Search Results

Search found 46878 results on 1876 pages for 'function location'.

Page 54/1876 | < Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >

• LogonUser function (2 replies)

  I am trying to access a server using LogonUser function as follows Dim returnValue As Boolean LogonUser(Domain\UserName, MachineName, password, LOGON32 LOGON NEW CREDENTIALS, LOGON32 PROVIDER DEFAULT, tokenHandle) I get a token, and seems to me that I get authenticated. However when I execute the following Dim AllCountersCategories As PerformanceCounterCategory() PerformanceCounterCategory.GetCate...

  Read the article

• Why am I getting 'Argument count mismatch' error here?

  - by Leon

  I have a Document class, Intro class and Nav class. The Intro class runs first, then sends a custom dispatch event to run the Nav class, but I'm getting this error: removed Intro ArgumentError: Error #1063: Argument count mismatch on com.secrettowriting.StanPlayer.ui::Navigation/addNav(). Expected 0, got 1. at flash.events::EventDispatcher/dispatchEventFunction() at flash.events::EventDispatcher/dispatchEvent() at com.secrettowriting.StanPlayer.display::Intro/removeIntro() at flash.utils::Timer/_timerDispatch() at flash.utils::Timer/tick() The addNav function in the Navigation class should expect 0 arguments/variables and I'm not sending any arguments/variables to it, which is why I'm confused as to why it's saying I'm getting 1. My Document Class: public function HomePlayer():void { if (stage) init(); else addEventListener(Event.ADDED_TO_STAGE, init); } private function init(e:Event = null):void { removeEventListener(Event.ADDED_TO_STAGE, init); stage.scaleMode = StageScaleMode.NO_SCALE; stage.align = StageAlign.TOP_LEFT; // Use when Live //videoURL = this.loaderInfo.parameters.theVIDEO; // Get the Video URL from HTML // Remove when video testing ready videoURL = "videos/WhatDifferentiatesUs.flv"; drawNav(); drawIntro(); } private function drawIntro():void { intro = new Intro(); intro.drawIntro(); intro.addEventListener("onComplete", nav.addNav); stage.addChild(intro); } private function drawNav():void { nav = new Navigation(); nav.drawNav(); stage.addChild(nav); } Intro Class: Public function Intro():void { if (stage) init(); else addEventListener(Event.ADDED_TO_STAGE, init); } private function init(e:Event = null):void { removeEventListener(Event.ADDED_TO_STAGE, init); } public function drawIntro():void { introMov = new IntroMov(); introMov.alpha = 0; addChild(introMov); TweenLite.to(introMov, 3, {alpha:1}); // Timer introFader = new Timer(INTRO_DELAY); introFader.addEventListener(TimerEvent.TIMER, fadeIntro); introFader.start(); introRemover = new Timer(INTRO_DELAY); introRemover.addEventListener(TimerEvent.TIMER, removeIntro); } private function fadeIntro(e:TimerEvent):void { if (i < 30){ i++ } else if (i == 30){ TweenLite.to(introMov, 1.5, {alpha:0}); introFader.removeEventListener(TimerEvent.TIMER, fadeIntro); introRemover.start(); } } private function removeIntro(e:TimerEvent):void { if (n < 10){ n++ } else if (n == 10){ introRemover.removeEventListener(TimerEvent.TIMER, removeIntro); removeChild(introMov); trace("removed Intro"); dispatchEvent (new CustomEvent(CustomEvent.COMPLETE, {})); // ? Intro to Navigation } } Navigation Class functions: public function drawNav():void { weAreA = new WeAreA(); weAreA.alpha = 0; weAreA.x = 20; weAreA.y = 35; introText = new IntroText(); introText.alpha = 0; introText.x = 20; introText.y = 124; chooseAVideo = new ChooseAVideo(); chooseAVideo.alpha = 0; chooseAVideo.x = 20; chooseAVideo.y = 336; } public function addNav():void { addChild(weAreA); addChild(introText); addChild(chooseAVideo); TweenLite.to(weAreA, 2, {alpha:1}); TweenLite.to(introText, 3, {alpha:1}); TweenLite.to(introText, 3, {alpha:1}); }

  Read the article

• Skyrim: Heavy Performance Issues after a couple of location changes

  - by Derija

  Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

  Read the article

• filtering itunes library items by file location

  - by Cawas

  3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

  Read the article

• Compare 2 sets of data in Excel and returning a value when multiple columns match

  - by Susan C

  I have a data set for employees that contains name and 3 attributes (job function, job grade and location). I then have a data set for open positions that contains the requisition number and 3 attributes (job function, job grade and job location). For every employee, i would like the three attributes associated with them compared to the same three attributes of the open positions and have the cooresponding requisition numbers displayed for each employee where there is a match.

