Search Results

Search found 1867 results on 75 pages for 'insane 36'.

Page 54/75 | < Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >

  • AngularJS: download pdf file from the server

    - by Bartosz Bialecki
    I want to download a pdf file from the web server using $http. I use this code which works great, my file only is save as a html file, but when I open it it is opened as pdf but in the browser. I tested it on Chrome 36, Firefox 31 and Opera 23. This is my angularjs code (based on this code): UserService.downloadInvoice(hash).success(function (data, status, headers) { var filename, octetStreamMime = "application/octet-stream", contentType; // Get the headers headers = headers(); if (!filename) { filename = headers["x-filename"] || 'invoice.pdf'; } // Determine the content type from the header or default to "application/octet-stream" contentType = headers["content-type"] || octetStreamMime; if (navigator.msSaveBlob) { var blob = new Blob([data], { type: contentType }); navigator.msSaveBlob(blob, filename); } else { var urlCreator = window.URL || window.webkitURL || window.mozURL || window.msURL; if (urlCreator) { // Try to use a download link var link = document.createElement("a"); if ("download" in link) { // Prepare a blob URL var blob = new Blob([data], { type: contentType }); var url = urlCreator.createObjectURL(blob); $window.saveAs(blob, filename); return; link.setAttribute("href", url); link.setAttribute("download", filename); // Simulate clicking the download link var event = document.createEvent('MouseEvents'); event.initMouseEvent('click', true, true, window, 1, 0, 0, 0, 0, false, false, false, false, 0, null); link.dispatchEvent(event); } else { // Prepare a blob URL // Use application/octet-stream when using window.location to force download var blob = new Blob([data], { type: octetStreamMime }); var url = urlCreator.createObjectURL(blob); $window.location = url; } } } }).error(function (response) { $log.debug(response); }); On my server I use Laravel and this is my response: $headers = array( 'Content-Type' => $contentType, 'Content-Length' => strlen($data), 'Content-Disposition' => $contentDisposition ); return Response::make($data, 200, $headers); where $contentType is application/pdf and $contentDisposition is attachment; filename=" . basename($fileName) . '"' $filename - e.g. 59005-57123123.PDF My response headers: Cache-Control:no-cache Connection:Keep-Alive Content-Disposition:attachment; filename="159005-57123123.PDF" Content-Length:249403 Content-Type:application/pdf Date:Mon, 25 Aug 2014 15:56:43 GMT Keep-Alive:timeout=3, max=1 What am I doing wrong?

    Read the article

  • android : customer List Adatper + ArrayList

    - by Ram
    Team, Could you please help me debug the issue? ActivityAdapter activityAdapter = new ActivityAdapter(this,activityList); Log.d("list", "List Display - 1"); setListAdapter( activityAdapter ); Log.d("List", "list done"); It's throwing exception at the time of setListAdapter, 05-01 16:59:15.996: WARN/dalvikvm(251): threadid=3: thread exiting with uncaught exception (group=0x4001b188) 05-01 16:59:15.996: ERROR/AndroidRuntime(251): Uncaught handler: thread main exiting due to uncaught exception 05-01 16:59:16.204: ERROR/AndroidRuntime(251): java.lang.RuntimeException: Unable to start activity ComponentInfo{com.antennasoftware.xml/com.antennasoftware.xml.XMLParsing}: java.lang.RuntimeException: Your content must have a ListView whose id attribute is 'android.R.id.list' 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2454) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:2470) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.access$2200(ActivityThread.java:119) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:1821) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.os.Handler.dispatchMessage(Handler.java:99) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.os.Looper.loop(Looper.java:123) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.main(ActivityThread.java:4310) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at java.lang.reflect.Method.invokeNative(Native Method) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at java.lang.reflect.Method.invoke(Method.java:521) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:860) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:618) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at dalvik.system.NativeStart.main(Native Method) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): Caused by: java.lang.RuntimeException: Your content must have a ListView whose id attribute is 'android.R.id.list' 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ListActivity.onContentChanged(ListActivity.java:236) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.android.internal.policy.impl.PhoneWindow.setContentView(PhoneWindow.java:201) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.Activity.setContentView(Activity.java:1622) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at com.antennasoftware.xml.XMLParsing.onCreate(XMLParsing.java:36) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:2417) 05-01 16:59:16.204: ERROR/AndroidRuntime(251): ... 11 more Thanks in advance

    Read the article

  • Javascript Converter Coding Error ~ Showing Bug

    - by olivia
    Please help~! <HTML> <HEAD> <TITLE>Bra Size to Chest Size Converter - CM</TITLE> <SCRIPT LANGUAGE="JavaScript"> function CalculateSum(Atext, Btext, form) { var A = BratoNum(Btext); var B = parseFloat(CuptoNum(Btext)); form.Answer.value = A + B; } function ClearForm(form) { form.input_A.value = ""; form.input_B.value = ""; form.Answer.value = ""; } function BratoNum(str) { switch(str.toUpperCase()) { case "32": return 70; case "34": return 75; case "36": return 80; case "38": return 85; case "40": return 90; default: alert('You must enter a number between 32 and 40!'); return 'X'; } } function CuptoNum(str) { switch(str.toUpperCase()) { case "A": return 4; case "B": return 5; case "C": return 6; case "D": return 7; case "E": return 8; case "F": return 9; default: alert('You must enter a letter between A and F!'); return 'X'; } } // end of JavaScript functions --> </SCRIPT> </HEAD> <BODY> <P><FONT SIZE="+2">Bra Size to Chest Size Converter</FONT></P> <FORM NAME="Calculator" METHOD="post"> <P>Enter Bra Size: <INPUT TYPE=TEXT NAME="input_A" SIZE=8></P> <P>Enter Cup Size: <INPUT TYPE=TEXT NAME="input_B" SIZE=8></P> <P><INPUT TYPE="button" VALUE="Get Chest Size" name="AddButton" onClick="CalculateSum(this.form.input_A.value, this.form.input_B.value, this.form)"></P> <P>Your Chest Size is <INPUT TYPE=TEXT NAME="Answer" SIZE=8> inch</P> <P><INPUT TYPE="button" VALUE="Clear" name="ClearButton" onClick="ClearForm(this.form)"></P> </FORM> </BODY> </HTML>

