Search Results

Search found 6142 results on 246 pages for 'singleton pattern'.

Page 52/246 | < Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >

  • Seeking on a Heap, and Two Useful DMVs

    - by Paul White
    So far in this mini-series on seeks and scans, we have seen that a simple ‘seek’ operation can be much more complex than it first appears.  A seek can contain one or more seek predicates – each of which can either identify at most one row in a unique index (a singleton lookup) or a range of values (a range scan).  When looking at a query plan, we will often need to look at the details of the seek operator in the Properties window to see how many operations it is performing, and what type of operation each one is.  As you saw in the first post in this series, the number of hidden seeking operations can have an appreciable impact on performance. Measuring Seeks and Scans I mentioned in my last post that there is no way to tell from a graphical query plan whether you are seeing a singleton lookup or a range scan.  You can work it out – if you happen to know that the index is defined as unique and the seek predicate is an equality comparison, but there’s no separate property that says ‘singleton lookup’ or ‘range scan’.  This is a shame, and if I had my way, the query plan would show different icons for range scans and singleton lookups – perhaps also indicating whether the operation was one or more of those operations underneath the covers. In light of all that, you might be wondering if there is another way to measure how many seeks of either type are occurring in your system, or for a particular query.  As is often the case, the answer is yes – we can use a couple of dynamic management views (DMVs): sys.dm_db_index_usage_stats and sys.dm_db_index_operational_stats. Index Usage Stats The index usage stats DMV contains counts of index operations from the perspective of the Query Executor (QE) – the SQL Server component that is responsible for executing the query plan.  It has three columns that are of particular interest to us: user_seeks – the number of times an Index Seek operator appears in an executed plan user_scans – the number of times a Table Scan or Index Scan operator appears in an executed plan user_lookups – the number of times an RID or Key Lookup operator appears in an executed plan An operator is counted once per execution (generating an estimated plan does not affect the totals), so an Index Seek that executes 10,000 times in a single plan execution adds 1 to the count of user seeks.  Even less intuitively, an operator is also counted once per execution even if it is not executed at all.  I will show you a demonstration of each of these things later in this post. Index Operational Stats The index operational stats DMV contains counts of index and table operations from the perspective of the Storage Engine (SE).  It contains a wealth of interesting information, but the two columns of interest to us right now are: range_scan_count – the number of range scans (including unrestricted full scans) on a heap or index structure singleton_lookup_count – the number of singleton lookups in a heap or index structure This DMV counts each SE operation, so 10,000 singleton lookups will add 10,000 to the singleton lookup count column, and a table scan that is executed 5 times will add 5 to the range scan count. The Test Rig To explore the behaviour of seeks and scans in detail, we will need to create a test environment.  The scripts presented here are best run on SQL Server 2008 Developer Edition, but the majority of the tests will work just fine on SQL Server 2005.  A couple of tests use partitioning, but these will be skipped if you are not running an Enterprise-equivalent SKU.  Ok, first up we need a database: USE master; GO IF DB_ID('ScansAndSeeks') IS NOT NULL DROP DATABASE ScansAndSeeks; GO CREATE DATABASE ScansAndSeeks; GO USE ScansAndSeeks; GO ALTER DATABASE ScansAndSeeks SET ALLOW_SNAPSHOT_ISOLATION OFF ; ALTER DATABASE ScansAndSeeks SET AUTO_CLOSE OFF, AUTO_SHRINK OFF, AUTO_CREATE_STATISTICS OFF, AUTO_UPDATE_STATISTICS OFF, PARAMETERIZATION SIMPLE, READ_COMMITTED_SNAPSHOT OFF, RESTRICTED_USER ; Notice that several database options are set in particular ways to ensure we get meaningful and reproducible results from the DMVs.  In particular, the options to auto-create and update statistics are disabled.  There are also three stored procedures, the first of which creates a test table (which may or may not be partitioned).  