  Read the article

• Metro: Promises

  - by Stephen.Walther

  The goal of this blog entry is to describe the Promise class in the WinJS library. You can use promises whenever you need to perform an asynchronous operation such as retrieving data from a remote website or a file from the file system. Promises are used extensively in the WinJS library. Asynchronous Programming Some code executes immediately, some code requires time to complete or might never complete at all. For example, retrieving the value of a local variable is an immediate operation. Retrieving data from a remote website takes longer or might not complete at all. When an operation might take a long time to complete, you should write your code so that it executes asynchronously. Instead of waiting for an operation to complete, you should start the operation and then do something else until you receive a signal that the operation is complete. An analogy. Some telephone customer service lines require you to wait on hold – listening to really bad music – until a customer service representative is available. This is synchronous programming and very wasteful of your time. Some newer customer service lines enable you to enter your telephone number so the customer service representative can call you back when a customer representative becomes available. This approach is much less wasteful of your time because you can do useful things while waiting for the callback. There are several patterns that you can use to write code which executes asynchronously. The most popular pattern in JavaScript is the callback pattern. When you call a function which might take a long time to return a result, you pass a callback function to the function. For example, the following code (which uses jQuery) includes a function named getFlickrPhotos which returns photos from the Flickr website which match a set of tags (such as “dog” and “funny”): function getFlickrPhotos(tags, callback) { $.getJSON( "http://api.flickr.com/services/feeds/photos_public.gne?jsoncallback=?", { tags: tags, tagmode: "all", format: "json" }, function (data) { if (callback) { callback(data.items); } } ); } getFlickrPhotos("funny, dogs", function(data) { $.each(data, function(index, item) { console.log(item); }); }); The getFlickr() function includes a callback parameter. When you call the getFlickr() function, you pass a function to the callback parameter which gets executed when the getFlicker() function finishes retrieving the list of photos from the Flickr web service. In the code above, the callback function simply iterates through the results and writes each result to the console. Using callbacks is a natural way to perform asynchronous programming with JavaScript. Instead of waiting for an operation to complete, sitting there and listening to really bad music, you can get a callback when the operation is complete. Using Promises The CommonJS website defines a promise like this (http://wiki.commonjs.org/wiki/Promises): “Promises provide a well-defined interface for interacting with an object that represents the result of an action that is performed asynchronously, and may or may not be finished at any given point in time. By utilizing a standard interface, different components can return promises for asynchronous actions and consumers can utilize the promises in a predictable manner.” A promise provides a standard pattern for specifying callbacks. In the WinJS library, when you create a promise, you can specify three callbacks: a complete callback, a failure callback, and a progress callback. Promises are used extensively in the WinJS library. The methods in the animation library, the control library, and the binding library all use promises. For example, the xhr() method included in the WinJS base library returns a promise. The xhr() method wraps calls to the standard XmlHttpRequest object in a promise. The following code illustrates how you can use the xhr() method to perform an Ajax request which retrieves a file named Photos.txt: var options = { url: "/data/photos.txt" }; WinJS.xhr(options).then( function (xmlHttpRequest) { console.log("success"); var data = JSON.parse(xmlHttpRequest.responseText); console.log(data); }, function(xmlHttpRequest) { console.log("fail"); }, function(xmlHttpRequest) { console.log("progress"); } ) The WinJS.xhr() method returns a promise. The Promise class includes a then() method which accepts three callback functions: a complete callback, an error callback, and a progress callback: Promise.then(completeCallback, errorCallback, progressCallback) In the code above, three anonymous functions are passed to the then() method. The three callbacks simply write a message to the JavaScript Console. The complete callback also dumps all of the data retrieved from the photos.txt file. Creating Promises You can create your own promises by creating a new instance of the Promise class. The constructor for the Promise class requires a function which accepts three parameters: a complete, error, and