    Read the article

  • libXcodeDebuggerSupport.dylib is missing in iOS 4.2.1 development SDK

    - by Kalle
    Note: creating a symbolic link to use the 4.2 lib seems to work fine -- maybe cd /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2.1\ \(8C148\)/Symbols/ sudo ln -s ../../4.2 (8C134)/Symbols/Developer Request: See end of this question! After upgrading from 4.2.0 (beta, I believe) to 4.2.1, the libXcodeDebuggerSupport.dylib file is missing, which results in: warning: Unable to read symbols for /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2.1 (8C148)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib (file not found). which I guess isn't good. Looking at the directory in question I note: .../DeviceSupport/4.2 (8C134)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib but .../DeviceSupport/4.2.1 (8C148)/Symbols/System/ .../DeviceSupport/4.2.1 (8C148)/Symbols/usr/ the above two dirs make up all the content in the 4.2.1 folder. No "Developer" folder. Checking the /usr/ dir there, I find no libXcodeDebuggerSupport.dylib file in the lib dir either, so ln -s'ing isn't an option. Worth mentioning: after the upgrade, I plugged the iPad in and had to click "Use for development" in Xcode organizer. Doing so, I got a message about symbols missing for that version, and Xcode proceeded to generate such, then failed. I restored the iPad and did "Use for development" again, and nothing about missing symbols appeared... Update: deletion of /Developer and reinstallation of Xcode from scratch does not fix this issue. Update 2: I just realized that after the reinstall of Xcode, .../DeviceSupport/4.2 (8C134)/Symbols is now a symbolic link, lrwxr-xr-x 1 root admin 36 Dec 3 17:17 Symbols -> ../../Developer/SDKs/iPhoneOS4.2.sdk And the directory in question has the appropriate files. Maybe this is simply a matter of linking the 4.2.1 dir in the same fashion? I'll try that and see if Xcode freaks out. If someone who has this file could provide a md5 sum that would be splendid. This is what it says for me: $ md5 /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2\ \(8C134\)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib MD5 (/Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2 (8C134)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib) = 08f93a0a2e3b03feaae732691f112688 If the MD5 sum is identical to the output of $ md5 /Developer/Platforms/iPhoneOS.platform/DeviceSupport/4.2.1\ \(8C148\)/Symbols/Developer/usr/lib/libXcodeDebuggerSupport.dylib then we're all set.

    Read the article

  • Question about InputMismatchException while using Scanner

    - by aser
    The question : Input file: customer’s account number, account balance at beginning of month, transaction type (withdrawal, deposit, interest), transaction amount Output: account number, beginning balance, ending balance, total interest paid, total amount deposited, number of deposits, total amount withdrawn, number of withdrawals package sentinel; import java.io.*; import java.util.*; public class Ex7 { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { int AccountNum; double BeginningBalance; double TransactionAmount; int TransactionType; double AmountDeposited=0; int NumberOfDeposits=0; double InterestPaid=0.0; double AmountWithdrawn=0.0; int NumberOfWithdrawals=0; boolean found= false; Scanner inFile = new Scanner(new FileReader("Account.in")); PrintWriter outFile = new PrintWriter("Account.out"); AccountNum = inFile.nextInt(); BeginningBalance= inFile.nextDouble(); while (inFile.hasNext()) { TransactionAmount=inFile.nextDouble(); TransactionType=inFile.nextInt(); outFile.printf("Account Number: %d%n", AccountNum); outFile.printf("Beginning Balance: $%.2f %n",BeginningBalance); outFile.printf("Ending Balance: $%.2f %n",BeginningBalance); outFile.println(); switch (TransactionType) { case '1': // case 1 if we have a Deposite BeginningBalance = BeginningBalance + TransactionAmount; AmountDeposited = AmountDeposited + TransactionAmount; NumberOfDeposits++; outFile.printf("Amount Deposited: $%.2f %n",AmountDeposited); outFile.printf("Number of Deposits: %d%n",NumberOfDeposits); outFile.println(); break; case '2':// case 2 if we have an Interest BeginningBalance = BeginningBalance + TransactionAmount; InterestPaid = InterestPaid + TransactionAmount; outFile.printf("Interest Paid: $%.2f %n",InterestPaid); outFile.println(); break; case '3':// case 3 if we have a Withdraw BeginningBalance = BeginningBalance - TransactionAmount; AmountWithdrawn = AmountWithdrawn + TransactionAmount; NumberOfWithdrawals++; outFile.printf("Amount Withdrawn: $%.2f %n",AmountWithdrawn); outFile.printf("Number of Withdrawals: %d%n",NumberOfWithdrawals); outFile.println(); break; default: System.out.println("Invalid transaction Tybe: " + TransactionType + TransactionAmount); } } inFile.close(); outFile.close(); } } But is gives me this : Exception in thread "main" java.util.InputMismatchException at java.util.Scanner.throwFor(Scanner.java:840) at java.util.Scanner.next(Scanner.java:1461) at java.util.Scanner.nextInt(Scanner.java:2091) at java.util.Scanner.nextInt(Scanner.java:2050) at sentinel.Ex7.main(Ex7.java:36) Java Result: 1

    Read the article

  • .NET AES returns wrong Test Vectors

    - by ralu
    I need to implement some crypto protocol on C# and want to say that this is my first project in C#. After spending some time to get used on C# I found out that I am unable to get compliant AES vectors. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Security.Cryptography; using System.IO; namespace ConsoleApplication1 { class Program { public static void Main() { try { //test vectors from "ecb_vk.txt" byte[] key = { 0x80, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] data = { 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] encTest = { 0x0e, 0xdd, 0x33, 0xd3, 0xc6, 0x21, 0xe5, 0x46, 0x45, 0x5b, 0xd8, 0xba, 0x14, 0x18, 0xbe, 0xc8 }; AesManaged aesAlg = new AesManaged(); aesAlg.BlockSize = 128; aesAlg.Key = key; aesAlg.Mode = CipherMode.ECB; ICryptoTransform encryptor = aesAlg.CreateEncryptor(); MemoryStream msEncrypt = new MemoryStream(); CryptoStream csEncrypt = new CryptoStream(msEncrypt, encryptor, CryptoStreamMode.Write); StreamWriter swEncrypt = new StreamWriter(csEncrypt); swEncrypt.Write(data); swEncrypt.Close(); csEncrypt.Close(); msEncrypt.Close(); aesAlg.Clear(); byte[] encr; encr = msEncrypt.ToArray(); string datastr = BitConverter.ToString(data); string encrstr = BitConverter.ToString(encr); string encTestStr = BitConverter.ToString(encTest); Console.WriteLine("data: {0}", datastr); Console.WriteLine("encr: {0}", encrstr); Console.WriteLine("should: {0}", encTestStr); Console.ReadKey(); } catch (Exception e) { Console.WriteLine("Error: {0}", e.Message); } } } } Output is wrong: data: 00-00-00-00-00-00-00-00-00-00-00-00-00-00-00-00 encr: A0-3C-C2-22-A4-32-F7-C9-BA-36-AE-73-66-BD-BB-A3 should: 0E-DD-33-D3-C6-21-E5-46-45-5B-D8-BA-14-18-BE-C8 I am sure that there is a correct AES implementation in .NET, so I need some advice from a .NET wizard to help with this.