The table is pretty much the same one we used yesterday: The table has 100 rows, and both the key_col and data columns contain the same values – the integers from 1 to 100 inclusive.  The table is a heap, with a non-clustered primary key on key_col, and a non-clustered non-unique index on the data column.  The only reason I have used a heap here, rather than a clustered table, is so I can demonstrate a seek on a heap later on.  The table has an extra column (not shown because I am too lazy to update the diagram from yesterday) called padding – a CHAR(100) column that just contains 100 spaces in every row.  It’s just there to discourage SQL Server from choosing table scan over an index + RID lookup in one of the tests. The first stored procedure is called ResetTest: CREATE PROCEDURE dbo.ResetTest @Partitioned BIT = 'false' AS BEGIN SET NOCOUNT ON ; IF OBJECT_ID(N'dbo.Example', N'U') IS NOT NULL BEGIN DROP TABLE dbo.Example; END ; -- Test table is a heap -- Non-clustered primary key on 'key_col' CREATE TABLE dbo.Example ( key_col INTEGER NOT NULL, data INTEGER NOT NULL, padding CHAR(100) NOT NULL DEFAULT SPACE(100), CONSTRAINT [PK dbo.Example key_col] PRIMARY KEY NONCLUSTERED (key_col) ) ; IF @Partitioned = 'true' BEGIN -- Enterprise, Trial, or Developer -- required for partitioning tests IF SERVERPROPERTY('EngineEdition') = 3 BEGIN EXECUTE (' DROP TABLE dbo.Example ; IF EXISTS ( SELECT 1 FROM sys.partition_schemes WHERE name = N''PS'' ) DROP PARTITION SCHEME PS ; IF EXISTS ( SELECT 1 FROM sys.partition_functions WHERE name = N''PF'' ) DROP PARTITION FUNCTION PF ; CREATE PARTITION FUNCTION PF (INTEGER) AS RANGE RIGHT FOR VALUES (20, 40, 60, 80, 100) ; CREATE PARTITION SCHEME PS AS PARTITION PF ALL TO ([PRIMARY]) ; CREATE TABLE dbo.Example ( key_col INTEGER NOT NULL, data INTEGER NOT NULL, padding CHAR(100) NOT NULL DEFAULT SPACE(100), CONSTRAINT [PK dbo.Example key_col] PRIMARY KEY NONCLUSTERED (key_col) ) ON PS (key_col); '); END ELSE BEGIN RAISERROR('Invalid SKU for partition test', 16, 1); RETURN; END; END ; -- Non-unique non-clustered index on the 'data' column CREATE NONCLUSTERED INDEX [IX dbo.Example data] ON dbo.Example (data) ; -- Add 100 rows INSERT dbo.Example WITH (TABLOCKX) ( key_col, data ) SELECT key_col = V.number, data = V.number FROM master.dbo.spt_values AS V WHERE V.[type] = N'P' AND V.number BETWEEN 1 AND 100 ; END; GO The second stored procedure, ShowStats, displays information from the Index Usage Stats and Index Operational Stats DMVs: CREATE PROCEDURE dbo.ShowStats @Partitioned BIT = 'false' AS BEGIN -- Index Usage Stats DMV (QE) SELECT index_name = ISNULL(I.name, I.type_desc), scans = IUS.user_scans, seeks = IUS.user_seeks, lookups = IUS.user_lookups FROM sys.dm_db_index_usage_stats AS IUS JOIN sys.indexes AS I ON I.object_id = IUS.object_id AND I.index_id = IUS.index_id WHERE IUS.database_id = DB_ID(N'ScansAndSeeks') AND IUS.object_id = OBJECT_ID(N'dbo.Example', N'U') ORDER BY I.index_id ; -- Index Operational Stats DMV (SE) IF @Partitioned = 'true' SELECT index_name = ISNULL(I.name, I.type_desc), partitions = COUNT(IOS.partition_number), range_scans = SUM(IOS.range_scan_count), single_lookups = SUM(IOS.singleton_lookup_count) FROM sys.dm_db_index_operational_stats ( DB_ID(N'ScansAndSeeks'), OBJECT_ID(N'dbo.Example', N'U'), NULL, NULL ) AS IOS JOIN sys.indexes AS I ON I.object_id = IOS.object_id AND I.index_id = IOS.index_id GROUP BY I.index_id, -- Key I.name, I.type_desc ORDER BY I.index_id; ELSE SELECT index_name = ISNULL(I.name, I.type_desc), range_scans = SUM(IOS.range_scan_count), single_lookups = SUM(IOS.singleton_lookup_count) FROM sys.dm_db_index_operational_stats ( DB_ID(N'ScansAndSeeks'), OBJECT_ID(N'dbo.Example', N'U'), NULL, NULL ) AS IOS JOIN sys.indexes AS I ON I.object_id = IOS.object_id AND I.index_id = IOS.index_id GROUP BY I.index_id, -- Key I.name, I.type_desc ORDER BY I.index_id; END; The final stored procedure, RunTest, executes a query written against the example table: CREATE PROCEDURE dbo.RunTest @SQL VARCHAR(8000), @Partitioned BIT = 'false' AS BEGIN -- No execution plan yet SET STATISTICS XML OFF ; -- Reset the test environment EXECUTE dbo.ResetTest @Partitioned ; -- Previous call will throw an error if a partitioned -- test was requested, but SKU does not support it IF @@ERROR = 0 BEGIN -- IO statistics and plan on SET STATISTICS XML, IO ON ; -- Test statement EXECUTE (@SQL) ; -- Plan and IO statistics off SET STATISTICS XML, IO OFF ; EXECUTE dbo.ShowStats @Partitioned; END; END; The Tests The first test is a simple scan of the heap table: EXECUTE dbo.RunTest @SQL = 'SELECT * FROM Example'; The top result set comes from the Index Usage Stats DMV, so it is the Query Executor’s (QE) view.  