progress function parameter. For example, the code below illustrates how you can create a method named wait10Seconds() which returns a promise. The progress function is called every second and the complete function is not called until 10 seconds have passed: (function () { "use strict"; var app = WinJS.Application; function wait10Seconds() { return new WinJS.Promise(function (complete, error, progress) { var seconds = 0; var intervalId = window.setInterval(function () { seconds++; progress(seconds); if (seconds > 9) { window.clearInterval(intervalId); complete(); } }, 1000); }); } app.onactivated = function (eventObject) { if (eventObject.detail.kind === Windows.ApplicationModel.Activation.ActivationKind.launch) { wait10Seconds().then( function () { console.log("complete") }, function () { console.log("error") }, function (seconds) { console.log("progress:" + seconds) } ); } } app.start(); })(); All of the work happens in the constructor function for the promise. The window.setInterval() method is used to execute code every second. Every second, the progress() callback method is called. If more than 10 seconds have passed then the complete() callback method is called and the clearInterval() method is called. When you execute the code above, you can see the output in the Visual Studio JavaScript Console. Creating a Timeout Promise In the previous section, we created a custom Promise which uses the window.setInterval() method to complete the promise after 10 seconds. We really did not need to create a custom promise because the Promise class already includes a static method for returning promises which complete after a certain interval. The code below illustrates how you can use the timeout() method. The timeout() method returns a promise which completes after a certain number of milliseconds. WinJS.Promise.timeout(3000).then( function(){console.log("complete")}, function(){console.log("error")}, function(){console.log("progress")} ); In the code above, the Promise completes after 3 seconds (3000 milliseconds). The Promise returned by the timeout() method does not support progress events. Therefore, the only message written to the console is the message “complete” after 10 seconds. Canceling Promises Some promises, but not all, support cancellation. When you cancel a promise, the promise’s error callback is executed. For example, the following code uses the WinJS.xhr() method to perform an Ajax request. However, immediately after the Ajax request is made, the request is cancelled. // Specify Ajax request options var options = { url: "/data/photos.txt" }; // Make the Ajax request var request = WinJS.xhr(options).then( function (xmlHttpRequest) { console.log("success"); }, function (xmlHttpRequest) { console.log("fail"); }, function (xmlHttpRequest) { console.log("progress"); } ); // Cancel the Ajax request request.cancel(); When you run the code above, the message “fail” is written to the Visual Studio JavaScript Console. Composing Promises You can build promises out of other promises. In other words, you can compose promises. There are two static methods of the Promise class which you can use to compose promises: the join() method and the any() method. When you join promises, a promise is complete when all of the joined promises are complete. When you use the any() method, a promise is complete when any of the promises complete. The following code illustrates how to use the join() method. A new promise is created out of two timeout promises. The new promise does not complete until both of the timeout promises complete: WinJS.Promise.join([WinJS.Promise.timeout(1000), WinJS.Promise.timeout(5000)]) .then(function () { console.log("complete"); }); The message “complete” will not be written to the JavaScript Console until both promises passed to the join() method completes. The message won’t be written for 5 seconds (5,000 milliseconds). The any() method completes when any promise passed to the any() method completes: WinJS.Promise.any([WinJS.Promise.timeout(1000), WinJS.Promise.timeout(5000)]) .then(function () { console.log("complete"); }); The code above writes the message “complete” to the JavaScript Console after 1 second (1,000 milliseconds). The message is written to the JavaScript console immediately after the first promise completes and before the second promise completes. Summary The goal of this blog entry was to describe WinJS promises. First, we discussed how promises enable you to easily write code which performs asynchronous actions. You learned how to use a promise when performing an Ajax request. Next, we discussed how you can create your own promises. You learned how to create a new promise by creating a constructor function with complete, error, and progress parameters. Finally, you learned about several advanced methods of promises. You learned how to use the timeout() method to create promises which complete after an interval of time. You also learned how to cancel promises and compose promises from other promises.