    Read the article

  • Instance Failure in asp.net

    - by user85511
    I have a web application that is working perfectly in my system. However, when I copied it to another system, I couldn't login to the application. There is an error: Server Error in '/' Application. -------------------------------------------------------------------------------- Instance failure. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.InvalidOperationException: Instance failure. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [InvalidOperationException: Instance failure.] System.Data.SqlClient.TdsParser.Connect(ServerInfo serverInfo, SqlInternalConnectionTds connHandler, Boolean ignoreSniOpenTimeout, Int64 timerExpire, Boolean encrypt, Boolean trustServerCert, Boolean integratedSecurity, SqlConnection owningObject) +4858423 System.Data.SqlClient.SqlInternalConnectionTds.AttemptOneLogin(ServerInfo serverInfo, String newPassword, Boolean ignoreSniOpenTimeout, Int64 timerExpire, SqlConnection owningObject) +90 System.Data.SqlClient.SqlInternalConnectionTds.LoginNoFailover(String host, String newPassword, Boolean redirectedUserInstance, SqlConnection owningObject, SqlConnectionString connectionOptions, Int64 timerStart) +257 System.Data.SqlClient.SqlInternalConnectionTds.OpenLoginEnlist(SqlConnection owningObject, SqlConnectionString connectionOptions, String newPassword, Boolean redirectedUserInstance) +221 System.Data.SqlClient.SqlInternalConnectionTds..ctor(DbConnectionPoolIdentity identity, SqlConnectionString connectionOptions, Object providerInfo, String newPassword, SqlConnection owningObject, Boolean redirectedUserInstance) +189 System.Data.SqlClient.SqlConnectionFactory.CreateConnection(DbConnectionOptions options, Object poolGroupProviderInfo, DbConnectionPool pool, DbConnection owningConnection) +4859187 System.Data.ProviderBase.DbConnectionFactory.CreatePooledConnection(DbConnection owningConnection, DbConnectionPool pool, DbConnectionOptions options) +31 System.Data.ProviderBase.DbConnectionPool.CreateObject(DbConnection owningObject) +433 System.Data.ProviderBase.DbConnectionPool.UserCreateRequest(DbConnection owningObject) +66 System.Data.ProviderBase.DbConnectionPool.GetConnection(DbConnection owningObject) +499 System.Data.ProviderBase.DbConnectionFactory.GetConnection(DbConnection owningConnection) +65 System.Data.ProviderBase.DbConnectionClosed.OpenConnection(DbConnection outerConnection, DbConnectionFactory connectionFactory) +117 System.Data.SqlClient.SqlConnection.Open() +122 System.Web.DataAccess.SqlConnectionHolder.Open(HttpContext context, Boolean revertImpersonate) +87 System.Web.DataAccess.SqlConnectionHelper.GetConnection(String connectionString, Boolean revertImpersonation) +221 System.Web.Security.SqlMembershipProvider.GetPasswordWithFormat(String username, Boolean updateLastLoginActivityDate, Int32& status, String& password, Int32& passwordFormat, String& passwordSalt, Int32& failedPasswordAttemptCount, Int32& failedPasswordAnswerAttemptCount, Boolean& isApproved, DateTime& lastLoginDate, DateTime& lastActivityDate) +815 System.Web.Security.SqlMembershipProvider.CheckPassword(String username, String password, Boolean updateLastLoginActivityDate, Boolean failIfNotApproved, String& salt, Int32& passwordFormat) +105 System.Web.Security.SqlMembershipProvider.CheckPassword(String username, String password, Boolean updateLastLoginActivityDate, Boolean failIfNotApproved) +42 System.Web.Security.SqlMembershipProvider.ValidateUser(String username, String password) +78 System.Web.UI.WebControls.Login.AuthenticateUsingMembershipProvider(AuthenticateEventArgs e) +60 System.Web.UI.WebControls.Login.OnAuthenticate(AuthenticateEventArgs e) +119 System.Web.UI.WebControls.Login.AttemptLogin() +115 System.Web.UI.WebControls.Login.OnBubbleEvent(Object source, EventArgs e) +101 System.Web.UI.Control.RaiseBubbleEvent(Object source, EventArgs args) +37 System.Web.UI.WebControls.Button.OnCommand(CommandEventArgs e) +118 System.Web.UI.WebControls.Button.RaisePostBackEvent(String eventArgument) +166 System.Web.UI.WebControls.Button.System.Web.UI.IPostBackEventHandler.RaisePostBackEvent(String eventArgument) +10 System.Web.UI.Page.RaisePostBackEvent(IPostBackEventHandler sourceControl, String eventArgument) +13 System.Web.UI.Page.RaisePostBackEvent(NameValueCollection postData) +36 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +1565 -------------------------------------------------------------------------------- Version Information: Microsoft .NET Framework Version:2.0.50727.3053; ASP.NET Version:2.0.50727.3053 What could be the reason for such an error? How could I solve this?

    Read the article

  • OpenGL, how to set a monochrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :)

    Read the article

  • How to query data from a password protected https website

    - by Addie
    I'd like my application to query a csv file from a secure website. I have no experience with web programming so I'd appreciate detailed instructions. Currently I have the user login to the site, manually query the csv, and have my application load the file locally. I'd like to automate this by having the user enter his login information, authenticating him on the website, and querying the data. The application is written in C# .NET. The url of the site is: https://www2.emidas.com/default.asp. I've tested the following code already and am able to access the file once the user has already authenticated himself and created a manual query. System.Net.WebClient Client = new WebClient(); Stream strm = Client.OpenRead("https://www3.emidas.com/users/<username>/file.csv"); Here is the request sent to the site for authentication. I've angle bracketed the real userid and password. POST /pwdVal.asp HTTP/1.1 Accept: image/jpeg, application/x-ms-application, image/gif, application/xaml+xml, image/pjpeg, application/x-ms-xbap, application/vnd.ms-excel, application/vnd.ms-powerpoint, application/msword, application/x-shockwave-flash, */* User-Agent: Mozilla/4.0 (compatible; MSIE 8.0; Windows NT 6.1; Trident/4.0; SLCC2; .NET CLR 2.0.50727; .NET CLR 3.5.30729; .NET CLR 3.0.30729; Media Center PC 6.0; InfoPath.2; Tablet PC 2.0; OfficeLiveConnector.1.4; OfficeLivePatch.1.3; .NET4.0C; .NET4.0E) Content-Type: application/x-www-form-urlencoded Accept-Encoding: gzip, deflate Cookie: ASPSESSIONID<unsure if this data contained password info so removed>; ClientId=<username> Host: www3.emidas.com Content-Length: 36 Connection: Keep-Alive Cache-Control: no-cache Accept-Language: en-US client_id=<username>&password=<password>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How t o make a magnifying glass On a picture?

