Search Results

Search found 13788 results on 552 pages for 'instance'.

Page 511/552 | < Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to wait multiple function processing to finish

    - by user351412
    I have a problem about multiple function processing , listed as below code, the main function is btnEvalClick, I have try to use alter native 1and 2 to wait the function not move to next record before theprocessed function finish, but it does not work //private function btnEvalClick(event:Event):void { // var i:int; // for(i= 0; i < (dataArr1.length); i++) { // dispatchEvent( new FlexEvent('test') ); // callfunc1('cydatGMX'); //call function 1 // callfun2('cydatGMO'); //call function 1 // editSave(); //save record (HTTP) //## Alternative 1 //if (String(event) == 'SAVEOK') { // RecMov('next'); //move record if save = OK //} //## Alternative 2 //while (waitfc == '') // if waitfc not 'OK' continue looping //{ // z = z + 1; //} // RecMov('next'); //Move to next record to process //} //private function callfunc1(tasal:String):void { // var mySO :SharedObject; // var myDP: Array; // var i:int; // var prm:Array; // try // { // mySO = SharedObject.getLocal(tasal,'/'); // prm = mySO.data.txt.split('?'); // for(i=0; i < (prm.length - 1); i++) { // myDP = prm[i].toString().split('^'); // if ( myDP[0].toString() == String(dataArr1[dg].MatrixCDCol)){ // myDPX = myDP; // break; // } // } // } // catch (err:Error) { // Alert.show('Limit object creation fail (' + tasal + '), please retry ); // } //} //private function editSave():void //{ // var parameters:* = // { // 'CertID': CertIDCol.text, 'AssetID': AssetIDCol.text, 'CertDate': cdt, //'Ccatat': CcatatCol.text, 'CertBy': CertByCol.text, 'StatusID': StatusIDCol.text, //'UpdDate': lele, 'UpdUsr': ApplicationState.instance.luNm }; // doRequest('Update', parameters, saveItemHandler); //} //private function doRequest(method_name:String, parameters:Object, callback:Function):void // { // add the method to the parameters list // parameters['method'] = (method_name + 'ASC'); // gateway.request = parameters; // var call:AsyncToken = gateway.send(); // call.request_params = gateway.request; // call.handler = callback; // } //private function saveItemHandler(e:Object):void // { // if (e.isError) // { // Alert.show('Error: ' + e.data.error); // } // else // { // Alert.show('Record Saved..'); // waitfc = 'OK'; // dispatchEvent( new FlexEvent('SAVEOK') ); // } // }

    Read the article

  • Java DriverManager Always Assigns My Driver

    - by JGB146
    I am writing a driver to act as a wrapper around two separate MySQL connections (to distributed databases). Basically, the goal is to enable interaction with my driver for all applications instead of requiring the application to sort out which database holds the desired data. Most of the code for this is in place, but I'm having a problem in that when I attempt to create connections via the MySQL Driver, the DriverManager is returning an instance of my driver instead of the MySQL Driver. I'd appreciate any tips on what could be causing this and what could be done to fix it! Below is a few relevant snippets of code. I can provide more, but there's a lot, so I'd need to know what else you want to see. First, from MyDriver.java: public MyDriver() throws SQLException { DriverManager.registerDriver(this); } public Connection connect(String url, Properties info) throws SQLException { try { return new MyConnection(info); } catch (Exception e) { return null; } } public boolean acceptsURL(String url) throws SQLException { if (url.contains("jdbc:jgb://")) { return true; } return false; } It is my understanding that this acceptsURL function will dictate whether or not the DriverManager deems my driver a suitable fit for a given URL. Hence it should only be passing connections from my driver if the URL contains "jdbc:jgb://" right? Here's code from MyConnection.java: Connection c1 = null; Connection c2 = null; /** *Constructors */ public DDBSConnection (Properties info) throws SQLException, Exception { info.list(System.out); //included for testing Class.forName("com.mysql.jdbc.Driver").newInstance(); String url1 = "jdbc:mysql://server1.com/jgb"; String url2 = "jdbc:mysql://server2.com/jgb"; this.c1 = DriverManager.getConnection( url1, info.getProperty("username"), info.getProperty("password")); this.c2 = DriverManager.getConnection( url2, info.getProperty("username"), info.getProperty("password")); } And this tells me two things. First, the info.list() call confirms that the correct user and password are being sent. Second, because we enter an infinite loop, we see that the DriverManager is providing new instances of my connection as matches for the mysql URLs instead of the desired mysql driver/connection. FWIW, I have separately tested implementations that go straight to the mysql driver using this exact syntax (al beit only one at a time), and was able to successfully interact with each database individually from a test application outside of my driver.

    Read the article

  • Python: How best to parse a simple grammar?