  Read the article

• Procedure or function has too many arguments specified

  - by bullpit

  This error took me a while to figure out. I was using SqlDataSource with stored procedures for SELECT and UPDATE commands. The SELECT worked fine. Then I added UPDATE command and while trying to update, I would get this error: "Procedure of function has too many arguments specified" Apparently, good guys at .NET decided it is necessary to send SELECT parameters with the UPDATE command as well. So when I was sending the required parameters to the UPDATE sp, in reality, it was also getting my SELECT parameters, and thus failing. I had to add the extra parameters in the UPDATE stored procedure and make them NULLABLE so that they are not required....phew... Here is piece of SP with unused parameters. ALTER PROCEDURE [dbo].[UpdateMaintenanceRecord]        @RecordID INT     ,@District VARCHAR(255)     ,@Location VARCHAR(255)         --UNUSED PARAMETERS     ,@MTBillTo VARCHAR(255) = NULL     ,@SerialNumber VARCHAR(255) = NULL     ,@PartNumber VARCHAR(255) = NULL Update: I was getting that error because unkowingly, I had bound the extra fields in my GridVeiw with Bind() call. I changed all the extra one's, which did not need to be in Update, to Eval() and everything works fine.

  Read the article

• How can I design my classes to include calendar events stored in a database?

  - by Gianluca78

  I'm developing a web calendar in php (using Symfony2) inspired by iCal for a project of mine. At this moment, I have two classes: a class "Calendar" and a class "CalendarCell". Here you are the two classes properties and method declarations. class Calendar { private $month; private $monthName; private $year; private $calendarCellList = array(); private $translator; public function __construct($month, $year, $translator) {} public function getCalendarCellList() {} public function getMonth() {} public function getMonthName() {} public function getNextMonth() {} public function getNextYear() {} public function getPreviousMonth() {} public function getPreviousYear() {} public function getYear() {} private function calculateDaysPreviousMonth() {} private function calculateNumericDayOfTheFirstDayOfTheWeek() {} private function isCurrentDay(\DateTime $dateTime) {} private function isDifferentMonth(\DateTime $dateTime) {} } class CalendarCell { private $day; private $month; private $dayNameAbbreviation; private $numericDayOfTheWeek; private $isCurrentDay; private $isDifferentMonth; private $translator; public function __construct(array $parameters) {} public function getDay() {} public function getMonth() {} public function getDayNameAbbreviation() {} public function isCurrentDay() {} public function isDifferentMonth() {} } Each calendar day can includes many calendar events (such as appointments or schedules) stored in a database. My question is: which is the best way to manage these calendar events in my classes? I think to add a eventList property in CalendarCell and populate it with an array of CalendarEvent objects fetched by the database. This kind of solution doesn't allow other coders to reuse the classes without db (because I should inject at least a repository services also) just to create and visualize a calendar... so maybe it could be better to extend CalendarCell (for instance in CalendarCellEvent) and add the database features? I feel like I'm missing some crucial design pattern! Any suggestion will be very appreciated!

  Read the article

• How can I design my classes for a calendar based on database events?

  - by Gianluca78

  I'm developing a web calendar in php (using Symfony2) inspired by iCal for a project of mine. At this moment, I have two classes: a class "Calendar" and a class "CalendarCell". Here you are the two classes properties and method declarations. class Calendar { private $month; private $monthName; private $year; private $calendarCellList = array(); private $translator; public function __construct($month, $year, $translator) {} public function getCalendarCells() {} public function getMonth() {} public function getMonthName() {} public function getNextMonth() {} public function getNextYear() {} public function getPreviousMonth() {} public function getPreviousYear() {} public function getYear() {} private function calculateDaysPreviousMonth() {} private function calculateNumericDayOfTheFirstDayOfTheWeek() {} private function isCurrentDay(\DateTime $dateTime) {} private function isDifferentMonth(\DateTime $dateTime) {} } class CalendarCell { private $day; private $month; private $dayNameAbbreviation; private $numericDayOfTheWeek; private $isCurrentDay; private $isDifferentMonth; private $translator; public function __construct(array $parameters) {} public function getDay() {} public function getMonth() {} public function getDayNameAbbreviation() {} public function isCurrentDay() {} public function isDifferentMonth() {} } Each calendar day can includes many events stored in a database. My question is: which is the best way to manage these events in my classes? I think to add a eventList property in CalendarCell and populate it with an array of CalendarEvent objects fetched by the database. This kind of solution doesn't allow other coders to reuse the classes without db (because I should inject at least a repository services also) just to create and visualize a calendar... so maybe it could be better to extend CalendarCell (for instance in CalendarCellEvent) and add the database features? I feel like I'm missing some crucial design pattern! Any suggestion will be very appreciated!