    - by pengwang
    hello I want to make a magnifying glass on a picture so that the part of picture is extended ? in other words i want to find a easy method to create the illusion of a magnifying glass,I know ShapeDrawable and BitmapShader(Bitmap, Shader.TileMode.REPEAT, Shader.TileMode.REPEAT) is useful,but I donot konw how tu du it. AS http://i3.6.cn/cvbnm/72/60/36/73dfcc8862020e9ed366a55e72e88883.jpg could you give me some code or sample? thank you

    Read the article

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • Help me with this java program

    - by aser
    The question : Input file: customer’s account number, account balance at beginning of month, transaction type (withdrawal, deposit, interest), transaction amount Output: account number, beginning balance, ending balance, total interest paid, total amount deposited, number of deposits, total amount withdrawn, number of withdrawals package sentinel; import java.io.*; import java.util.*; public class Ex7 { /** * @param args the command line arguments */ public static void main(String[] args) throws FileNotFoundException { int AccountNum; double BeginningBalance; double TransactionAmount; int TransactionType; double AmountDeposited=0; int NumberOfDeposits=0; double InterestPaid=0.0; double AmountWithdrawn=0.0; int NumberOfWithdrawals=0; boolean found= false; Scanner inFile = new Scanner(new FileReader("Account.in")); PrintWriter outFile = new PrintWriter("Account.out"); AccountNum = inFile.nextInt(); BeginningBalance= inFile.nextDouble(); while (inFile.hasNext()) { TransactionAmount=inFile.nextDouble(); TransactionType=inFile.nextInt(); outFile.printf("Account Number: %d%n", AccountNum); outFile.printf("Beginning Balance: $%.2f %n",BeginningBalance); outFile.printf("Ending Balance: $%.2f %n",BeginningBalance); outFile.println(); switch (TransactionType) { case '1': // case 1 if we have a Deposite BeginningBalance = BeginningBalance + TransactionAmount; AmountDeposited = AmountDeposited + TransactionAmount; NumberOfDeposits++; outFile.printf("Amount Deposited: $%.2f %n",AmountDeposited); outFile.printf("Number of Deposits: %d%n",NumberOfDeposits); outFile.println(); break; case '2':// case 2 if we have an Interest BeginningBalance = BeginningBalance + TransactionAmount; InterestPaid = InterestPaid + TransactionAmount; outFile.printf("Interest Paid: $%.2f %n",InterestPaid); outFile.println(); break; case '3':// case 3 if we have a Withdraw BeginningBalance = BeginningBalance - TransactionAmount; AmountWithdrawn = AmountWithdrawn + TransactionAmount; NumberOfWithdrawals++; outFile.printf("Amount Withdrawn: $%.2f %n",AmountWithdrawn); outFile.printf("Number of Withdrawals: %d%n",NumberOfWithdrawals); outFile.println(); break; default: System.out.println("Invalid transaction Tybe: " + TransactionType + TransactionAmount); } } inFile.close(); outFile.close(); } } But is gives me this : Exception in thread "main" java.util.InputMismatchException at java.util.Scanner.throwFor(Scanner.java:840) at java.util.Scanner.next(Scanner.java:1461) at java.util.Scanner.nextInt(Scanner.java:2091) at java.util.Scanner.nextInt(Scanner.java:2050) at sentinel.Ex7.main(Ex7.java:36) Java Result: 1

    Read the article

  • How to change the JSON output format and how to support chinese character?

    - by sky
    Currently I using the following code to get my JSON output from MySQL. <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT message FROM posts', $session); $somethings = array(); while ($row = mysql_fetch_assoc($result)) { $somethings[] = $row; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> And the output is: <script type="text/javascript"> var somethings= [{"message":"Welcome to Yo~ :)"},{"message":"Try iPhone post!"},{"message":"????"}]; </script> Here is the question, how can I change my output into format like : <script type="text/javascript"> userAge = new Array('21','36','20'), userMid = new Array('liuple','anhu','jacksen'); </script> Which I'll be using later with following code : var html = ' <table class="map-overlay"> <tr> <td class="user">' + '<a class="username" href="/' + **userMid[index]** + '" target="_blank"><img alt="" src="' + getAvatar(signImgList[index], '72x72') + '"></a><br> <a class="username" href="/' + **userMid[index]** + '" target="_blank">' + userNameList[index] + '</a><br> <span class="info">' + **userSex[index]** + ' ' + **userAge[index]** + '?<br> ' + cityList[index] + '</span>' + '</td> <td class="content">' + picString + somethings[index] + '<br> <span class="time">' + timeList[index] + picTips + '</span></td> </tr> </table> '; Thanks for helping and reading!

    Read the article

  • OpenGL, how to set a monocrome texture to a colored shape?

    - by Santiago
    I'm developing on Android with OpenGL ES, I draw some cubes and I change its colors with glColor4f. Now, what I want is to give a more realistic effect on the cubes, so I create a monochromatic 8bit depth, 64x64 pixel size PNG file. I loaded on a texture, and here is my problem, witch is the way to combine the color and the texture to get a colorized and textured cubes onto the screen? I'm not an expert on OpenGL, I tried this: On create: public void asignBitmap(GL10 gl, Bitmap bitmap) { int[] textures = new int[1]; gl.glGenTextures(1, textures, 0); mTexture = textures[0]; gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MIN_FILTER, GL10.GL_NEAREST); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_MAG_FILTER, GL10.GL_LINEAR); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_S, GL10.GL_CLAMP_TO_EDGE); gl.glTexParameterf(GL10.GL_TEXTURE_2D, GL10.GL_TEXTURE_WRAP_T, GL10.GL_CLAMP_TO_EDGE); gl.glTexEnvf(GL10.GL_TEXTURE_ENV, GL10.GL_TEXTURE_ENV_MODE, GL10.GL_REPLACE); GLUtils.texImage2D(GL10.GL_TEXTURE_2D, 0, GL10.GL_ALPHA, bitmap, 0); ByteBuffer tbb = ByteBuffer.allocateDirect(texCoords.length * 4); tbb.order(ByteOrder.nativeOrder()); mTexBuffer = tbb.asFloatBuffer(); for (int i = 0; i < 48; i++) mTexBuffer.put(texCoords[i]); mTexBuffer.position(0); } And OnDraw: public void draw(GL10 gl, int alphawires) { gl.glColor4f(1.0f, 0.0f, 0.0f, 0.5f); //RED gl.glBindTexture(GL10.GL_TEXTURE_2D, mTexture); gl.glBlendFunc(GL10.GL_SRC_ALPHA, GL10.GL_ONE_MINUS_SRC_ALPHA); gl.glEnable(GL10.GL_TEXTURE_2D); gl.glEnable(GL10.GL_BLEND); gl.glEnableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glTexCoordPointer(2, GL10.GL_FLOAT, 0, mTexBuffer); //Set the face rotation gl.glFrontFace(GL10.GL_CW); //Point to our buffers gl.glVertexPointer(3, GL10.GL_FLOAT, 0, vertexBuffer); //Enable the vertex and color state gl.glEnableClientState(GL10.GL_VERTEX_ARRAY); //Draw the vertices as triangles, based on the Index Buffer information gl.glDrawElements(GL10.GL_TRIANGLES, 36, GL10.GL_UNSIGNED_BYTE, indexBuffer); //Disable the client state before leaving gl.glDisableClientState(GL10.GL_VERTEX_ARRAY); gl.glDisableClientState(GL10.GL_TEXTURE_COORD_ARRAY); gl.glDisable(GL10.GL_BLEND); gl.glDisable(GL10.GL_TEXTURE_2D); } I'm even not sure if I have to use a blend option, because I don't need transparency, but is a plus :) Thank's