The lower result is from Index Operational Stats, which shows statistics derived from the actions taken by the Storage Engine (SE).  We see that QE performed 1 scan operation on the heap, and SE performed a single range scan.  Let’s try a single-value equality seek on a unique index next: EXECUTE dbo.RunTest @SQL = 'SELECT key_col FROM Example WHERE key_col = 32'; This time we see a single seek on the non-clustered primary key from QE, and one singleton lookup on the same index by the SE.  Now for a single-value seek on the non-unique non-clustered index: EXECUTE dbo.RunTest @SQL = 'SELECT data FROM Example WHERE data = 32'; QE shows a single seek on the non-clustered non-unique index, but SE shows a single range scan on that index – not the singleton lookup we saw in the previous test.  That makes sense because we know that only a single-value seek into a unique index is a singleton seek.  A single-value seek into a non-unique index might retrieve any number of rows, if you think about it.  The next query is equivalent to the IN list example seen in the first post in this series, but it is written using OR (just for variety, you understand): EXECUTE dbo.RunTest @SQL = 'SELECT data FROM Example WHERE data = 32 OR data = 33'; The plan looks the same, and there’s no difference in the stats recorded by QE, but the SE shows two range scans.  Again, these are range scans because we are looking for two values in the data column, which is covered by a non-unique index.  I’ve added a snippet from the Properties window to show that the query plan does show two seek predicates, not just one.  Now let’s rewrite the query using BETWEEN: EXECUTE dbo.RunTest @SQL = 'SELECT data FROM Example WHERE data BETWEEN 32 AND 33'; Notice the seek operator only has one predicate now – it’s just a single range scan from 32 to 33 in the index – as the SE output shows.  For the next test, we will look up four values in the key_col column: EXECUTE dbo.RunTest @SQL = 'SELECT key_col FROM Example WHERE key_col IN (2,4,6,8)'; Just a single seek on the PK from the Query Executor, but four singleton lookups reported by the Storage Engine – and four seek predicates in the Properties window.  On to a more complex example: EXECUTE dbo.RunTest @SQL = 'SELECT * FROM Example WITH (INDEX([PK dbo.Example key_col])) WHERE key_col BETWEEN 1 AND 8'; This time we are forcing use of the non-clustered primary key to return eight rows.  The index is not covering for this query, so the query plan includes an RID lookup into the heap to fetch the data and padding columns.  The QE reports a seek on the PK and a lookup on the heap.  The SE reports a single range scan on the PK (to find key_col values between 1 and 8), and eight singleton lookups on the heap.  Remember that a bookmark lookup (RID or Key) is a seek to a single value in a ‘unique index’ – it finds a row in the heap or cluster from a unique RID or clustering key – so that’s why lookups are always singleton lookups, not range scans. Our next example shows what happens when a query plan operator is not executed at all: EXECUTE dbo.RunTest @SQL = 'SELECT key_col FROM Example WHERE key_col = 8 AND @@TRANCOUNT < 0'; The Filter has a start-up predicate which is always false (if your @@TRANCOUNT is less than zero, call CSS immediately).  The index seek is never executed, but QE still records a single seek against the PK because the operator appears once in an executed plan.  The SE output shows no activity at all.  This next example is 2008 and above only, I’m afraid: EXECUTE dbo.RunTest @SQL = 'SELECT * FROM Example WHERE key_col BETWEEN 1 AND 30', @Partitioned = 'true'; This is the first example to use a partitioned table.  QE reports a single seek on the heap (yes – a seek on a heap), and the SE reports two range scans on the heap.  SQL Server knows (from the partitioning definition) that it only needs to look at partitions 1 and 2 to find all the rows where key_col is between 1 and 30 – the engine seeks to find the two partitions, and performs a range scan seek on each partition. The final example for today is another seek on a heap – try to work out the output of the query before running it! EXECUTE dbo.RunTest @SQL = 'SELECT TOP (2) WITH TIES * FROM Example WHERE key_col BETWEEN 1 AND 50 ORDER BY $PARTITION.PF(key_col) DESC', @Partitioned = 'true'; Notice the lack of an explicit Sort operator in the query plan to enforce the ORDER BY clause, and the backward range scan. © 2011 Paul White email: [email protected] twitter: @SQL_Kiwi