  Read the article

• What are those little useful ,customize/enhanced php functions that you wish you knew about 2 years

  - by I Like PHP

  Hello All, i like to work in php bcoz it's just amazing language. please share basic, useful, enhanced and customize function that make things better and easy in php and must be used in our all PHP project, i m sharing some of them please share your customize function that may be useful for everyone alternative/ enhanced print_r() and var_dump() function watch( $what ) { echo '<pre>'; if ( is_array( $what ) ) { print_r ( $what ); } else { var_dump ( $what ); } echo '</pre>'; } usage: 1. watch($_POST); // to see all post variable 2. watch($array); // to see any variable may b array, string or a variable enhanced mysql_escape_string() for multidimensional array to prevent sql injection function recursive_escape(&$value) { if (is_array($value)) array_map('recursive_escape', $value); else $value = mysql_escape_string($value); } usage array_map('recursive_escape', $_POST); ---------------------For encoding Get variables-------------------------------------- function nkode($k) { if ( is_array( $k ) ) return array_map("base64_encode",$k); else return base64_encode($k); } ---------------------for decoding varaibles from GET--------------------------------- function dkode($k) { if ( is_array( $k ) ) return array_map("base64_decode",$k); else return base64_decode($k); } Usage <a href="somelink.php?pid=<?php echo nkode($someid)?>"> and on next page(somelink.php) $findID=dkode($_GET[pid]); date convert to mm/dd/yyyy to yyyy-mm-dd( if we use date datatype in mysql) and also change into mm/dd/yyyy to disply on page function dateconvert($date,$func) { if ($func == 1){ //insert conversion list($month, $day, $year) = split('[/.-]', $date); $date = "$year-$month-$day"; return $date; } if ($func == 2){ //output conversion list($year, $month, $day) = split('[-.]', $date); $date = "$month/$day/$year"; return $date; } } usage $firstDate=dateconvert($_POST['firstdate'],1); // for insertion in database $showDate=dateconvert($fetch->date_field,2) // to display on browser to clean data before doing some action with that variable function cleanID($data) { $success=0; $data=trim($data); $data=strtolower($data); $data=strip_tags($data); return $data; } usage cleanID($_POST[username]); cleanID($_GET[pid]); please share any basic function that must be used , and please give me some suggestion to make above function more better Thanks

  Read the article

• c++ : looking away to implemnt this senario

  - by user63898

  Hi im looking to find how to implement this scenario: i have logic code that is inside function, now i like to be able to execute this function in a separate thread. now what i have is a raw implementation of this .. i simple Init the Thread that in its Start/Run method i keep the function logic . how can i make it more generic ? so i could send the function ( mybe function pointer ) to generic thread factory/pool ? in c++

  Read the article

• Algorithm for dynamic combinations

  - by sOltan

  My code has a list called INPUTS, that contains a dynamic number of lists, let's call them A, B, C, .. N. These lists contain a dynamic number of Events I would like to call a function with each combination of Events. To illustrate with an example: INPUTS: A(0,1,2), B(0,1), C(0,1,2,3) I need to call my function this many times for each combination (the input count is dynamic, in this example it is three parameter, but it can be more or less) function(A[0],B[0],C[0]) function(A[0],B[1],C[0]) function(A[0],B[0],C[1]) function(A[0],B[1],C[1]) function(A[0],B[0],C[2]) function(A[0],B[1],C[2]) function(A[0],B[0],C[3]) function(A[0],B[1],C[3]) function(A[1],B[0],C[0]) function(A[1],B[1],C[0]) function(A[1],B[0],C[1]) function(A[1],B[1],C[1]) function(A[1],B[0],C[2]) function(A[1],B[1],C[2]) function(A[1],B[0],C[3]) function(A[1],B[1],C[3]) function(A[2],B[0],C[0]) function(A[2],B[1],C[0]) function(A[2],B[0],C[1]) function(A[2],B[1],C[1]) function(A[2],B[0],C[2]) function(A[2],B[1],C[2]) function(A[2],B[0],C[3]) function(A[2],B[1],C[3]) This is what I have thought of so far: My approach so far is to build a list of combinations. The element combination is itself a list of "index" to the input arrays A, B and C. For our example: my list iCOMBINATIONS contains the following iCOMBO lists (0,0,0) (0,1,0) (0,0,1) (0,1,1) (0,0,2) (0,1,2) (0,0,3) (0,1,3) (1,0,0) (1,1,0) (1,0,1) (1,1,1) (1,0,2) (1,1,2) (1,0,3) (1,1,3) (2,0,0) (2,1,0) (2,0,1) (2,1,1) (2,0,2) (2,1,2) (2,0,3) (2,1,3) Then I would do this: foreach( iCOMBO in iCOMBINATIONS) { foreach ( P in INPUTS ) { COMBO.Clear() foreach ( i in iCOMBO ) { COMBO.Add( P[ iCOMBO[i] ] ) } function( COMBO ) --- (instead of passing the events separately) } } But I need to find a way to build the list iCOMBINATIONS for any given number of INPUTS and their events. Any ideas? Is there actually a better algorithm than this? any pseudo code to help me with will be great. C# (or VB) Thank You

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Different location of assemblies stoped the type casting.

  - by smwikipedia

  I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

  Read the article

• longitude and latitude for current location returned from CLLocationManager in UK region is not corr

  - by bond

  Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

  Read the article

• Where to prompt for required file location at start of Win Forms application

  - by Murph

  I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

  Read the article

• Add Firefox’s Awesome Bar Bookmark Search Function to Chrome and Iron

  - by Asian Angel

  Do you have a large number of bookmarks saved in your Chromium-based browser and need a quick way to search through them? Then see how easy it is to search through those bookmarks just like Firefox users do with the AwesomeBar extension. To engage the bookmark search function type “ab” in the Address Bar as seen above and press either Tab or the Space Bar. That will display the AwesomeBar prefix-bar as seen below. Enter the desired text to begin your search. For our example we decided to conduct a search for bookmarks related to the Ubuntu Twitter client Hotot. The results will continue to narrow down nicely as you type… Typing just a bit more finishes narrowing our search down the rest of the way for Hotot related items. Install the AwesomeBar Extension [Google Chrome Extensions] How to Enable Google Chrome’s Secret Gold IconHow to Create an Easy Pixel Art Avatar in Photoshop or GIMPInternet Explorer 9 Released: Here’s What You Need To Know

  Read the article

• Keyboard Function Keys Do Not Work

  - by Anthony Burman

  I use the Microsoft Natural MultiMedia Keyboard 1.0A. The keyboard is not a wireless board. The Escape button and the function keys have never worked. I am currently running on 10.10. On previous incarnations the keys never worked either. However a recent journey through all the Microsoft options in System Preference Keyboard Layouts suggested that the Escape button could be functional. The current setting is Generic 105-key (Intl) PC. Can I find out whether the keys can be made to work or not? Of the top buttons, nothing happens when I press My Documents; a small red cross appears at the top right of the screen when I press My Pictures and the Media, Mail and Web/Home buttons work just fine. Thanks, Anthony.

  Read the article

• How to recognize special function keys on keyboard

  - by NikolaiDante

  I have a Microsoft Digital Media 3000 Keyboard. None of the function keys or other special keys seem to do anything, what do I need to do to get them working (at the very least f2, as not having a shortcut to rename a file is driving me mad) If I run xev and press f2 I get the following output in the terminal: KeyPress event, serial 36, synthetic NO, window 0x4800001, root 0x15d, subw 0x0, time 42858728, (674,456), root:(1034,588), state 0x10, keycode 139 (keysym 0xff65, Undo), same_screen YES, XLookupString gives 0 bytes: XmbLookupString gives 0 bytes: XFilterEvent returns: False KeyRelease event, serial 36, synthetic NO, window 0x4800001, root 0x15d, subw 0x0, time 42858912, (674,456), root:(1034,588), state 0x10, keycode 139 (keysym 0xff65, Undo), same_screen YES, XLookupString gives 0 bytes: XFilterEvent returns: False

  Read the article

• How to re-enable function keys in byobu?

  - by Yang

  I was using byobu on Ubuntu 11.10 Server and I needed to hit a function key in an app, so I hit F9 to bring up the config menu and switched the keybinding set from "f-keys" to "screen-escape-keys". That worked, but now I can't re-enable all the f-keys. I found a program byobu-config that brings up the menu again, and I can switch back to screen keys from there. This fixes things for new screen processes, but the effect on the current screen session is weird: it disables the ctrl-a (screen) keys and restores F2-F8, but F9-F12 still don't do anything (they're just passed on to the foreground process). What's up with this? Any ideas? Thanks in advance.

  Read the article

• ~/.bashrc return can only 'return' from a function or sourced script

  - by Timothy

  I am trying to setup a OpenStack box to have a look at OpenStack Object Storage (Swift). Looking through the web I found this link; http://swift.openstack.org/development_saio.html#loopback-section I followed the instructions line by line but stuck on step 7 in the "Getting the code and setting up test environment" section. When I execute ~/.bashrc I get; line 6: return: can only 'return' from a function or sourced script. Below is the Line 6 extract from ~/.bashrc. My first reaction is to comment this line out, but I dont know what it does. Can anyone help? #If not running interactively, dont't do anything [ -z "$PS1" ] && return I'm running Ubuntu 12.04 as a VM on Hyper-v if knowing that is useful.

  Read the article

• Test case as a function or test case as a class

  - by GodMan

  I am having a design problem in test automation:- Requirements - Need to test different servers (using unix console and not GUI) through automation framework. Tests which I'm going to run - Unit, System, Integration Question: While designing a test case, I am thinking that a Test Case should be a part of a test suite (test suite is a class), just as we have in Python's pyunit framework. But, should we keep test cases as functions for a scalable automation framework or should be keep test cases as separate classes(each having their own setup, run and teardown methods) ? From automation perspective, Is the idea of having a test case as a class more scalable, maintainable or as a function?

  Read the article

• Using DLLEXPORT to export DLL function With Class to C#

  - by SICGames2013

  In my previous revision game engine I deported major functions for the game editor for C#. Now, I'm beginning to revise the game engine with a static library. There's a already dynamic library created in C++ to use DLLEXPORT for C#. Just now I want to test out the newer functions and created a DLL file from C++. Because the DLL contains classes I was wondering how would I be able to use DLL Export. Would I do this: [DLLEXPORT("GameEngine.dll", EntryPoint="SomeClass", Conventional=_stdcall)] static extern void functionFromClass(); I have a feeling it's probably DLLImport and not DLLExport. I was wondering how would I go about this? Another way I was thinking was because I already have the DLL in C++ prepared already to go the C# Class Library. I could just keep the new engine as a lib, and link the lib with the old DLL C++ file. Wouldn't the EntryPoint be able to point to the class the function is in?

  Read the article

• Can't adjust brightness on Samsung RV420 with fn keys

  - by nicholascamp

  Typing ls /sys/class/backlight/*/brightness outputs /sys/class/backlight/intel_backlight/brightness /sys/class/backlight/samsung/brightness The max_brightness for the second is 8, but changing it with echo 2 | sudo tee /sys/class/backlight/samsung/brightness doesn't change brightness. I can do it by using intel_backlight: echo 2000 | sudo tee /sys/class/backlight/intel_backlight/brightness (max_brightness: cat /sys/class/backlight/intel_backlight/max_brightness outputs 4648). But I want to do this work with the fn brightness keys, as I always did. I don't know what happened to stop working, maybe the use of +1 monitor and removing it in a wrong time or a system update. I'm using Ubuntu 12.04 64 bits in an Samsung RV420 notebook. Kernel Version is 3.2.0-27-generic. Could you help me? Please tell me what more info should I provide. Thanks!

  Read the article

• Accessing UI elements from delegate function in Windows Phone 7

  - by EpsilonVector

  I have the following scenario: a page with a bunch of UI elements (grids, textblocks, whatever), and a button that when clicked launches an asynchronous network transaction which, when finished, launches a delegate function. I want to reference the page's UI elements from that delegate. Ideally I would like to do something like currentPage.getUIElementByName("uielement").insert(data), or even uielement.insert(data), or something similar. Is there a way to do this? No matter what I try an exception is being thrown saying that I don't have permissions to access that element. Is there a more correct way to handle updating pages with data retrieved over network?

  Read the article

< Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >