a way to guarantee that the order of <lib:book .../> elements is preserved? I want to be sure that any parser reading the XML will return books in the specified oder, that is first the book with title="t1", then the book with title="t2", and finally the book with title="t3". As far as I know XML parsers are not required to preserve order. I wonder whether one can enforce this through XML Schema? One quick solution for me would be adding an index attribute to the <lib:book .../> element, and delegate order preservation to the application reading the XML. Comments? Suggestions?

    Read the article

  • How to dispose off custom object from within custom membership provider

    - by IrfanRaza
    I have created my custom MembershipProvider. I have used an instance of the class DBConnect within this provider to handle database functions. Please look at the code below: public class SGIMembershipProvider : MembershipProvider { #region "[ Property Variables ]" private int newPasswordLength = 8; private string connectionString; private string applicationName; private bool enablePasswordReset; private bool enablePasswordRetrieval; private bool requiresQuestionAndAnswer; private bool requiresUniqueEmail; private int maxInvalidPasswordAttempts; private int passwordAttemptWindow; private MembershipPasswordFormat passwordFormat; private int minRequiredNonAlphanumericCharacters; private int minRequiredPasswordLength; private string passwordStrengthRegularExpression; private MachineKeySection machineKey; **private DBConnect dbConn;** #endregion ....... public override bool ChangePassword(string username, string oldPassword, string newPassword) { if (!ValidateUser(username, oldPassword)) return false; ValidatePasswordEventArgs args = new ValidatePasswordEventArgs(username, newPassword, true); OnValidatingPassword(args); if (args.Cancel) { if (args.FailureInformation != null) { throw args.FailureInformation; } else { throw new Exception("Change password canceled due to new password validation failure."); } } SqlParameter[] p = new SqlParameter[3]; p[0] = new SqlParameter("@applicationName", applicationName); p[1] = new SqlParameter("@username", username); p[2] = new SqlParameter("@password", EncodePassword(newPassword)); bool retval = **dbConn.ExecuteSP("User_ChangePassword", p);** return retval; } //ChangePassword public override void Initialize(string name, NameValueCollection config) { if (config == null) { throw new ArgumentNullException("config"); } ...... ConnectionStringSettings ConnectionStringSettings = ConfigurationManager.ConnectionStrings[config["connectionStringName"]]; if ((ConnectionStringSettings == null) || (ConnectionStringSettings.ConnectionString.Trim() == String.Empty)) { throw new ProviderException("Connection string cannot be blank."); } connectionString = ConnectionStringSettings.ConnectionString; **dbConn = new DBConnect(connectionString); dbConn.ConnectToDB();** ...... } //Initialize ...... } // SGIMembershipProvider I have instantiated dbConn object within Initialize() event. My problem is that how could i dispose off this object when object of SGIMembershipProvider is disposed off. I know the GC will do this all for me, but I need to explicitly dispose off that object. Even I tried to override Finalize() but there is no such overridable method. I have also tried to create destructor for SGIMembershipProvider. Can anyone provide me solution.

    Read the article

  • vector related memory allocation question

    - by memC
    hi all, I am encountering the following bug. I have a class Foo . Instances of this class are stored in a std::vector vec of class B. in class Foo, I am creating an instance of class A by allocating memory using new and deleting that object in ~Foo(). the code compiles, but I get a crash at the runtime. If I disable delete my_a from desstructor of class Foo. The code runs fine (but there is going to be a memory leak). Could someone please explain what is going wrong here and suggest a fix? thank you! class A{ public: A(int val); ~A(){}; int val_a; }; A::A(int val){ val_a = val; }; class Foo { public: Foo(); ~Foo(); void createA(); A* my_a; }; Foo::Foo(){ createA(); }; void Foo::createA(){ my_a = new A(20); }; Foo::~Foo(){ delete my_a; }; class B { public: vector<Foo> vec; void createFoo(); B(){}; ~B(){}; }; void B::createFoo(){ vec.push_back(Foo()); }; int main(){ B b; int i =0; for (i = 0; i < 5; i ++){ std::cout<<"\n creating Foo"; b.createFoo(); std::cout<<"\n Foo created"; } std::cout<<"\nDone with Foo creation"; std::cout << "\nPress RETURN to continue..."; std::cin.get(); return 0; }

    Read the article

  • Thinking about introducing PHP/MySQL into a .NET/SQL Server environment. Thoughts?

    - by abszero
    I posted this over at reddit but it didn't gain any momentum. So here is what is going on: our company was recently purchased by another web shop and I was promoted to head of development here in our office. Our office is completely .NET/SQL Server and the company who purchased us is a *nix/PHP/MySQL shop. Now several of our large clients who are on the .NET platform are up for complete rewrites (the sites are from '04 and are running on the 1.x framework.) While reviewing the proposal for one client with my superior I came across a pretty extensive module which would require several hundred man hours to complete and voiced some concern about it in relation to the quote. One of the guys from the PHP group happen to hear this and told me of a module that they (PHP Group) use in Drupal that does exactly what the proposal in front of me was describing and it only took, at most, 8 hours to completely setup / configure. My superior suggested that I take a look at Drupal and the module in question over the weekend but stressed that we should only go that route if it really made sense. So this weekend I spun up a CentOS instance in VirtualBox and started playing around with Drupal. I am still fleshing it out so don't have a solid opinion on it just yet. Anyway I have some questions / fears that I was hoping progit could help me out in! Has anyone had experience doing this and, if so, how did it turn out? I am completely ignorant to what IDE's (if any) are available to for PHP. The last time I worked with PHP it was in Notepad and that was less than intuitive. So is there are more intuitive IDE out there for PHP dev? I don't want to scare my .NET guys. Since the merger all of our new business clients that have had relatively small websites have gone on Drupal with the larger sites going on .NET. My concern is that if they see a large site go onto Drupal that they might start getting anxious and start handing out their resumes. For the foreseeable future there are no plans to liquidate the .NET platform and really we can't just from a support standpoint. What would be the best way to approach this? Any other helpful info? Thanks!

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • What is a good generic sibling control Javascript communication strategy?

    - by James
    I'm building a webpage that is composed of several controls, and trying to come up with an effective somewhat generic client side sibling control communication model. One of the controls is the menu control. Whenever an item is clicked in here I wanted to expose a custom client side event that other controls can subscribe to, so that I can achieve a loosely coupled sibling control communication model. To that end I've created a simple Javascript event collection class (code below) that acts as like a hub for control event registration and event subscription. This code certainly gets the job done, but my question is is there a better more elegant way to do this in terms of best practices or tools, or is this just a fools errand? /// Event collection object - acts as the hub for control communication. function ClientEventCollection() { this.ClientEvents = {}; this.RegisterEvent = _RegisterEvent; this.AttachToEvent = _AttachToEvent; this.FireEvent = _FireEvent; function _RegisterEvent(eventKey) { if (!this.ClientEvents[eventKey]) this.ClientEvents[eventKey] = []; } function _AttachToEvent(eventKey, handlerFunc) { if (this.ClientEvents[eventKey]) this.ClientEvents[eventKey][this.ClientEvents[eventKey].length] = handlerFunc; } function _FireEvent(eventKey, triggerId, contextData ) { if (this.ClientEvents[eventKey]) { for (var i = 0; i < this.ClientEvents[eventKey].length; i++) { var fn = this.ClientEvents[eventKey][i]; if (fn) fn(triggerId, contextData); } } } } // load new collection instance. var myClientEvents = new bsdClientEventCollection(); // register events specific to the control that owns it, this will be emitted by each respective control. myClientEvents.RegisterEvent("menu-item-clicked"); Here is the part where this code above is consumed by source and subscriber controls. // menu control $(document).ready(function() { $(".menu > a").click( function(event) { //event.preventDefault(); myClientEvents.FireEvent("menu-item-clicked", $(this).attr("id"), null); }); }); <div style="float: left;" class="menu"> <a id="1" href="#">Menu Item1</a><br /> <a id="2" href="#">Menu Item2</a><br /> <a id="3" href="#">Menu Item3</a><br /> <a id="4" href="#">Menu Item4</a><br /> </div> // event subscriber control $(document).ready(function() { myClientEvents.AttachToEvent("menu-item-clicked", menuItemChanged); myClientEvents.AttachToEvent("menu-item-clicked", menuItemChanged2); myClientEvents.AttachToEvent("menu-item-clicked", menuItemChanged3); }); function menuItemChanged(id, contextData) { alert('menuItemChanged ' + id); } function menuItemChanged2(id, contextData) { alert('menuItemChanged2 ' + id); } function menuItemChanged3(id, contextData) { alert('menuItemChanged3 ' + id); }

    Read the article

  • Absolute Xpath to get list of childnodes?

    - by Googler
    Hi this my xml file, <?xml version="1.0"?> <worldpatentdata xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <meta name="elapsed-time" value="329" xmlns="http://ops.epo.org"/> <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> </exchange-documents> </worldpatentdata> For the above xml file, i need the xpath to receive the childnodes below it: Output i need is : <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> I using Linq-Xml to get the following data: This is my Xpath and code: var list = doc1.XPathSelectElement("exchange-document"); I couldnt retreive the needed output.It returns null for the above code. Can anyone pls help on this by providing the correct xpath to retieve the child nodes. Else is there any other way to retrieve it.

    Read the article

  • Several client waiting for the same event

    - by ff8mania
    I'm developing a communication API to be used by a lot of generic clients to communicate with a proprietary system. This proprietary system exposes an API, and I use a particular classes to send and wait messages from this system: obviously the system alert me that a message is ready using an event. The event is named OnMessageArrived. My idea is to expose a simple SendSyncMessage(message) method that helps the user/client to simply send a message and the method returns the response. The client: using ( Communicator c = new Communicator() ) { response = c.SendSync(message); } The communicator class is done in this way: public class Communicator : IDisposable { // Proprietary system object ExternalSystem c; String currentRespone; Guid currentGUID; private readonly ManualResetEvent _manualResetEvent; private ManualResetEvent _manualResetEvent2; String systemName = "system"; String ServerName = "server"; public Communicator() { _manualResetEvent = new ManualResetEvent(false); //This methods are from the proprietary system API c = SystemInstance.CreateInstance(); c.Connect(systemName , ServerName); } private void ConnectionStarter( object data ) { c.OnMessageArrivedEvent += c_OnMessageArrivedEvent; _manualResetEvent.WaitOne(); c.OnMessageArrivedEvent-= c_OnMessageArrivedEvent; } public String SendSync( String Message ) { Thread _internalThread = new Thread(ConnectionStarter); _internalThread.Start(c); _manualResetEvent2 = new ManualResetEvent(false); String toRet; int messageID; currentGUID = Guid.NewGuid(); c.SendMessage(Message, "Request", currentGUID.ToString()); _manualResetEvent2.WaitOne(); toRet = currentRespone; return toRet; } void c_OnMessageArrivedEvent( int Id, string root, string guid, int TimeOut, out int ReturnCode ) { if ( !guid.Equals(currentGUID.ToString()) ) { _manualResetEvent2.Set(); ReturnCode = 0; return; } object newMessage; c.FetchMessage(Id, 7, out newMessage); currentRespone = newMessage.ToString(); ReturnCode = 0; _manualResetEvent2.Set(); } } I'm really noob in using waithandle, but my idea was to create an instance that sends the message and waits for an event. As soon as the event arrived, checks if the message is the one I expect (checking the unique guid), otherwise continues to wait for the next event. This because could be (and usually is in this way) a lot of clients working concurrently, and I want them to work parallel. As I implemented my stuff, at the moment if I run client 1, client 2 and client 3, client 2 starts sending message as soon as client 1 has finished, and client 3 as client 2 has finished: not what I'm trying to do. Can you help me to fix my code and get my target? Thanks!

    Read the article

  • Android database closed exception

    - by Bombastic
    I'm working on a project where I'm downloading and saving data from web to sqlite database. A few minutes ago I receive a strange exception to our server from a user which is saying that the sqlite database is already closed..and I just checked the whole file where the exception happened and I'm not calling dbHelper.close();. Here is the function where the app crashes and LogCat message : public void insertCollectionCountries(JSONObject obj, Context context) { //Insert in collection_countries if(RPCCommunicator.isServiceRunning){ Log.w("","JsonCollection - insertCollectionCountries"); ContentValues valuesCountries = new ContentValues(); try { collectionId = Integer.parseInt(obj.getString("collection_id")); dbHelper.deleteSQL("collection_countries", "collection_id=?", new String[] {Integer.toString(collectionId)}); JSONArray arrayCountries = obj.getJSONArray("country_availability"); for (int i=0; i<arrayCountries.length(); i++) { valuesCountries.put("collection_id", collectionId); String countryCode = arrayCountries.getString(i); valuesCountries.put("country_code", countryCode); dbHelper.executeQuery("collection_countries", valuesCountries); } } catch (JSONException e){ e.printStackTrace(); } } } and the error is on that line : dbHelper.executeQuery("collection_countries", valuesCountries); here is the LogCat message : java.lang.IllegalStateException: database /data/data/com.stampii.stampii/databases/stampii_sys_tpl.sqlite (conn# 0) already closed at android.database.sqlite.SQLiteDatabase.verifyDbIsOpen(SQLiteDatabase.java:2123) at android.database.sqlite.SQLiteDatabase.setTransactionSuccessful(SQLiteDatabase.java:734) at com.stampii.stampii.comm.rpc.SystemDatabaseHelper.execQuery(SystemDatabaseHelper.java:298) at com.stampii.stampii.comm.rpc.SystemDatabaseHelper.executeQuery(SystemDatabaseHelper.java:291) at com.stampii.stampii.jsonAPI.JsonCollection.insertCollectionCounries(JsonCollection.java:548) at com.stampii.stampii.jsonAPI.JsonCollection.executeInsert(JsonCollection.java:181) at com.stampii.stampii.collections.MyService.downloadCollections(MyService.java:122) at com.stampii.stampii.collections.MyService$2.run(MyService.java:74) at java.lang.Thread.run(Thread.java:1020) and function in my dbHelperClass which I'm using to insert data : public boolean executeQuery(String tableName,ContentValues values){ return execQuery(tableName,values); } private boolean execQuery(String tableName,ContentValues values){ sqliteDb = instance.getWritableDatabase(); sqliteDb.beginTransaction(); sqliteDb.insert(tableName, null, values); sqliteDb.setTransactionSuccessful(); sqliteDb.endTransaction(); return true; } Any ideas which can close my sqlite database or what can cause that exception, because I've tested this code on a few emulators with different Android versions, different devices (HTC EVO 3D, Samsung Galaxy Nexus,HTC Desire, LG OPTIMUS PAD, Samsung Galaxy S2, Samsung Galaxy Note) and it's working fine. Thanks in advance!

    Read the article

  • Java DriverManager Always Assigns My Driver

    - by JGB146
    I am writing a driver to act as a wrapper around two separate MySQL connections (to distributed databases). Basically, the goal is to enable interaction with my driver for all applications instead of requiring the application to sort out which database holds the desired data. Most of the code for this is in place, but I'm having a problem in that when I attempt to create connections via the MySQL Driver, the DriverManager is returning an instance of my driver instead of the MySQL Driver. I'd appreciate any tips on what could be causing this and what could be done to fix it! Below is a few relevant snippets of code. I can provide more, but there's a lot, so I'd need to know what else you want to see. First, from MyDriver.java: public MyDriver() throws SQLException { DriverManager.registerDriver(this); } public Connection connect(String url, Properties info) throws SQLException { try { return new MyConnection(info); } catch (Exception e) { return null; } } public boolean acceptsURL(String url) throws SQLException { if (url.contains("jdbc:jgb://")) { return true; } return false; } It is my understanding that this acceptsURL function will dictate whether or not the DriverManager deems my driver a suitable fit for a given URL. Hence it should only be passing connections from my driver if the URL contains "jdbc:jgb://" right? Here's code from MyConnection.java: Connection c1 = null; Connection c2 = null; /** *Constructors */ public DDBSConnection (Properties info) throws SQLException, Exception { info.list(System.out); //included for testing Class.forName("com.mysql.jdbc.Driver").newInstance(); String url1 = "jdbc:mysql://server1.com/jgb"; String url2 = "jdbc:mysql://server2.com/jgb"; this.c1 = DriverManager.getConnection( url1, info.getProperty("username"), info.getProperty("password")); this.c2 = DriverManager.getConnection( url2, info.getProperty("username"), info.getProperty("password")); } And this tells me two things. First, the info.list() call confirms that the correct user and password are being sent. Second, because we enter an infinite loop, we see that the DriverManager is providing new instances of my connection as matches for the mysql URLs instead of the desired mysql driver/connection. FWIW, I have separately tested implementations that go straight to the mysql driver using this exact syntax (al beit only one at a time), and was able to successfully interact with each database individually from a test application outside of my driver.

    Read the article

  • Calculate total time between Dates in Hours and Minutes

    - by matthew parkes
    Hi I’m trying to resolve a problem using VB and I need some assistance. I’m very new to the language (1 week). The problem is I have created a user form to show how many hours and minutes has elapsed between two different times similar to a time sheet. The user form consists of two calendars, and under each calendar there are two text boxes; one box each to record the Hour and Minute they left and two further boxes to record the time they arrived back. I have used the code to minus the calendars together (e.g calendar in – calendar out) then times this by 24 to indicate the hours away. Then under the calendar out I have a text box for the user to type in the hour they left. Then I minus the 24 by the Hour out e.g. if it was 24 -15 it will appear 9 ( 9 hours of that day ) then I would add that to the figure they inserted in the text box Hour in (Return Time). e.g 14. Then I would add them to together e.g. 9 + 14 = 23 and have this displayed in another text box Total Hours. Therefore it would display 23 meaning 23 hours. I have then want to show another two text boxes to indicate minutes. One for Minutes Out then Minutes In. I have the problem to convert these minutes for instance if it is the out time is 15:50 and the in time the next day is at 15:55 it displays as 24 (in one text box) and 105 minutes (in the other text box). I would like the minutes added to the hour and have the balance of the remaining minutes in the minute text box. This should display 24 (in one text box) and 5 (in another text box). The ultimate aim is to get a result that shows a person was absent for a number of days, hours and minutes, eg, 2 days, 5 hours and 10 minutes. Any ideas on how I can modify my code to achieve this? Here’s my code. Please Help Dim number1 As Date Dim number2 As Date Dim number3 As Integer Dim number4 As Integer Dim Number5 As Integer Dim Number6 As Integer Dim answer As Integer Dim answer2 As Integer Dim answer3 As Integer Dim answer4 As Integer Dim answer5 As String number1 = DTPicker1 number2 = DTPicker2 number3 = Txthourout number4 = TxtHourin Number5 = TxtMinuteout Number6 = TxtMinuetIn answer = number2 - number1 answer2 = answer * 24 answer3 = answer2 - number3 answer4 = answer3 + number4 answer5 = Number5 + Number6 TextBox1.Text = answer4 TextBox2.Text = answer5 End Sub

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 506 507 508 509 510 511 512 513 514 515 516 517  | Next Page >