    Read the article

  • Is there a pattern or best practice for passing a reference type to multiple classes vs a static class?

    - by Dave
    My .NET application creates HTML files, and as such, the structure looks like variable myData BuildHomePage() variable graph = new BuildGraphPage(myData) variable table = BuildTablePage(myData) BuildGraphPage and BuildTablePage both require access data, the myData object. In the above example, I've passed the myData object to 2 constructors. This is what I'm doing now, in my current project. The myData object, and it's properties are all readonly. The problem is, the number of pages which will require this object has grown. In the real project, there are currently 4, but the new spec is to have about 20. Passing this object to the constructor of each new object and assigning it to a field is a little time consuming, but not a hardship! This poses the question whether it's better practice to continue as I have, or to refactor and create a new static class for myData which can be referenced from any where in my project. I guess my abilities to use Google are poor, because I did try and find an appropriate pattern as I am sure this type of design must be common place but my results returned nothing. Is there a pattern which is suited, or do best practices lean towards one implementation over another.

    Read the article

  • Code maintenance: keeping a bad pattern when extending new code for being consistent or not ?

    - by Guillaume
    I have to extend an existing module of a project. I don't like the way it has been done (lots of anti-pattern involved, like copy/pasted code). I don't want to perform a complete refactor. Should I: create new methods using existing convention, even if I feel it wrong, to avoid confusion for the next maintainer and being consistent with the code base? or try to use what I feel better even if it is introducing another pattern in the code ? Precison edited after first answers: The existing code is not a mess. It is easy to follow and understand. BUT it is introducing lots of boilerplate code that can be avoided with good design (resulting code might become harder to follow then). In my current case it's a good old JDBC (spring template inboard) DAO module, but I have already encounter this dilemma and I'm seeking for other dev feedback. I don't want to refactor because I don't have time. And even with time it will be hard to justify that a whole perfectly working module needs refactoring. Refactoring cost will be heavier than its benefits. Remember: code is not messy or over-complex. I can not extract few methods there and introduce an abstract class here. It is more a flaw in the design (result of extreme 'Keep It Stupid Simple' I think) So the question can also be asked like that: You, as developer, do you prefer to maintain easy stupid boring code OR to have some helpers that will do the stupid boring code at your place ? Downside of the last possibility being that you'll have to learn some stuff and maybe you will have to maintain the easy stupid boring code too until a full refactoring is done)

    Read the article

  • Is there a name for the Builder Pattern where the Builder is implemented via interfaces so certain parameters are required?

    - by Zipper
    So we implemented the builder pattern for most of our domain to help in understandability of what actually being passed to a constructor, and for the normal advantages that a builder gives. The one twist was that we exposed the builder through interfaces so we could chain required functions and unrequired functions to make sure that the correct parameters were passed. I was curious if there was an existing pattern like this. Example below: public class Foo { private int someThing; private int someThing2; private DateTime someThing3; private Foo(Builder builder) { this.someThing = builder.someThing; this.someThing2 = builder.someThing2; this.someThing3 = builder.someThing3; } public static RequiredSomething getBuilder() { return new Builder(); } public interface RequiredSomething { public RequiredDateTime withSomething (int value); } public interface RequiredDateTime { public OptionalParamters withDateTime (DateTime value); } public interface OptionalParamters { public OptionalParamters withSeomthing2 (int value); public Foo Build ();} public static class Builder implements RequiredSomething, RequiredDateTime, OptionalParamters { private int someThing; private int someThing2; private DateTime someThing3; public RequiredDateTime withSomething (int value) {someThing = value; return this;} public OptionalParamters withDateTime (int value) {someThing = value; return this;} public OptionalParamters withSeomthing2 (int value) {someThing = value; return this;} public Foo build(){return new Foo(this);} } } Example of how it's called: Foo foo = Foo.getBuilder().withSomething(1).withDateTime(DateTime.now()).build(); Foo foo2 = Foo.getBuilder().withSomething(1).withDateTime(DateTime.now()).withSomething2(3).build();

    Read the article

  • Are first-class functions a substitute for the Strategy pattern?

    - by Prog
    The Strategy design pattern is often regarded as a substitute for first-class functions in languages that lack them. So for example say you wanted to pass functionality into an object. In Java you'd have to pass in the object another object which encapsulates the desired behavior. In a language such as Ruby, you'd just pass the functionality itself in the form of an annonymous function. However I was thinking about it and decided that maybe Strategy offers more than a plain annonymous function does. This is because an object can hold state that exists independently of the period when it's method runs. However an annonymous function by itself can only hold state that ceases to exist the moment the function finishes execution. So my question is: when using a language that features first-class functions, would you ever use the Strategy pattern (i.e. encapsulate the functionality you want to pass around in an explicit object), or would you always use an annonymous function? When would you decide to use Strategy when you can use a first-class function?

    Read the article

  • Is event sourcing ready for prime time?

    - by Dakotah North
    Event Sourcing was popularized by LMAX as a means to provide speed, performance scalability, transparent persistence and transparent live mirroring. Before being rebranded as Event Sourcing, this type of architectural pattern was known as System Prevalence but yet I was never familiar with this pattern before the LMAX team went public. Has this pattern proved itself in numerous production systems and therefore even conservative individuals should feel empowered to embrace this pattern or is event sourcing / system prevalence an exotic pattern that is best left for the fearless?

    Read the article

  • GIT repository layout for server with multiple projects

    - by Paul Alexander
    One of the things I like about the way I have Subversion set up is that I can have a single main repository with multiple projects. When I want to work on a project I can check out just that project. Like this \main \ProductA \ProductB \Shared then svn checkout http://.../main/ProductA As a new user to git I want to explore a bit of best practice in the field before committing to a specific workflow. From what I've read so far, git stores everything in a single .git folder at the root of the project tree. So I could do one of two things. Set up a separate project for each Product. Set up a single massive project and store products in sub folders. There are dependencies between the products, so the single massive project seems appropriate. We'll be using a server where all the developers can share their code. I've already got this working over SSH & HTTP and that part I love. However, the repositories in SVN are already many GB in size so dragging around the entire repository on each machine seems like a bad idea - especially since we're billed for excessive network bandwidth. I'd imagine that the Linux kernel project repositories are equally large so there must be a proper way of handling this with Git but I just haven't figured it out yet. Are there any guidelines or best practices for working with very large multi-project repositories?

    Read the article

  • Linq to SQL, Repository, IList and Persist All

    - by Dr. Zim
    This discusses a repository which returns IList that also uses Linq to SQL as a DAL. Once you do a .ToList(), IQueryable object is gone once you exit the Repository. This means that I need to send the objects back in to the Repo methods .Create(Model model), .Update(Model model), and .Delete(int ID). Assuming that is correct, how do you do the PersistAll()? For example, if you did the following, how would you code that in the repository? Changed a single string property in the object Called .Update(object); Changed a different string property in the object Called .Update(object); Called .PersistAll(), which would update the database with both changed strings. How would you associate the objects in the Repository parameters with the objects in the Linq to Sql data context, especially over multiple calls? I am sure this is a standard thing. Links to examples on the web would be great!

    Read the article

  • Replace with wildcard, in SQL

    - by Jay
    I know MS T-SQL does not support regular expression, but I need similar functionality. Here's what I'm trying to do: I have a varchar table field which stores a breadcrumb, like this: /ID1:Category1/ID2:Category2/ID3:Category3/ Each Category name is preceded by its Category ID, separated by a colon. I'd like to select and display these breadcrumbs but I want to remove the Category IDs and colons, like this: /Category1/Category2/Category3/ Everything between the leading slash (/) up to and including the colon (:) should be stripped out. I don't have the option of extracting the data, manipulating it externally, and re-inserting back into the table; so I'm trying to accomplish this in a SELECT statement. I also can't resort to using a cursor to loop through each row and clean each field with a nested loop, due to the number of rows returned in the SELECT. Can this be done? Thanks all - Jay

    Read the article

  • Javascript regex URL matching

    - by Blondie
    I have this so far: chrome.tabs.getSelected(null, function(tab) { var title = tab.title; var btn = '<a href="' + tab.url + '" onclick="save(\'' + title + '\');"> ' + title + '</a>'; if(tab.url.match('/http:\/\/www.mydomain.com\/version.php/i')) { document.getElementById('link').innerHTML = '<p>' + btn + '</p>'; } }); Basically it should match the domain within this: http://www.mydomain.com/version.php?* Anything that matches that even when it includes something like version.php?ver=1, etc When I used the code above of mine, it doesn't display anything, but when I remove the if statement, it's fine but it shows on other pages which it shouldn't only on the matched URL.

    Read the article

  • How can I write a clean Repository without exposing IQueryable to the rest of my application?

    - by Simucal
    So, I've read all the Q&A's here on SO regarding the subject of whether or not to expose IQueryable to the rest of your project or not (see here, and here), and I've ultimately decided that I don't want to expose IQueryable to anything but my Model. Because IQueryable is tied to certain persistence implementations I don't like the idea of locking myself into this. Similarly, I'm not sure how good I feel about classes further down the call chain modifying the actual query that aren't in the repository. So, does anyone have any suggestions for how to write a clean and concise Repository without doing this? One problem I see, is my Repository will blow up from a ton of methods for various things I need to filter my query off of. Having a bunch of: IEnumerable GetProductsSinceDate(DateTime date); IEnumberable GetProductsByName(string name); IEnumberable GetProductsByID(int ID); If I was allowing IQueryable to be passed around I could easily have a generic repository that looked like: public interface IRepository<T> where T : class { T GetById(int id); IQueryable<T> GetAll(); void InsertOnSubmit(T entity); void DeleteOnSubmit(T entity); void SubmitChanges(); } However, if you aren't using IQueryable then methods like GetAll() aren't really practical since lazy evaluation won't be taking place down the line. I don't want to return 10,000 records only to use 10 of them later. What is the answer here? In Conery's MVC Storefront he created another layer called the "Service" layer which received IQueryable results from the respository and was responsible for applying various filters. Is this what I should do, or something similar? Have my repository return IQueryable but restrict access to it by hiding it behind a bunch of filter classes like GetProductByName, which will return a concrete type like IList or IEnumerable?

    Read the article

  • Using C# and Repository Factory and the error: The requested database is not defined in configurati

    - by odiseh
    hi I am using Repository factory for visual studio 2008 for a personal project. It generated a class called ProductRepository which inherits from Repository. The ProductRepository has a constructor which gets a database name as string and passes it to its base (I mean Repository ). So when I try to debug my project step by step, I pass my database name to ProductRepository but it raises the following error: The requested database is not defined in configuration. What's wrong?

    Read the article

  • Very simple regex not working

    - by Thomas Wanner
    I have read that to match a word inside of a string using Regular expressions (in .NET), I can use the word boundary specifier (\b) within the regex. However, none of these calls result in any matches Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\b@p1\b"); Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\bINSERT\b"); Is there anything I am doing wrong ?

    Read the article

  • What is good practice in .NET system architecture design concerning multiple models and aggregates

    - by BuzzBubba
    I'm designing a larger enterprise architecture and I'm in a doubt about how to separate the models and design those. There are several points I'd like suggestions for: - models to define - way to define models Currently my idea is to define: Core (domain) model Repositories to get data to that domain model from a database or other store Business logic model that would contain business logic, validation logic and more specific versions of forms of data retrieval methods View models prepared for specifically formated data output that would be parsed by views of different kind (web, silverlight, etc). For the first model I'm puzzled at what to use and how to define the mode. Should this model entities contain collections and in what form? IList, IEnumerable or IQueryable collections? - I'm thinking of immutable collections which IEnumerable is, but I'd like to avoid huge data collections and to offer my Business logic layer access with LINQ expressions so that query trees get executed at Data level and retrieve only really required data for situations like the one when I'm retrieving a very specific subset of elements amongst thousands or hundreds of thousands. What if I have an item with several thousands of bids? I can't just make an IEnumerable collection of those on the model and then retrieve an item list in some Repository method or even Business model method. Should it be IQueryable so that I actually pass my queries to Repository all the way from the Business logic model layer? Should I just avoid collections in my domain model? Should I void only some collections? Should I separate Domain model and BusinessLogic model or integrate those? Data would be dealt trough repositories which would use Domain model classes. Should repositories be used directly using only classes from domain model like data containers? This is an example of what I had in mind: So, my Domain objects would look like (e.g.) public class Item { public string ItemName { get; set; } public int Price { get; set; } public bool Available { get; set; } private IList<Bid> _bids; public IQueryable<Bid> Bids { get { return _bids.AsQueryable(); } private set { _bids = value; } } public AddNewBid(Bid newBid) { _bids.Add(new Bid {.... } } Where Bid would be defined as a normal class. Repositories would be defined as data retrieval factories and used to get data into another (Business logic) model which would again be used to get data to ViewModels which would then be rendered by different consumers. I would define IQueryable interfaces for all aggregating collections to get flexibility and minimize data retrieved from real data store. Or should I make Domain Model "anemic" with pure data store entities and all collections define for business logic model? One of the most important questions is, where to have IQueryable typed collections? - All the way from Repositories to Business model or not at all and expose only solid IList and IEnumerable from Repositories and deal with more specific queries inside Business model, but have more finer grained methods for data retrieval within Repositories. So, what do you think? Have any suggestions?

    Read the article

  • Custom Django admin URL + changelist view for custom list filter by Tags

    - by Botondus
    In django admin I wanted to set up a custom filter by tags (tags are introduced with django-tagging) I've made the ModelAdmin for this and it used to work fine, by appending custom urlconf and modifying the changelist view. It should work with URLs like: http://127.0.0.1:8000/admin/reviews/review/only-tagged-vista/ But now I get 'invalid literal for int() with base 10: 'only-tagged-vista', error which means it keeps matching the review edit page instead of the custom filter page, and I cannot figure out why since it used to work and I can't find what change might have affected this. Any help appreciated. Relevant code: class ReviewAdmin(VersionAdmin): def changelist_view(self, request, extra_context=None, **kwargs): from django.contrib.admin.views.main import ChangeList cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, self.list_per_page, self.list_editable, self) cl.formset = None if extra_context is None: extra_context = {} if kwargs.get('only_tagged'): tag = kwargs.get('tag') cl.result_list = cl.result_list.filter(tags__icontains=tag) extra_context['extra_filter'] = "Only tagged %s" % tag extra_context['cl'] = cl return super(ReviewAdmin, self).changelist_view(request, extra_context=extra_context) def get_urls(self): from django.conf.urls.defaults import patterns, url urls = super(ReviewAdmin, self).get_urls() def wrap(view): def wrapper(*args, **kwargs): return self.admin_site.admin_view(view)(*args, **kwargs) return update_wrapper(wrapper, view) info = self.model._meta.app_label, self.model._meta.module_name my_urls = patterns('', # make edit work from tagged filter list view # redirect to normal edit view url(r'^only-tagged-\w+/(?P<id>.+)/$', redirect_to, {'url': "/admin/"+self.model._meta.app_label+"/"+self.model._meta.module_name+"/%(id)s"} ), # tagged filter list view url(r'^only-tagged-(P<tag>\w+)/$', self.admin_site.admin_view(self.changelist_view), {'only_tagged':True}, name="changelist_view"), ) return my_urls + urls Edit: Original issue fixed. I now receive 'Cannot filter a query once a slice has been taken.' for line: cl.result_list = cl.result_list.filter(tags__icontains=tag) I'm not sure where this result list is sliced, before tag filter is applied. Edit2: It's because of the self.list_per_page in ChangeList declaration. However didn't find a proper solution yet. Temp fix: if kwargs.get('only_tagged'): list_per_page = 1000000 else: list_per_page = self.list_per_page cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, list_per_page, self.list_editable, self)

    Read the article

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

< Previous Page | 48 49 50 51 52 53 54 55 56 57 58 59  | Next Page >