    - by Rosarch
    Ok, so I've asked a bunch of smaller questions about this project, but I still don't have much confidence in the designs I'm coming up with, so I'm going to ask a question on a broader scale. I am parsing pre-requisite descriptions for a course catalog. The descriptions almost always follow a certain form, which makes me think I can parse most of them. From the text, I would like to generate a graph of course pre-requisite relationships. (That part will be easy, after I have parsed the data.) Some sample inputs and outputs: "CS 2110" => ("CS", 2110) # 0 "CS 2110 and INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, INFO 3300" => [("CS", 2110), ("INFO", 3300)] # 1 "CS 2110, 3300, 3140" => [("CS", 2110), ("CS", 3300), ("CS", 3140)] # 1 "CS 2110 or INFO 3300" => [[("CS", 2110)], [("INFO", 3300)]] # 2 "MATH 2210, 2230, 2310, or 2940" => [[("MATH", 2210), ("MATH", 2230), ("MATH", 2310)], [("MATH", 2940)]] # 3 If the entire description is just a course, it is output directly. If the courses are conjoined ("and"), they are all output in the same list If the course are disjoined ("or"), they are in separate lists Here, we have both "and" and "or". One caveat that makes it easier: it appears that the nesting of "and"/"or" phrases is never greater than as shown in example 3. What is the best way to do this? I started with PLY, but I couldn't figure out how to resolve the reduce/reduce conflicts. The advantage of PLY is that it's easy to manipulate what each parse rule generates: def p_course(p): 'course : DEPT_CODE COURSE_NUMBER' p[0] = (p[1], int(p[2])) With PyParse, it's less clear how to modify the output of parseString(). I was considering building upon @Alex Martelli's idea of keeping state in an object and building up the output from that, but I'm not sure exactly how that is best done. def addCourse(self, str, location, tokens): self.result.append((tokens[0][0], tokens[0][1])) def makeCourseList(self, str, location, tokens): dept = tokens[0][0] new_tokens = [(dept, tokens[0][1])] new_tokens.extend((dept, tok) for tok in tokens[1:]) self.result.append(new_tokens) For instance, to handle "or" cases: def __init__(self): self.result = [] # ... self.statement = (course_data + Optional(OR_CONJ + course_data)).setParseAction(self.disjunctionCourses) def disjunctionCourses(self, str, location, tokens): if len(tokens) == 1: return tokens print "disjunction tokens: %s" % tokens How does disjunctionCourses() know which smaller phrases to disjoin? All it gets is tokens, but what's been parsed so far is stored in result, so how can the function tell which data in result corresponds to which elements of token? I guess I could search through the tokens, then find an element of result with the same data, but that feel convoluted... What's a better way to approach this problem?

    Read the article

  • Absolute Xpath to get list of childnodes?

    - by Googler
    Hi this my xml file, <?xml version="1.0"?> <worldpatentdata xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <meta name="elapsed-time" value="329" xmlns="http://ops.epo.org"/> <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> </exchange-documents> </worldpatentdata> For the above xml file, i need the xpath to receive the childnodes below it: Output i need is : <exchange-documents xmlns="http://www.epo.org/exchange"> <exchange-document country="AT" doc-number="380509" family-id="38826527" kind="T" system="ops.epo.org"> <bibliographic-data> <publication-reference data-format="docdb"> <document-id> <country>AT</country> <doc-number>380509</doc-number> <kind>T</kind> <date>20071215</date> </document-id> </publication-reference> <parties> <applicants> </applicants> <inventors> </inventors> </parties> </bibliographic-data> </exchange-document> I using Linq-Xml to get the following data: This is my Xpath and code: var list = doc1.XPathSelectElement("exchange-document"); I couldnt retreive the needed output.It returns null for the above code. Can anyone pls help on this by providing the correct xpath to retieve the child nodes. Else is there any other way to retrieve it.

    Read the article

  • vector related memory allocation question

    - by memC
    hi all, I am encountering the following bug. I have a class Foo . Instances of this class are stored in a std::vector vec of class B. in class Foo, I am creating an instance of class A by allocating memory using new and deleting that object in ~Foo(). the code compiles, but I get a crash at the runtime. If I disable delete my_a from desstructor of class Foo. The code runs fine (but there is going to be a memory leak). Could someone please explain what is going wrong here and suggest a fix? thank you! class A{ public: A(int val); ~A(){}; int val_a; }; A::A(int val){ val_a = val; }; class Foo { public: Foo(); ~Foo(); void createA(); A* my_a; }; Foo::Foo(){ createA(); }; void Foo::createA(){ my_a = new A(20); }; Foo::~Foo(){ delete my_a; }; class B { public: vector<Foo> vec; void createFoo(); B(){}; ~B(){}; }; void B::createFoo(){ vec.push_back(Foo()); }; int main(){ B b; int i =0; for (i = 0; i < 5; i ++){ std::cout<<"\n creating Foo"; b.createFoo(); std::cout<<"\n Foo created"; } std::cout<<"\nDone with Foo creation"; std::cout << "\nPress RETURN to continue..."; std::cin.get(); return 0; }

    Read the article

  • Several client waiting for the same event

    - by ff8mania
    I'm developing a communication API to be used by a lot of generic clients to communicate with a proprietary system. This proprietary system exposes an API, and I use a particular classes to send and wait messages from this system: obviously the system alert me that a message is ready using an event. The event is named OnMessageArrived. My idea is to expose a simple SendSyncMessage(message) method that helps the user/client to simply send a message and the method returns the response. The client: using ( Communicator c = new Communicator() ) { response = c.SendSync(message); } The communicator class is done in this way: public class Communicator : IDisposable { // Proprietary system object ExternalSystem c; String currentRespone; Guid currentGUID; private readonly ManualResetEvent _manualResetEvent; private ManualResetEvent _manualResetEvent2; String systemName = "system"; String ServerName = "server"; public Communicator() { _manualResetEvent = new ManualResetEvent(false); //This methods are from the proprietary system API c = SystemInstance.CreateInstance(); c.Connect(systemName , ServerName); } private void ConnectionStarter( object data ) { c.OnMessageArrivedEvent += c_OnMessageArrivedEvent; _manualResetEvent.WaitOne(); c.OnMessageArrivedEvent-= c_OnMessageArrivedEvent; } public String SendSync( String Message ) { Thread _internalThread = new Thread(ConnectionStarter); _internalThread.Start(c); _manualResetEvent2 = new ManualResetEvent(false); String toRet; int messageID; currentGUID = Guid.NewGuid(); c.SendMessage(Message, "Request", currentGUID.ToString()); _manualResetEvent2.WaitOne(); toRet = currentRespone; return toRet; } void c_OnMessageArrivedEvent( int Id, string root, string guid, int TimeOut, out int ReturnCode ) { if ( !guid.Equals(currentGUID.ToString()) ) { _manualResetEvent2.Set(); ReturnCode = 0; return; } object newMessage; c.FetchMessage(Id, 7, out newMessage); currentRespone = newMessage.ToString(); ReturnCode = 0; _manualResetEvent2.Set(); } } I'm really noob in using waithandle, but my idea was to create an instance that sends the message and waits for an event. As soon as the event arrived, checks if the message is the one I expect (checking the unique guid), otherwise continues to wait for the next event. This because could be (and usually is in this way) a lot of clients working concurrently, and I want them to work parallel. As I implemented my stuff, at the moment if I run client 1, client 2 and client 3, client 2 starts sending message as soon as client 1 has finished, and client 3 as client 2 has finished: not what I'm trying to do. Can you help me to fix my code and get my target? Thanks!

    Read the article

  • How to compute a unicode string which bidirectional representation is specified?

    - by valdo
    Hello, fellows. I have a rather pervert question. Please forgive me :) There's an official algorithm that describes how bidirectional unicode text should be presented. http://www.unicode.org/reports/tr9/tr9-15.html I receive a string (from some 3rd-party source), which contains latin/hebrew characters, as well as digits, white-spaces, punctuation symbols and etc. The problem is that the string that I receive is already in the representation form. I.e. - the sequence of characters that I receive should just be presented from left to right. Now, my goal is to find the unicode string which representation is exactly the same. Means - I need to pass that string to another entity; it would then render this string according to the official algorithm, and the result should be the same. Assuming the following: The default text direction (of the rendering entity) is RTL. I don't want to inject "special unicode characters" that explicitly override the text direction (such as RLO, RLE, etc.) I suspect there may exist several solutions. If so - I'd like to preserve the RTL-looking of the string as much as possible. The string usually consists of hebrew words mostly. I'd like to preserve the correct order of those words, and characters inside those words. Whereas other character sequences may (and should) be transposed. One naive way to solve this is just to swap the whole string (this takes care of the hebrew words), and then swap inside it sequences of non-hebrew characters. This however doesn't always produce correct results, because actual rules of representation are rather complex. The only comprehensive algorithm that I see so far is brute-force check. The string can be divided into sequences of same-class characters. Those sequences may be joined in random order, plus any of them may be reversed. I can check all those combinations to obtain the correct result. Plus this technique may be optimized. For instance the order of hebrew words is known, so we only have to check different combinations of their "joining" sequences. Any better ideas? If you have an idea, not necessarily the whole solution - it's ok. I'll appreciate any idea. Thanks in advance.

    Read the article

  • casting doubles to integers in order to gain speed

    - by antirez
    Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

    Read the article

  • What is a good generic sibling control Javascript communication strategy?

    - by James
    I'm building a webpage that is composed of several controls, and trying to come up with an effective somewhat generic client side sibling control communication model. One of the controls is the menu control. Whenever an item is clicked in here I wanted to expose a custom client side event that other controls can subscribe to, so that I can achieve a loosely coupled sibling control communication model. To that end I've created a simple Javascript event collection class (code below) that acts as like a hub for control event registration and event subscription. This code certainly gets the job done, but my question is is there a better more elegant way to do this in terms of best practices or tools, or is this just a fools errand? /// Event collection object - acts as the hub for control communication. function ClientEventCollection() { this.ClientEvents = {}; this.RegisterEvent = _RegisterEvent; this.AttachToEvent = _AttachToEvent; this.FireEvent = _FireEvent; function _RegisterEvent(eventKey) { if (!this.ClientEvents[eventKey]) this.ClientEvents[eventKey] = []; } function _AttachToEvent(eventKey, handlerFunc) { if (this.ClientEvents[eventKey]) this.ClientEvents[eventKey][this.ClientEvents[eventKey].length] = handlerFunc; } function _FireEvent(eventKey, triggerId, contextData ) { if (this.ClientEvents[eventKey]) { for (var i = 0; i < this.ClientEvents[eventKey].length; i++) { var fn = this.ClientEvents[eventKey][i]; if (fn) fn(triggerId, contextData); } } } } // load new collection instance. var myClientEvents = new bsdClientEventCollection(); // register events specific to the control that owns it, this will be emitted by each respective control. myClientEvents.RegisterEvent("menu-item-clicked"); Here is the part where this code above is consumed by source and subscriber controls. // menu control $(document).ready(function() { $(".menu > a").click( function(event) { //event.preventDefault(); myClientEvents.FireEvent("menu-item-clicked", $(this).attr("id"), null); }); }); <div style="float: left;" class="menu"> <a id="1" href="#">Menu Item1</a><br /> <a id="2" href="#">Menu Item2</a><br /> <a id="3" href="#">Menu Item3</a><br /> <a id="4" href="#">Menu Item4</a><br /> </div> // event subscriber control $(document).ready(function() { myClientEvents.AttachToEvent("menu-item-clicked", menuItemChanged); myClientEvents.AttachToEvent("menu-item-clicked", menuItemChanged2); myClientEvents.AttachToEvent("menu-item-clicked", menuItemChanged3); }); function menuItemChanged(id, contextData) { alert('menuItemChanged ' + id); } function menuItemChanged2(id, contextData) { alert('menuItemChanged2 ' + id); } function menuItemChanged3(id, contextData) { alert('menuItemChanged3 ' + id); }

    Read the article

  • Is there a reason why a base class decorated with XmlInclude would still throw a type unknown exception when serialized?