    Read the article

  • User has many computers, computers have many attributes in different tables, best way to JOIN?

    - by krismeld
    I have a table for users: USERS: ID | NAME | ---------------- 1 | JOHN | 2 | STEVE | a table for computers: COMPUTERS: ID | USER_ID | ------------------ 13 | 1 | 14 | 1 | a table for processors: PROCESSORS: ID | NAME | --------------------------- 27 | PROCESSOR TYPE 1 | 28 | PROCESSOR TYPE 2 | and a table for harddrives: HARDDRIVES: ID | NAME | ---------------------------| 35 | HARDDRIVE TYPE 25 | 36 | HARDDRIVE TYPE 90 | Each computer can have many attributes from the different attributes tables (processors, harddrives etc), so I have intersection tables like this, to link the attributes to the computers: COMPUTER_PROCESSORS: C_ID | P_ID | --------------| 13 | 27 | 13 | 28 | 14 | 27 | COMPUTER_HARDDRIVES: C_ID | H_ID | --------------| 13 | 35 | So user JOHN, with id 1 owns computer 13 and 14. Computer 13 has processor 27 and 28, and computer 13 has harddrive 35. Computer 14 has processor 27 and no harddrive. Given a user's id, I would like to retrieve a list of that user's computers with each computers attributes. I have figured out a query that gives me a somewhat of a result: SELECT computers.id, processors.id AS p_id, processors.name AS p_name, harddrives.id AS h_id, harddrives.name AS h_name, FROM computers JOIN computer_processors ON (computer_processors.c_id = computers.id) JOIN processors ON (processors.id = computer_processors.p_id) JOIN computer_harddrives ON (computer_harddrives.c_id = computers.id) JOIN harddrives ON (harddrives.id = computer_harddrives.h_id) WHERE computers.user_id = 1 Result: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | HARDDRIVE TYPE 25 | But this has several problems... Computer 14 doesnt show up, because it has no harddrive. Can I somehow make an OUTER JOIN to make sure that all computers show up, even if there a some attributes they don't have? Computer 13 shows up twice, with the same harddrive listet for both. When more attributes are added to a computer (like 3 blocks of ram), the number of rows returned for that computer gets pretty big, and it makes it had to sort the result out in application code. Can I somehow make a query, that groups the two returned rows together? Or a query that returns NULL in the h_name column in the second row, so that all values returned are unique? EDIT: What I would like to return is something like this: ID | P_ID | P_NAME | H_ID | H_NAME | ----------------------------------------------------------- 13 | 27 | PROCESSOR TYPE 1 | 35 | HARDDRIVE TYPE 25 | 13 | 28 | PROCESSOR TYPE 2 | 35 | NULL | 14 | 27 | PROCESSOR TYPE 1 | NULL | NULL | Or whatever result that make it easy to turn it into an array like this [13] => [P_NAME] => [0] => PROCESSOR TYPE 1 [1] => PROCESSOR TYPE 2 [H_NAME] => [0] => HARDDRIVE TYPE 25 [14] => [P_NAME] => [0] => PROCESSOR TYPE 1

    Read the article

  • RaphaelJS HTML5 Library pathIntersection() bug or alternative optimisation (screenshots)

    - by user1236048
    I have a chart generated using RaphaelJS library. It is just on long path: M 50 122 L 63.230769230769226 130 L 76.46153846153845 130 L 89.6923076923077 128 L 102.92307692307692 56 L 116.15384615384615 106 L 129.3846153846154 88 L 142.6153846153846 114 L 155.84615384615384 52 L 169.07692307692307 30 L 182.3076923076923 62 L 195.53846153846152 130 L 208.76923076923077 74 L 222 130 L 235.23076923076923 66 L 248.46153846153845 102 L 261.6923076923077 32 L 274.9230769230769 130 L 288.15384615384613 130 L 301.38461538461536 32 L 314.6153846153846 86 L 327.8461538461538 130 L 341.07692307692304 70 L 354.30769230769226 130 L 367.53846153846155 102 L 380.7692307692308 120 L 394 112 L 407.2307692307692 68 L 420.46153846153845 48 L 433.6923076923077 92 L 446.9230769230769 128 L 460.15384615384613 110 L 473.38461538461536 78 L 486.6153846153846 130 L 499.8461538461538 56 L 513.0769230769231 116 L 526.3076923076923 80 L 539.5384615384614 58 L 552.7692307692307 40 L 566 130 L 579.2307692307692 94 L 592.4615384615385 64 L 605.6923076923076 122 L 618.9230769230769 98 L 632.1538461538461 120 L 645.3846153846154 70 L 658.6153846153845 82 L 671.8461538461538 76 L 685.0769230769231 124 L 698.3076923076923 110 L 711.5384615384615 94 L 724.7692307692307 130 L 738 130 L 751.2307692307692 66 L 764.4615384615385 118 L 777.6923076923076 70 L 790.9230769230769 130 L 804.1538461538461 44 L 817.3846153846154 130 L 830.6153846153845 36 L 843.8461538461538 92 L 857.076923076923 130 L 870.3076923076923 76 L 883.5384615384614 130 L 896.7692307692307 60 L 910 88 Also below these chart I have a jqueryUI slider of the same width (860px) and centered with the chart. I want when I move the slider to move a dot on the chart accordingly with the slider position. See attached screenshot: As you can see it seems to work fine. I've implemented this behaviour using the pathIntersection() method. On the slide event at each ui.value (x coordinate) I intersect my chartPath (the one from above) with a vertical straight line at the x coordinate. But still there are some problems. One of them is that it runs very hard, and it kinda freezes sometimes.. and very weird sometimes it doesn't seem to intersect at all even it should.. I'll example below 2 cases I identified: M 499.8461538461538 0 L 499.8461538461538 140 M 910 0 L 910 140 Could you please explain why this intersect behaviour happens (it should return a dot).. and the worst part it seems like it happens randomly.. if I use another chartdata. Also if you can identify another (better) solution to syncronise the slider position with the dot on the chart.. would be perfect. I thought about using Element.getPointAtLength(length), but I don't know how. I think I should save the pathSegments and for each to compute the start Length and the finish Length.