    - by Tedford
    I will simplify the code to save space but what is presented does illustrate the core problem. I have a class which has a property that is a base type. There exist 3 dervived classes which could be assigned to that property. If I assign any of the derived classes to the container then the XmlSerializer throws dreaded "The type xxx was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically." exception when attempting to seralize the container. However my base class is already decorated with that attribute so I figure there must be an additional "hidden" requirement. The really odd part is that the default WCF serializer has no issues with this class hierarchy. The Container class [DataContract] [XmlRoot(ElementName = "TRANSACTION", Namespace = Constants.Namespace)] public class PaymentSummaryRequest : CommandRequest { /// <summary> /// Gets or sets the summary. /// </summary> /// <value>The summary.</value> /// <remarks></remarks> [DataMember] public PaymentSummary Summary { get; set; } /// <summary> /// Initializes a new instance of the <see cref="PaymentSummaryRequest"/> class. /// </summary> public PaymentSummaryRequest() { Mechanism = CommandMechanism.PaymentSummary; } } The base class [DataContract] [XmlInclude(typeof(xxxPaymentSummary))] [XmlInclude(typeof(yyyPaymentSummary))] [XmlInclude(typeof(zzzPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(xxxPaymentSummary))] [KnownType(typeof(zzzPaymentSummary))] public abstract class PaymentSummary { } One of the derived classes [DataContract] public class xxxPaymentSummary : PaymentSummary { } The serialization code var serializer = new XmlSerializer(typeof(PaymentSummaryRequest)); serializer.Serialize(Console.Out,new PaymentSummaryRequest{Summary = new xxxPaymentSummary{}}); The Exception System.InvalidOperationException: There was an error generating the XML document. --- System.InvalidOperationException: The type xxxPaymentSummary was not expected. Use the XmlInclude or SoapInclude attribute to specify types that are not known statically. at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write13_PaymentSummary(String n, String ns, PaymentSummary o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write14_PaymentSummaryRequest(String n, String ns, PaymentSummaryRequest o, Boolean isNullable, Boolean needType) at Microsoft.Xml.Serialization.GeneratedAssembly.XmlSerializationWriterPaymentSummaryRequest.Write15_TRANSACTION(Object o) --- End of inner exception stack trace --- at System.Xml.Serialization.XmlSerializer.Serialize(XmlWriter xmlWriter, Object o, XmlSerializerNamespaces namespaces, String encodingStyle, String id) at System.Xml.Serialization.XmlSerializer.Serialize(TextWriter textWriter, Object o, XmlSerializerNamespaces namespaces) at UserQuery.RunUserAuthoredQuery() in c:\Users\Tedford\AppData\Local\Temp\uqacncyo.0.cs:line 47

    Read the article

  • urgent..haskell mini interpreter

    - by mohamed elshikh
    i'm asked to implement this project and i have problems in part b which is the eval function this is the full describtion of the project You are required to implement an interpreter for mini-Haskell language. An interpreter is dened in Wikipedia as a computer program that executes, i.e. performs, instructions written in a programming language. The interpreter should be able to evaluate functions written in a special notation, which you will dene. A function is dened by: Function name Input Parameters : dened as a list of variables. The body of the function. The body of the function can be any of the following statements: a) Variable: The function may return any of the input variables. b) Arithmetic Expressions: The arithmetic expressions include input variables and addition, sub- traction, multiplication, division and modulus operations on arithmetic expressions. c) Boolean Expressions: The Boolean expressions include the ordering of arithmetic expressions (applying the relationships: <, =<, , = or =) and the anding, oring and negation of Boolean expressions. d) If-then-else statements: where the if keyword is followed by a Boolean expression. The then and else parts may be followed by any of the statements described here. e) Guarded expressions: where each case consists of a boolean expression and any of the statements described here. The expression consists of any number of cases. The rst case whose condition is true, its body should be evaluated. The guarded expression has to terminate with an otherwise case. f) Function calls: the body of the function may have a call to another function. Note that all inputs passed to the function will be of type Int. The output of the function can be of type Int or Bool. To implement the interpreter, you are required to implement the following: a) Dene a datatype for the following expressions: Variables Arithmetic expressions Boolean expressions If-then-else statements Guarded expressions Functions b) Implement the function eval which evaluates a function. It takes 3 inputs: The name of a function to be evaluated represented as a string. A list of inputs to that function. The arguments will always be of datatype Int. A list of functions. Each function is represented as instance of the datatype that you have created for functions. c) Implement the function get_type that returns the type of the function (as a string). The input to this function is the same as in part b. here is what i've done data Variable = v(char) data Arth= va Variable | Add Arth Arth | Sub Arth Arth | Times Arth Arth | Divide Arth Arth data Bol= Great Arth Arth | Small Arth Arth | Geq Arth Arth | Seq Arth Arth | And Bol Bol | Or Bol Bol | Neg Bol data Cond = data Guard = data Fun =cons String [Variable] Body data Body= bodycons(String) |Bol |Cond |Guard |Arth

    Read the article

  • Refactoring Singleton Overuse

    - by drharris
    Today I had an epiphany, and it was that I was doing everything wrong. Some history: I inherited a C# application, which was really just a collection of static methods, a completely procedural mess of C# code. I refactored this the best I knew at the time, bringing in lots of post-college OOP knowledge. To make a long story short, many of the entities in code have turned out to be Singletons. Today I realized I needed 3 new classes, which would each follow the same Singleton pattern to match the rest of the software. If I keep tumbling down this slippery slope, eventually every class in my application will be Singleton, which will really be no logically different from the original group of static methods. I need help on rethinking this. I know about Dependency Injection, and that would generally be the strategy to use in breaking the Singleton curse. However, I have a few specific questions related to this refactoring, and all about best practices for doing so. How acceptable is the use of static variables to encapsulate configuration information? I have a brain block on using static, and I think it is due to an early OO class in college where the professor said static was bad. But, should I have to reconfigure the class every time I access it? When accessing hardware, is it ok to leave a static pointer to the addresses and variables needed, or should I continually perform Open() and Close() operations? Right now I have a single method acting as the controller. Specifically, I continually poll several external instruments (via hardware drivers) for data. Should this type of controller be the way to go, or should I spawn separate threads for each instrument at the program's startup? If the latter, how do I make this object oriented? Should I create classes called InstrumentAListener and InstrumentBListener? Or is there some standard way to approach this? Is there a better way to do global configuration? Right now I simply have Configuration.Instance.Foo sprinkled liberally throughout the code. Almost every class uses it, so perhaps keeping it as a Singleton makes sense. Any thoughts? A lot of my classes are things like SerialPortWriter or DataFileWriter, which must sit around waiting for this data to stream in. Since they are active the entire time, how should I arrange these in order to listen for the events generated when data comes in? Any other resources, books, or comments about how to get away from Singletons and other pattern overuse would be helpful.

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • Problems with validates_inclusion_of, acts_as_tree and rspec

    - by Jens Fahnenbruck
    I have problems to get rspec running properly to test validates_inclusion_of my migration looks like this: class CreateCategories < ActiveRecord::Migration def self.up create_table :categories do |t| t.string :name t.integer :parent_id t.timestamps end end def self.down drop_table :categories end end my model looks like this: class Category < ActiveRecord::Base acts_as_tree validates_presence_of :name validates_uniqueness_of :name validates_inclusion_of :parent_id, :in => Category.all.map(&:id), :unless => Proc.new { |c| c.parent_id.blank? } end my factories: Factory.define :category do |c| c.name "Category One" end Factory.define :category_2, :class => Category do |c| c.name "Category Two" end my model spec looks like this: require 'spec_helper' describe Category do before(:each) do @valid_attributes = { :name => "Category" } end it "should create a new instance given valid attributes" do Category.create!(@valid_attributes) end it "should have a name and it shouldn't be empty" do c = Category.new :name => nil c.should be_invalid c.name = "" c.should be_invalid end it "should not create a duplicate names" do Category.create!(@valid_attributes) Category.new(@valid_attributes).should be_invalid end it "should not save with invalid parent" do parent = Factory(:category) child = Category.new @valid_attributes child.parent_id = parent.id + 100 child.should be_invalid end it "should save with valid parent" do child = Factory.build(:category_2) child.parent = Factory(:category) # FIXME: make it pass, it works on cosole, but I don't know why the test is failing child.should be_valid end end I get the following error: 'Category should save with valid parent' FAILED Expected #<Category id: nil, name: "Category Two", parent_id: 5, created_at: nil, updated_at: nil to be valid, but it was not Errors: Parent is missing On console everything seems to be fine and work as expected: c1 = Category.new :name => "Parent Category" c1.valid? #=> true c1.save #=> true c1.id #=> 1 c2 = Category.new :name => "Child Category" c2.valid? #=> true c2.parent_id = 100 c2.valid? #=> false c2.parent_id = 1 c2.valid? #=> true I'm running rails 2.3.5, rspec 1.3.0 and rspec-rails 1.3.2 Anybody, any idea?

    Read the article

  • How do you unit test the real world?

    - by Kim Sun-wu
    I'm primarily a C++ coder, and thus far, have managed without really writing tests for all of my code. I've decided this is a Bad Idea(tm), after adding new features that subtly broke old features, or, depending on how you wish to look at it, introduced some new "features" of their own. But, unit testing seems to be an extremely brittle mechanism. You can test for something in "perfect" conditions, but you don't get to see how your code performs when stuff breaks. A for instance is a crawler, let's say it crawls a few specific sites, for data X. Do you simply save sample pages, test against those, and hope that the sites never change? This would work fine as regression tests, but, what sort of tests would you write to constantly check those sites live and let you know when the application isn't doing it's job because the site changed something, that now causes your application to crash? Wouldn't you want your test suite to monitor the intent of the code? The above example is a bit contrived, and something I haven't run into (in case you haven't guessed). Let me pick something I have, though. How do you test an application will do its job in the face of a degraded network stack? That is, say you have a moderate amount of packet loss, for one reason or the other, and you have a function DoSomethingOverTheNetwork() which is supposed to degrade gracefully when the stack isn't performing as it's supposed to; but does it? The developer tests it personally by purposely setting up a gateway that drops packets to simulate a bad network when he first writes it. A few months later, someone checks in some code that modifies something subtly, so the degradation isn't detected in time, or, the application doesn't even recognize the degradation, this is never caught, because you can't run real world tests like this using unit tests, can you? Further, how about file corruption? Let's say you're storing a list of servers in a file, and the checksum looks okay, but the data isn't really. You want the code to handle that, you write some code that you think does that. How do you test that it does exactly that for the life of the application? Can you? Hence, brittleness. Unit tests seem to test the code only in perfect conditions(and this is promoted, with mock objects and such), not what they'll face in the wild. Don't get me wrong, I think unit tests are great, but a test suite composed only of them seems to be a smart way to introduce subtle bugs in your code while feeling overconfident about it's reliability. How do I address the above situations? If unit tests aren't the answer, what is? Thanks!

    Read the article

  • Inserting a string array as a row into an Excel document using the Open XML SDK 2.0

    - by Sam
    The code runs, but corrupts my excel document. Any help would be mucho appreciated! I used this as a reference. public void AddRow(string fileName, string[] values) { using (SpreadsheetDocument doc = SpreadsheetDocument.Open(fileName, true)) { SharedStringTablePart sharedStringPart = GetSharedStringPart(doc); WorksheetPart worksheetPart = doc.WorkbookPart.WorksheetParts.First(); uint rowIdx = AppendRow(worksheetPart); for (int i = 0; i < values.Length; ++i) { int stringIdx = InsertSharedString(values[i], sharedStringPart); Cell cell = InsertCell(i, rowIdx, worksheetPart); cell.CellValue = new CellValue(stringIdx.ToString()); cell.DataType = new EnumValue<CellValues>( CellValues.SharedString); worksheetPart.Worksheet.Save(); } } } private SharedStringTablePart GetSharedStringPart( SpreadsheetDocument doc) { if (doc.WorkbookPart. GetPartsCountOfType<SharedStringTablePart>() > 0) return doc.WorkbookPart. GetPartsOfType<SharedStringTablePart>().First(); else return doc.WorkbookPart. AddNewPart<SharedStringTablePart>(); } private uint AppendRow(WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); uint rowIndex = (uint)sheetData.Elements<Row>().Count(); Row row = new Row() { RowIndex = rowIndex }; sheetData.Append(row); return rowIndex; } private int InsertSharedString(string s, SharedStringTablePart sharedStringPart) { if (sharedStringPart.SharedStringTable == null) sharedStringPart.SharedStringTable = new SharedStringTable(); int i = 0; foreach (SharedStringItem item in sharedStringPart.SharedStringTable. Elements<SharedStringItem>()) { if (item.InnerText == s) return i; ++i; } sharedStringPart.SharedStringTable.AppendChild( new Text(s)); sharedStringPart.SharedStringTable.Save(); return i; } private Cell InsertCell(int i, uint rowIdx, WorksheetPart worksheetPart) { SheetData sheetData = worksheetPart.Worksheet. GetFirstChild<SheetData>(); string cellReference = AlphabetMap.Instance[i] + rowIdx; Cell cell = new Cell() { CellReference = cellReference }; Row row = sheetData.Elements<Row>().ElementAt((int)rowIdx); row.InsertAt(cell, i); worksheetPart.Worksheet.Save(); return cell; }

    Read the article

  • X264 encoding using Opencv

    - by user573193
    I am working with a high resolution camera: 4008x2672. I a writing a simple program which grabs frame from the camera and sends the frame to a avi file. For working with such a high resolution, I found only x264 codec that could do the trick (Suggestions welcome). I am using opencv for most of the image handling stuff. As mentioned in this post http://doom10.org/index.php?topic=1019.0 , I modified the AVCodecContext members as per ffmpeg presets for libx264 (Had to do this to avoid broken ffmpeg defaults settings error). This is output I am getting when I try to run the program [libx264 @ 0x992d040]non-strictly-monotonic PTS 1294846981.526675 1 0 //Timestamp camera_no frame_no 1294846981.621101 1 1 1294846981.715521 1 2 1294846981.809939 1 3 1294846981.904360 1 4 1294846981.998782 1 5 1294846982.093203 1 6 Last message repeated 7 times [avi @ 0x992beb0]st:0 error, non monotone timestamps -614891469123651720 = -614891469123651720 OpenCV Error: Unspecified error (Error while writing video frame) in icv_av_write_frame_FFMPEG, file /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp, line 1034 terminate called after throwing an instance of 'cv::Exception' what(): /home/ajoshi/ext/OpenCV-2.2.0/modules/highgui/src/cap_ffmpeg.cpp:1034: error: (-2) Error while writing video frame in function icv_av_write_frame_FFMPEG Aborted Modifications to the AVCodecContext are: if(codec_id == CODEC_ID_H264) { //fprintf(stderr, "Trying to parse a preset file for libx264\n"); //Setting Values manually from medium preset c-me_method = 7; c-qcompress=0.6; c-qmin = 10; c-qmax = 51; c-max_qdiff = 4; c-i_quant_factor=0.71; c-max_b_frames=3; c-b_frame_strategy = 1; c-me_range = 16; c-me_subpel_quality=7; c-coder_type = 1; c-scenechange_threshold=40; c-partitions = X264_PART_I8X8 | X264_PART_I4X4 | X264_PART_P8X8 | X264_PART_B8X8; c-flags = CODEC_FLAG_LOOP_FILTER; c-flags2 = CODEC_FLAG2_BPYRAMID | CODEC_FLAG2_MIXED_REFS | CODEC_FLAG2_WPRED | CODEC_FLAG2_8X8DCT | CODEC_FLAG2_FASTPSKIP; c-keyint_min = 25; c-refs = 3; c-trellis=1; c-directpred = 1; c-weighted_p_pred=2; } I am probably not setting the dts and pts values which I believed ffmpeg should be setting it for me. Any sugggestions welcome. Thanks in advance

    Read the article

  • SpringBatch Jaxb2Marshaller: different name of class and xml attribute

    - by user588961
    I try to read an xml file as input for spring batch: Java Class: package de.example.schema.processes.standardprocess; @XmlAccessorType(XmlAccessType.FIELD) @XmlType(name = "Process", namespace = "http://schema.example.de/processes/process", propOrder = { "input" }) public class Process implements Serializable { @XmlElement(namespace = "http://schema.example.de/processes/process") protected ProcessInput input; public ProcessInput getInput() { return input; } public void setInput(ProcessInput value) { this.input = value; } } SpringBatch dev-job.xml: <bean id="exampleReader" class="org.springframework.batch.item.xml.StaxEventItemReader" scope="step"> <property name="fragmentRootElementName" value="input" /> <property name="resource" value="file:#{jobParameters['dateiname']}" /> <property name="unmarshaller" ref="jaxb2Marshaller" /> </bean> <bean id="jaxb2Marshaller" class="org.springframework.oxm.jaxb.Jaxb2Marshaller"> <property name="classesToBeBound"> <list> <value>de.example.schema.processes.standardprocess.Process</value> <value>de.example.schema.processes.standardprocess.ProcessInput</value> ... </list> </property> </bean> Input file: <?xml version="1.0" encoding="UTF-8"?> <process:process xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:process="http://schema.example.de/processes/process"> <process:input> ... </process:input> </process:process> It fires the following exception: [javax.xml.bind.UnmarshalException: unexpected element (uri:"http://schema.example.de/processes/process", local:"input"). Expected elements are <<{http://schema.example.de/processes/process}processInput] at org.springframework.oxm.jaxb.JaxbUtils.convertJaxbException(JaxbUtils.java:92) at org.springframework.oxm.jaxb.AbstractJaxbMarshaller.convertJaxbException(AbstractJaxbMarshaller.java:143) at org.springframework.oxm.jaxb.Jaxb2Marshaller.unmarshal(Jaxb2Marshaller.java:428) If I change to in xml it work's fine. Unfortunately I can change neither the xml nor the java class. Is there a possibility to make Jaxb2Marshaller map the element 'input' to the class 'ProcessInput'?

    Read the article

  • Casting to derived type problem in C++

    - by GONeale
    Hey there everyone, I am quite new to C++, but have worked with C# for years, however it is not helping me here! :) My problem: I have an Actor class which Ball and Peg both derive from on an objective-c iphone game I am working on. As I am testing for collision, I wish to set an instance of Ball and Peg appropriately depending on the actual runtime type of actorA or actorB. My code that tests this as follows: // Actors that collided Actor *actorA = (Actor*) bodyA->GetUserData(); Actor *actorB = (Actor*) bodyB->GetUserData(); Ball* ball; Peg* peg; if (static_cast<Ball*> (actorA)) { // true ball = static_cast<Ball*> (actorA); } else if (static_cast<Ball*> (actorB)) { ball = static_cast<Ball*> (actorB); } if (static_cast<Peg*> (actorA)) { // also true?! peg = static_cast<Peg*> (actorA); } else if (static_cast<Peg*> (actorB)) { peg = static_cast<Peg*> (actorB); } if (peg != NULL) { [peg hitByBall]; } Once ball and peg are set, I then proceed to run the hitByBall method (objective c). Where my problem really lies is in the casting procedurel Ball casts fine from actorA; the first if (static_cast<>) statement steps in and sets the ball pointer appropriately. The second step is to assign the appropriate type to peg. I know peg should be a Peg type and I previously know it will be actorB, however at runtime, detecting the types, I was surprised to find actually the third if (static_cast<>) statement stepped in and set this, this if statement was to check if actorA was a Peg, which we already know actorA is a Ball! Why would it have stepped here and not in the fourth if statement? The only thing I can assume is how casting works differently from c# and that is it finds that actorA which is actually of type Ball derives from Actor and then it found when static_cast<Peg*> (actorA) is performed it found Peg derives from Actor too, so this is a valid test? This could all come down to how I have misunderstood the use of static_cast. How can I achieve what I need? :) I'm really uneasy about what feels to me like a long winded brute-casting attempt here with a ton of ridiculous if statements. I'm sure there is a more elegant way to achieve a simple cast to Peg and cast to Ball dependent on actual type held in actorA and actorB. Hope someone out there can help! :) Thanks a lot.

    Read the article

  • SVG via dynamic XML+XSL

    - by Daniel
    This is a bit of a vague notion which I have been running over in my head, and which I am very curious if there is an elegant method of solving. Perhaps it should be taken as a thought experiment. Imagine you have an XML schema with a corresponding XSL transform, which renders the XML as SVG in the browser. The XSL generates SVG with appropriate Javascript handlers that, ultimately, implement editing-like functionality such that properties of the objects or their locations on the SVG canvas can be edited by the user. For instance, an element can be dragged from one location to another. Now, this isn't particularly difficult - the drag/drop example is simply a matter of changing the (x,y) coordinates of the SVG object, or a resize operation would be a simple matter of changing its width or height. But is there an elegant way to have Javascript work on the DOM of the source XML document instead of the rendered SVG? Why, you ask? Well, imagine you have very complex XSL transforms, where the modification of one property results in complex changes to the SVG. You want to maintain simplicity in your Javascript code, but also a simple way to persist the modified XML back to the server. Some possibilities of how this may function: After modification of the source DOM, simply re-run the XSL transform and replace the original. Downside: brute force, potentially expensive operation. Create id/class naming conventions in the source and target XML/SVG so elements can be related back to each other, and do an XSL transform on only a subset of the new DOM. In other words, modify temporary DOM, apply XSL to it, remove changed elements from SVG, and insert the new one. Downside: May not be possible to apply XSL to temporary in-browser DOMs(?). Also, perhaps a bit convoluted or ugly to maintain. I think that it may be possible to come up with a framework that handles the second scenario, but the challenge would be making it lightweight and not heavily tied to the actual XML schema. Any ideas or other possibilities? Or is there maybe an existing method of doing this which I'm not aware of? UPDATE: To clarify, as I mentioned in a comment below, this aids in separating the draw code from the edit code. For a more concrete example of how this is useful, imagine an element which determines how it is drawn dependent on the value of a property of an adjacent element. It's better to condense that logic directly in the draw code instead of also duplicating it in the edit code.

    Read the article

  • Linux configurations that would affect Java memory usage?

    - by wmacura
    Hi, Background: I have a set of java background workers I start as part of my webapp. I develop locally on Ubuntu 10.10 and deploy to an Ubuntu 10.04LTS server (a media temple (ve) instance). They're both running the same JVM: Sun JVM 1.6.0_22-b04. As part of the initialization script each worker is started with explicit Xmx, Xms, and XX:MaxPermGen settings. Yet somehow locally all 10 workers use 250MB, while on the server they use more than 2.7GB. I don't know how to begin to track this down. I thought the Ubuntu (and thus, kernel) version might make a difference, but I tried an old 10.04 VM and it behaves as expected. I've noticed that the machine does not seem to ever use memory for buffer or cache (according to htop), which seems a bit strange, but perhaps normal for a server? (edited) Some info: (server) root@devel:/app/axir/target# uname -a Linux devel 2.6.18-028stab069.5 #1 SMP Tue May 18 17:26:16 MSD 2010 x86_64 GNU/Linux (local) wiktor@beastie:~$ uname -a Linux beastie 2.6.35-25-generic #44-Ubuntu SMP Fri Jan 21 17:40:44 UTC 2011 x86_64 GNU/Linux (edited) Comparing PS output: (ps -eo "ppid,pid,cmd,rss,sz,vsz") PPID PID CMD RSS SZ VSZ (local) 1588 1615 java -cp axir-distribution. 25484 234382 937528 1615 1631 java -cp /home/wiktor/Code/ 83472 163059 652236 1615 1657 java -cp /home/wiktor/Code/ 70624 89135 356540 1615 1658 java -cp /home/wiktor/Code/ 37652 77625 310500 1615 1669 java -cp /home/wiktor/Code/ 38096 77733 310932 1615 1675 java -cp /home/wiktor/Code/ 37420 61395 245580 1615 1684 java -cp /home/wiktor/Code/ 38000 77736 310944 1615 1703 java -cp /home/wiktor/Code/ 39180 78060 312240 1615 1712 java -cp /home/wiktor/Code/ 38488 93882 375528 1615 1719 java -cp /home/wiktor/Code/ 38312 77874 311496 1615 1726 java -cp /home/wiktor/Code/ 38656 77958 311832 1615 1727 java -cp /home/wiktor/Code/ 78016 89429 357716 (server) 22522 23560 java -cp axir-distribution. 24860 285196 1140784 23560 23585 java -cp /app/axir/target/a 100764 161629 646516 23560 23667 java -cp /app/axir/target/a 72408 92682 370728 23560 23670 java -cp /app/axir/target/a 39948 97671 390684 23560 23674 java -cp /app/axir/target/a 40140 81586 326344 23560 23739 java -cp /app/axir/target/a 39688 81542 326168 They look very similar. In fact, the question now is why, if I add up the virtual memory usage on the server (3.2GB) does it more closely reflect 2.4GB of memory used (according to free), yet locally the virtual memory used adds up to a much more substantial 4.7GB but only actually uses ~250MB. It seems that perhaps memory isn't being shared as aggressively. (if that's even possible) Thank you for your help, Wiktor

    Read the article

  • How do I make my custom Swing component visible?

    - by Alex
    I have no idea why it won't show. First I create an instance of the component and then add it to a certain element in a two-dimensional JPanel array. Then I loop through that array and add each JPanel to another JPanel container which is to hold all the JPanels. I then add that final container to my JFrame window and set visibility to true, it should be visible? public class View extends JFrame { Board gameBoard; JFrame gameWindow = new JFrame("Chess"); JPanel gamePanel = new JPanel(); JPanel[][] squarePanel = new JPanel[8][8]; JMenuBar gameMenu = new JMenuBar(); JButton restartGame = new JButton("Restart"); JButton pauseGame = new JButton("Pause"); JButton log = new JButton("Log"); View(Board board){ gameWindow.setDefaultCloseOperation(EXIT_ON_CLOSE); gameWindow.setSize(400, 420); gameWindow.getContentPane().add(gamePanel, BorderLayout.CENTER); gameWindow.getContentPane().add(gameMenu, BorderLayout.NORTH); gameMenu.add(restartGame); gameMenu.add(pauseGame); gameMenu.add(log); gameBoard = board; drawBoard(gameBoard); gameWindow.setResizable(false); gameWindow.setVisible(true); } public void drawBoard(Board board){ for(int row = 0; row < 8; row++){ for(int col = 0; col < 8; col++){ Box box = new Box(board.getSquare(col, row).getColour(), col, row); squarePanel[col][row] = new JPanel(); squarePanel[col][row].add(box); } } for(JPanel[] col : squarePanel){ for(JPanel square : col){ gamePanel.add(square); } } } } @SuppressWarnings("serial") class Box extends JComponent{ Color boxColour; int col, row; public Box(Color boxColour, int col, int row){ this.boxColour = boxColour; this.col = col; this.row = row; repaint(); } protected void paintComponent(Graphics drawBox){ drawBox.setColor(boxColour); drawBox.drawRect(50*col, 50*row, 50, 50); drawBox.fillRect(50*col, 50*row, 50, 50); } } A final question as well. Notice how each Box component has a position, what happens to the position when I add the component to a JPanel and add the JPanel to my JFrame? Does it still have the same position in relation to the other Box components?

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • XmlSerializer.Deserialize blocks over NetworkStream

    - by Luca
    I'm trying to sends XML serializable objects over a network stream. I've already used this on an UDP broadcast server, where it receive UDP messages from the local network. Here a snippet of the server side: while (mServiceStopFlag == false) { if (mSocket.Available > 0) { IPEndPoint ipEndPoint = new IPEndPoint(IPAddress.Any, DiscoveryPort); byte[] bData; // Receive discovery message bData = mSocket.Receive(ref ipEndPoint); // Handle discovery message HandleDiscoveryMessage(ipEndPoint.Address, bData); ... Instead this is the client side: IPEndPoint ipEndPoint = new IPEndPoint(IPAddress.Broadcast, DiscoveryPort); MemoryStream mStream = new MemoryStream(); byte[] bData; // Create broadcast UDP server mSocket = new UdpClient(); mSocket.EnableBroadcast = true; // Create datagram data foreach (NetService s in ctx.Services) XmlHelper.SerializeClass<NetService>(mStream, s); bData = mStream.GetBuffer(); // Notify the services while (mServiceStopFlag == false) { mSocket.Send(bData, (int)mStream.Length, ipEndPoint); Thread.Sleep(DefaultServiceLatency); } It works very fine. But now i'me trying to get the same result, but on a TcpClient socket, but the using directly an XMLSerializer instance: On server side: TcpClient sSocket = k.Key; ServiceContext sContext = k.Value; Message msg = new Message(); while (sSocket.Connected == true) { if (sSocket.Available > 0) { StreamReader tr = new StreamReader(sSocket.GetStream()); msg = (Message)mXmlSerialize.Deserialize(tr); // Handle message msg = sContext.Handler(msg); // Reply with another message if (msg != null) mXmlSerialize.Serialize(sSocket.GetStream(), msg); } else Thread.Sleep(40); } And on client side: NetworkStream mSocketStream; Message rMessage; // Network stream mSocketStream = mSocket.GetStream(); // Send the message mXmlSerialize.Serialize(mSocketStream, msg); // Receive the answer rMessage = (Message)mXmlSerialize.Deserialize(mSocketStream); return (rMessage); The data is sent (Available property is greater then 0), but the method XmlSerialize.Deserialize (which should deserialize the Message class) blocks. What am I missing?

    Read the article

< Previous Page | 507 508 509 510 511 512 513 514 515 516 517 518  | Next Page >