    Read the article

  • Draw rectangle-like objects on a bitmap

    - by _simon_
    I am performing OCR (optical character recognition) on a bunch of images. Images are grouped into different projects (tickets, credit cards, insurance cards etc). Each image represents an actual product (for instance, if we have images of credit cards, picture1.jpg is image of my credit card, picture2.jpg is image of your credit card,... you get it). I have a settings.xml file, which contains regions of the image, where OCR should be performed. Example: <Project Name="Ticket1" TemplateImage="...somePath/templateTicket1.jpg"> <Region Name="Prefix" NumericOnly="false" Rotate="0"> <x>470</x> <y>395</y> <width>31</width> <height>36</height> </Region> <Region Name="Num1" NumericOnly="true" Rotate="0"> <x>555</x> <y>402</y> <width>123</width> <height>35</height> </Region> </Project> </Project Name="CreditCard" TemplateImage="...somePath/templateCreditCard1.jpg"> <Region Name="SerialNumber" NumericOnly="false" Rotate="90"> <x>332</x> <y>12</y> <width>20</width> <height>98</height> </Project> I would like to set these parameters through GUI (now I just write them into xml file). So, first I load a template image for a project (an empty credit card). Then I would like to draw a rectangle around a text, where OCR should be performed. I guess this isn't hard, but it would be great if I could also move and resize this rectangle object in the picture. I have to display all regions (rectangles) on the picture also. Also - there will probably be a list of regions in a listview, so when you click a region in this listview, it should mark it on the picture in a green color for example. Do you know for a library, which I could use? Or a link with some tips how to create such objects?

    Read the article

  • C# AES returns wrong Test Vectors

    - by ralu
    I need to implement some crypto protocol on C# and want to say that this is my first project in C#. After spending some time to get used on C# I found out that I am unable to get compliant AES vectors. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Security.Cryptography; using System.IO; namespace ConsoleApplication1 { class Program { public static void Main() { try { //test vectors from "ecb_vk.txt" byte[] key = { 0x80, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] data = { 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00 }; byte[] encTest = { 0x0e, 0xdd, 0x33, 0xd3, 0xc6, 0x21, 0xe5, 0x46, 0x45, 0x5b, 0xd8, 0xba, 0x14, 0x18, 0xbe, 0xc8 }; AesManaged aesAlg = new AesManaged(); aesAlg.BlockSize = 128; aesAlg.Key = key; aesAlg.Mode = CipherMode.ECB; ICryptoTransform encryptor = aesAlg.CreateEncryptor(); MemoryStream msEncrypt = new MemoryStream(); CryptoStream csEncrypt = new CryptoStream(msEncrypt, encryptor, CryptoStreamMode.Write); StreamWriter swEncrypt = new StreamWriter(csEncrypt); swEncrypt.Write(data); swEncrypt.Close(); csEncrypt.Close(); msEncrypt.Close(); aesAlg.Clear(); byte[] encr; encr = msEncrypt.ToArray(); string datastr = BitConverter.ToString(data); string encrstr = BitConverter.ToString(encr); string encTestStr = BitConverter.ToString(encTest); Console.WriteLine("data: {0}", datastr); Console.WriteLine("encr: {0}", encrstr); Console.WriteLine("should: {0}", encTestStr); Console.ReadKey(); } catch (Exception e) { Console.WriteLine("Error: {0}", e.Message); } } } } Output is wrong: data: 00-00-00-00-00-00-00-00-00-00-00-00-00-00-00-00 encr: A0-3C-C2-22-A4-32-F7-C9-BA-36-AE-73-66-BD-BB-A3 should: 0E-DD-33-D3-C6-21-E5-46-45-5B-D8-BA-14-18-BE-C8 I am sure that there is correct AES implementation in C#, so I need some advice from C# wizard to help whit this. Thanks

    Read the article

  • What exactly does this piece of JavaScript do?

    - by helpmarnie
    I saw this page growing in popularity among my social circles on Facebook, what 98 percent bla bla... and it walks users through copying the below JavaScript (I added some indentation to make it more readable) into their address bar. Looks dodgy to me, but I only have a very basic knowledge of JavaScript. Simply put, what does this do? javascript:(function(){ a='app120668947950042_jop'; b='app120668947950042_jode'; ifc='app120668947950042_ifc'; ifo='app120668947950042_ifo'; mw='app120668947950042_mwrapper'; eval(function(p,a,c,k,e,r){ e=function(c){ return(c<a?'':e(parseInt(c/a)))+((c=c%a)>35?String.fromCharCode(c+29):c.toString(36))} ; if(!''.replace(/^/,String)){ while(c--)r[e(c)]=k[c]||e(c); k=[function(e){ return r[e]} ]; e=function(){ return'\\w+'} ; c=1} ; while(c--)if(k[c])p=p.replace(new RegExp('\\b'+e(c)+'\\b','g'),k[c]); return p} ('J e=["\\n\\g\\j\\g\\F\\g\\i\\g\\h\\A","\\j\\h\\A\\i\\f","\\o\\f\\h\\q\\i\\f\\r\\f\\k\\h\\K\\A\\L\\t","\\w\\g\\t\\t\\f\\k","\\g\\k\\k\\f\\x\\M\\N\\G\\O","\\n\\l\\i\\y\\f","\\j\\y\\o\\o\\f\\j\\h","\\i\\g\\H\\f\\r\\f","\\G\\u\\y\\j\\f\\q\\n\\f\\k\\h\\j","\\p\\x\\f\\l\\h\\f\\q\\n\\f\\k\\h","\\p\\i\\g\\p\\H","\\g\\k\\g\\h\\q\\n\\f\\k\\h","\\t\\g\\j\\z\\l\\h\\p\\w\\q\\n\\f\\k\\h","\\j\\f\\i\\f\\p\\h\\v\\l\\i\\i","\\j\\o\\r\\v\\g\\k\\n\\g\\h\\f\\v\\P\\u\\x\\r","\\B\\l\\Q\\l\\R\\B\\j\\u\\p\\g\\l\\i\\v\\o\\x\\l\\z\\w\\B\\g\\k\\n\\g\\h\\f\\v\\t\\g\\l\\i\\u\\o\\S\\z\\w\\z","\\j\\y\\F\\r\\g\\h\\T\\g\\l\\i\\u\\o"]; d=U; d[e[2]](V)[e[1]][e[0]]=e[3]; d[e[2]](a)[e[4]]=d[e[2]](b)[e[5]]; s=d[e[2]](e[6]); m=d[e[2]](e[7]); c=d[e[9]](e[8]); c[e[11]](e[10],I,I); s[e[12]](c); C(D(){ W[e[13]]()} ,E); C(D(){ X[e[16]](e[14],e[15])} ,E); C(D(){ m[e[12]](c); d[e[2]](Y)[e[4]]=d[e[2]](Z)[e[5]]} ,E); ',62,69,'||||||||||||||_0x95ea|x65|x69|x74|x6C|x73|x6E|x61||x76|x67|x63|x45|x6D||x64|x6F|x5F|x68|x72|x75|x70|x79|x2F|setTimeout|function|5000|x62|x4D|x6B|true|var|x42|x49|x48|x54|x4C|x66|x6A|x78|x2E|x44|document|mw|fs|SocialGraphManager|ifo|ifc|||||||'.split('|'),0,{ } ))})();

    Read the article

  • Suggest an alternative way to organize/build a database solution.

    - by Hamish Grubijan
    We are using Visual Studio 2010, but this was first conceived with VS2003. I will forward the best suggestions to my team. The current setup almost makes me vomit. It is a C# solution with most projects containing .sql files. Because we support Microsoft, Oracle, and Sybase, and so home-brewed a pre-processor, much like C preprocessor, except that substitutions are performed by a home-brewed C# program without using yacc and tools like that. #ifdefs are used for conditional macro definitions, and yeah - macros are the way this is done. A macro can expand to another macro or two, but this should eventually terminate. Only macros have #ifdef in them - the rest of the SQL-like code just uses these macros. Now, the various configurations: Debug, MNDebug, MNRelease, Release, SQL_APPLY_ALL, SQL_APPLY_MSFT, SQL_APPLY_ORACLE, SQL_APPLY_SYBASE, SQL_BUILD_OUTPUT_ALL, SQL_COMPILE, as well as 2 more. Also: Any CPU, Mixed Platforms, Win32. What drives me nuts is having to configure it correctly as well as choosing the right one out of 12 x 3 = 36 configurations as well as having to substitute database name depending on the type of database: config, main, or gateway. I am thinking that configuration should be reduced to just Debug, Release, and SQL_APPLY. Also, using 0, 1, and 2 seems so 80s ... Finally, I think my intention to build or not to build 3 types of databases for 3 types of vendors should be configured with just a tic tac toe board like: XOX OOX XXX In this case it would mean build MSFT+CONFIG, all SYBASE, and all GATEWAY. Still, the overall thing which uses a text file and a pre-processor and many configurations seems incredibly clunky. It is year 2010 now and someone out there is bound to have a very clean and/or creative tool/solution. The only pro would be that the existing collection of macros has been well tested. Have you ever had to write SQL that would work for several vendors? How did you do it? SqlVars.txt (Every one of 30 users makes a copy of a template and modifies this to suit their needs): // This is the default parameters file and should not be changed. // You can overwrite any of these parameters by copying the appropriate // section to override into SqlVars.txt and providing your own information. //Build types are 0-Config, 1-Main, 2-Gateway BUILD_TYPE=1 REMOVE_COMMENTS=1 // Login information used when applying to a Microsoft SQL server database SQL_APPLY_MSFT_version=SQL2005 SQL_APPLY_MSFT_database=msftdb SQL_APPLY_MSFT_server=ABC SQL_APPLY_MSFT_user=msftusr SQL_APPLY_MSFT_password=msftpwd // Login information used when applying to an Oracle database SQL_APPLY_ORACLE_version=ORACLE10g SQL_APPLY_ORACLE_server=oradb SQL_APPLY_ORACLE_user=orausr SQL_APPLY_ORACLE_password=orapwd // Login information used when applying to a Sybase database SQL_APPLY_SYBASE_version=SYBASE125 SQL_APPLY_SYBASE_database=sybdb SQL_APPLY_SYBASE_server=sybdb SQL_APPLY_SYBASE_user=sybusr SQL_APPLY_SYBASE_password=sybpwd ... (THIS GOES ON)

    Read the article

  • Rails Active Record find(:all, :order => ) issue.

    - by CodingWithoutComments
    I seem to be unable to use :order_by for more than one column at a time. For example, I have a "Show" model with date and attending columns. If I run the following code: @shows = Show.find(:all, :order => "date") I get the following results: [#<Show id: 7, date: "2009-04-18", attending: 2>, #<Show id: 1, date: "2009-04-18", attending: 78>, #<Show id: 2, date: "2009-04-19", attending: 91>, #<Show id: 3, date: "2009-04-20", attending: 16>, #<Show id: 4, date: "2009-04-21", attending: 136>] If I run the following code: @shows = Show.find(:all, :order => "attending DESC") [#<Show id: 4, date: "2009-04-21", attending: 136>, #<Show id: 2, date: "2009-04-19", attending: 91>, #<Show id: 1, date: "2009-04-18", attending: 78>, #<Show id: 3, date: "2009-04-20", attending: 16>, #<Show id: 7, date: "2009-04-18", attending: 2>] But, if I run: @shows = Show.find(:all, :order => "date, attending DESC") OR @shows = Show.find(:all, :order => "date, attending ASC") OR @shows = Show.find(:all, :order => "date ASC, attending DESC") I get the same results as only sorting by date: [#<Show id: 7, date: "2009-04-18", attending: 2>, #<Show id: 1, date: "2009-04-18", attending: 78>, #<Show id: 2, date: "2009-04-19", attending: 91>, #<Show id: 3, date: "2009-04-20", attending: 16>, #<Show id: 4, date: "2009-04-21", attending: 136>] Where as, I want to get these results: [#<Show id: 1, date: "2009-04-18", attending: 78>, #<Show id: 7, date: "2009-04-18", attending: 2>, #<Show id: 2, date: "2009-04-19", attending: 91>, #<Show id: 3, date: "2009-04-20", attending: 16>, #<Show id: 4, date: "2009-04-21", attending: 136>] This is the query being generated from the logs: [4;35;1mUser Load (0.6ms)[0m [0mSELECT * FROM "users" WHERE ("users"."id" = 1) LIMIT 1[0m [4;36;1mShow Load (3.0ms)[0m [0;1mSELECT * FROM "shows" ORDER BY date ASC, attending DESC[0m [4;35;1mUser Load (0.6ms)[0m [0mSELECT * FROM "users" WHERE ("users"."id" = 1) [0m Finally, here is my model: create_table "shows", :force => true do |t| t.string "headliner" t.string "openers" t.string "venue" t.date "date" t.text "description" t.datetime "created_at" t.datetime "updated_at" t.decimal "price" t.time "showtime" t.integer "attending", :default => 0 t.string "time" end What am I missing? What am I doing wrong? UPDATE: Thanks for all your help, but it seems that all of you were stumped as much as I was. What solved the problem was actually switching databases. I switched from the default sqlite3 to mysql.

    Read the article

  • Why doesen't the number 2 work in this for-loop?

    - by Emil
    Hello. I have a function that runs trough each element in an array. It's hard to explain, so I'll just paste in the code here: NSLog(@"%@", arraySub); for (NSString *string in arrayFav){ int favoriteLoop = [string intValue] + favCount; NSLog(@"%d", favoriteLoop); id arrayFavObject = [array objectAtIndex:favoriteLoop]; [arrayFavObject retain]; [array removeObjectAtIndex:favoriteLoop]; [array insertObject:arrayFavObject atIndex:0]; [arrayFavObject release]; id arraySubFavObject = [arraySub objectAtIndex:favoriteLoop]; [arraySubFavObject retain]; [arraySub removeObjectAtIndex:favoriteLoop]; [arraySub insertObject:arraySubFavObject atIndex:0]; [arraySubFavObject release]; id arrayLengthFavObject = [arrayLength objectAtIndex:favoriteLoop]; [arrayLengthFavObject retain]; [arrayLength removeObjectAtIndex:favoriteLoop]; [arrayLength insertObject:arrayLengthFavObject atIndex:0]; [arrayLengthFavObject release]; } NSLog(@"%@", arraySub); The array arrayFav contains these strings: "3", "8", "2", "10", "40". Array array contains 92 strings with a name. Array arraySub contains numbers 0 to 91, representing a filename with a title from the array array. Array arrayLength contains 92 strings representing the size of each file from array arraySub. Now, the first NSLog shows, as expected, the numbers 0 to 91. The NSLog-s in the loop shows the numbers 3, 8, 2, 10, 40, also as expected. But here's the odd part: the last NSLog shows these numbers: 40, 10, 0, 8, 3, 1, 2, 4, 5, 6, 7, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 that is 40, 10, 0, 8, 3, and so on. It was not supposed to be a zero in there, it was supposed to be a 2.. Do you have any idea at why this is happening or a way to fix it? Thank you.

    Read the article

  • MapsActivity not beeing found

    - by Johnny Rottenweed
    I am trying to get a simple map displayed. This is what I have: package com.chance.squat; import com.chance.squat.R; import com.google.android.maps.MapActivity; import android.os.Bundle; public class Maps extends MapActivity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.maps); } @Override protected boolean isRouteDisplayed() { return false; } } <?xml version="1.0" encoding="utf-8"?> <com.google.android.maps.MapView xmlns:android="http://schemas.android.com/apk/res/android" android:id="@+id/mapview" android:layout_width="fill_parent" android:layout_height="fill_parent" android:clickable="true" android:apiKey="A2:D9:A5:1C:21:6F:D7:44:47:23:31:EC:1A:98:EF:36" /> <?xml version="1.0" encoding="utf-8"?> <manifest xmlns:android="http://schemas.android.com/apk/res/android" package="com.chance.squat" android:versionCode="1" android:versionName="1.0"> <application android:icon="@drawable/icon" android:label="@string/app_name" android:theme="@style/CustomTheme"> <uses-library android:name="com.google.android.maps"/> <activity android:name=".MyApp" android:label="@string/app_name"> <intent-filter> <action android:name="android.intent.action.MAIN" /> <category android:name="android.intent.category.LAUNCHER" /> </intent-filter> </activity> <activity android:name="com.chance.squat.Search" android:label="@string/app_name"> <intent-filter> <action android:name="android.intent.action.MAIN" /> </intent-filter> </activity> <activity android:name="com.chance.squat.Add" android:label="@string/app_name"> <intent-filter> <action android:name="android.intent.action.MAIN" /> </intent-filter> </activity> <activity android:name="com.chance.squat.About" android:label="@string/app_name"> <intent-filter> <action android:name="android.intent.action.MAIN" /> </intent-filter> </activity> </application> <uses-permission android:name="android.permission.INTERNET"/> </manifest> I also have downloaded the Google APIs for version 8 and have set to build against them. My problem is it doesn't seem to find import com.google.android.maps.MapActivity and I don't know why or what the next step is. Can anyone help?

    Read the article

  • Multiple value array

    - by Ant..
    I am new to jScript and have written this code [which works perfectly]. Its purpose is to test that the term for the amount of loan is not exceeded. Can the process be consolidated into one array where you pass the loan amount which returns the term based on the range i.e. 6000 to 7000 = 96 function TestMaxTerm() { var LnAmt = 14000 //Testing Purposes var Term = 0 //Testing Purposes if (LnAmt > 0 && LnAmt <= 1000){Term = 0;} if (LnAmt > 1000 && LnAmt <= 2000){Term = 1;} if (LnAmt > 2000 && LnAmt <= 3000){Term = 2;} if (LnAmt > 3000 && LnAmt <= 4000){Term = 3;} if (LnAmt > 4000 && LnAmt <= 5000){Term = 4;} if (LnAmt > 5000 && LnAmt <= 6000){Term = 5;} if (LnAmt > 6000 && LnAmt <= 7000){Term = 6;} if (LnAmt > 7000 && LnAmt <= 8000){Term = 7;} if (LnAmt > 8000 && LnAmt <= 9000){Term = 8;} if (LnAmt > 9000 && LnAmt <= 10000){Term = 9;} if (LnAmt > 10000 && LnAmt <= 11000){Term = 10;} if (LnAmt > 11000 && LnAmt <= 12000){Term = 11;} if (LnAmt > 11000){Term = 12;} //Obtain Maximum Term for Loan Amount var MaxTerm = new Array(); MaxTerm[0] = 24; MaxTerm[1]=36; MaxTerm[2] = 48; MaxTerm[3] = 60; MaxTerm[5] = 72; MaxTerm[5]=84; MaxTerm[6] = 96; MaxTerm[7] = 108; MaxTerm[8] = 120; MaxTerm[9]=132; MaxTerm[10] = 164; MaxTerm[11] = 176; MaxTerm[12] = 420; var text = MaxTerm[Term]; alert(text); }

    Read the article

< Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >