Search Results

Search found 1668 results on 67 pages for 'miss a'.

Page 54/67 | < Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >

  • Zend Cache is not retrieving cache items after some period of time

    - by Phil
    Hi, I am using Zend Cache with page caching but it seems to miss the cache after a period of time. For a while it is OK, but I come back tomorrow and hit the page, it doesn't fetch the contents from the cache. why? $frontendOptions = array( 'content_type_memorization' => true, // This remembers the headers, needed for images 'lifetime' => NULL, // cache lifetime forever 'automatic_serialization' => true, 'automatic_cleaning_factor' => 0 ); $myPageCache = new Zend_Cache_Frontend_Page(array( 'debug_header' => false, 'automatic_cleaning_factor'=>0, 'content_type_memorization' => true, 'default_options' => array( 'cache' => true, 'cache_with_get_variables' => true, 'cache_with_post_variables' => true, 'cache_with_session_variables' => true, 'cache_with_cookie_variables' => true ))); $backendOptions = array('cache_dir' => '.' . DIRECTORY_SEPARATOR . 'cache' . DIRECTORY_SEPARATOR); $cache = Zend_Cache::factory($myPageCache, 'File', $frontendOptions, $backendOptions); $cacheKey = hash('md5', "cache_" . $cachePath); // cachePath is the key I use for the cache if(!$cache->start($cacheKey)) { I output html here $cache->end(); }

    Read the article

  • Static Data Structures on Embedded Devices (Android in particular)

    - by Mark
    I've started working on some Android applications and have a question regarding how people normally deal with situations where you have a static data set and have an application where that data is needed in memory as one of the standard java collections or as an array. In my current specific issue i have a spreadsheet with some pre-calculated data. It consists of ~100 rows and 3 columns. 1 Column is a string, 1 column is a float, 1 column is an integer. I need access to this data as an array in java. It seems like i could: 1) Encode in XML - This would be cpu intensive to decode in my experience. 2) build into SQLite database - seems like a lot of overhead for static access to data i only need array style access to in ram. 3) Build into binary blob and read in. (never done this in java, i miss void *) 4) Build a python script to take the CSV version of my data and spit out a java function that adds the values to my desired structure with hard coded values. 5) Store a string array via androids resource mechanism and compute the other 2 columns on application load. In my case the computation would require a lot of calls to Math.log, Math.pow and Math.floor which i'd rather not have to do for load time and battery usage reasons. I mostly work in low power embedded applications in C and as such #4 is what i'm used to doing in these situations. It just seems like it should be far easier to gain access to static data structures in java/android. Perhaps I'm just being too battery usage conscious and in my single case i imagine the answer is that it doesn't matter much, but if every application took that stance it could begin to matter. What approaches do people usually take in this situation? Anything I missed?

    Read the article

  • How to customize the pop up menu in iPhone?

    - by Allen Dang
    The application I'm creating needs a function like user selects some text, a pop up menu shows, and user clicks "search" menu to perform a search directly. Problem is the current pop up menu provided by UIMenuController doesn't support to be extended. So my thought is to subscribe "UIMenuControllerDidShowMenuNotification", get the frame of pop up menu, and display the "search" button right aside. But during the implementation, I met a strange problem, the notification seems never be sent, means after the menu shown, I still cannot be notified, following are the key section of code. - (void)viewDidLoad { [super viewDidLoad]; [[NSNotificationCenter defaultCenter] addObserver:self selector:@selector(menuDidShow:) name:UIMenuControllerWillShowMenuNotification object:nil]; } - (void)viewDidUnload { // Release any retained subviews of the main view. // e.g. self.myOutlet = nil; [[NSNotificationCenter defaultCenter] removeObserver:self name:UIMenuControllerDidShowMenuNotification object:nil]; self.textView = nil; self.searchBar = nil; } - (void)menuDidShow:(NSNotification *)notification { NSLog(@"menu did show!"); } The code is too simple to make mistake, can someone help me to understand what's going on? Or what did I miss?

    Read the article

  • How to change disclosure style when user enters in edit mode of a UITableView?

    - by R31n4ld0
    Hello, guys. I have a UITableView that in 'normal' mode, show a UITableViewCellAccessoryDisclosureIndicator meaning if the user taps the row, another list is showed, like HIG says: "Disclosure indicator. When this element is present, users know they can tap anywhere in the row to see the next level in the hierarchy or the choices associated with the list item. Use a disclosure indicator in a row when selecting the row results in the display of another list. Don’t use a disclosure indicator to reveal detailed information about the list item; instead, use a detail disclosure button for this purpose." When the user tap the edit button in the top bar of the UITableView, I think I have to change the disclosure because if the user tap it, a view for changing the information of the current row is showed (see the bold line above), again, like HIG says: "Detail disclosure button. Users tap this element to see detailed information about the list item. (Note that you can use this element in views other than table views, to reveal additional details about something; see “Detail Disclosure Buttons” for more information.) In a table view, use a detail disclosure button in a row to display details about the list item. Note that the detail disclosure button, unlike the disclosure indicator, can perform an action that is separate from the selection of the row. For example, in Phone Favorites, tapping the row initiates a call to the contact; tapping the detail disclosure button in the row reveals more information about the contact." Have I miss understood the HIG, or I really do have to change the disclosure style in edit mode of UITableView? If yes, how I can intercept the edit mode when the user taps the Edit button? Thanks in advance.

    Read the article

  • Using IsolatedStorage on a IIS server

    - by JoeBilly
    I'am a bit confusing about the use of Isolated Storage on an IIS server. I understand the goal of Isolated Storage : provides a safe place to store data with no worry about how and where is this place. Since Isolated Storage has a by-user and by-assembly approach, I'am not to wild about using it on a IIS server where applications have almost their own identity. I haven't really seen the interest of impersonating a web application and almost never seen impersonated web applications myself but this is my point of view. Using Isolated Storage on a server mean : Using Isolated stores in \Documents and Settings\<user>\ Which mean \Documents and Settings\Default User\ when the application pool is owned by Local System or Network Services I guess Which also mean Write rights on this folder for Local System or Network Services Using of impersonation Regarding a web application (logic), these ideas are confusing me... Document and Settings ? Default User ? Enable impersonation just for storage ? No control about storage on server ? Uh ? And then I'am a front of a dilema : use System.IO.Packaging (with Isolated Storage inside) on web applications or find an alternative ? Am I wrong in my approach ? Did I miss something ? Any point of view is appreciated and an explanation about the Isolated Storage with IIS philosophy could be an anwser. Thanks !

    Read the article

  • Non-Relational Database Design

    - by Ian Varley
    I'm interested in hearing about design strategies you have used with non-relational "nosql" databases - that is, the (mostly new) class of data stores that don't use traditional relational design or SQL (such as Hypertable, CouchDB, SimpleDB, Google App Engine datastore, Voldemort, Cassandra, SQL Data Services, etc.). They're also often referred to as "key/value stores", and at base they act like giant distributed persistent hash tables. Specifically, I want to learn about the differences in conceptual data design with these new databases. What's easier, what's harder, what can't be done at all? Have you come up with alternate designs that work much better in the non-relational world? Have you hit your head against anything that seems impossible? Have you bridged the gap with any design patterns, e.g. to translate from one to the other? Do you even do explicit data models at all now (e.g. in UML) or have you chucked them entirely in favor of semi-structured / document-oriented data blobs? Do you miss any of the major extra services that RDBMSes provide, like relational integrity, arbitrarily complex transaction support, triggers, etc? I come from a SQL relational DB background, so normalization is in my blood. That said, I get the advantages of non-relational databases for simplicity and scaling, and my gut tells me that there has to be a richer overlap of design capabilities. What have you done? FYI, there have been StackOverflow discussions on similar topics here: the next generation of databases changing schemas to work with Google App Engine choosing a document-oriented database

    Read the article

  • iPhone: UIImagePickerController Randomly Fails to Take Picture

    - by pion
    I use a UIPickerViewController to take picture. It works 80% but seemingly at random it fails to take a picture. In tracing the code I found out that it occasionally goes to -PinRecordNewTableViewController:viewDidUnload. That is where it fails because it set nil to all ivars. @interface PinRecordNewTableViewController : UITableViewController { } ... @implementation PinRecordNewTableViewController ... - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { ... PinRecordNewPicture *pinRecordNewPicture = [[PinRecordNewPicture alloc] initWithNibName:@"PinRecordNewPicture" bundle:nil]; pinRecordNewPicture.delegate = self; [self.navigationController pushViewController:pinRecordNewPicture animated:YES]; [pinRecordNewPicture release]; ... } @interface PinRecordNewPicture : UIViewController ... @implementation PinRecordNewPicture ... - (void)picturePicker:(UIImagePickerControllerSourceType)theSource { UIImagePickerController *picker = [[UIImagePickerController alloc] init]; picker.delegate = self; picker.sourceType = theSource; picker.allowsEditing = YES; [self presentModalViewController:picker animated:YES]; [picker release]; } - (IBAction) takePicture:(id)sender { UIImagePickerControllerSourceType source = UIImagePickerControllerSourceTypeCamera; if ([UIImagePickerController isSourceTypeAvailable:source]) { [self picturePicker:source]; } What did I do wrong? Did I miss something that causes it to behave "randomly"? Thanks in advance for your help.

    Read the article

  • Passing Control's Value to Modal Popup

    - by Sherwin Valdez
    Hello, Just would like know how to pass textbox value to a modal popup after clicking a button using ModalPopUpExtender in ASP.NET, I've tried these codes but seems that I have no luck :( <script runat="server"> protected void Page_Load(object sender, EventArgs e) { Button1.Attributes.Add("onclick", "showModalPopup(); return false;"); } </script> <asp:ScriptManager ID="ScriptManager1" runat="server"> </asp:ScriptManager> <asp:TextBox ID="TextBox1" runat="server"></asp:TextBox> <asp:Button ID="Button1" runat="server" Text="Button" OnClick='showModalPopup(); return false;' /> <cc1:ModalPopupExtender ID="ModalPopupExtender1" runat="server" TargetControlID="Button1" PopupControlID="Panel1" CancelControlID="btnCancel" OkControlID="btnOkay" BackgroundCssClass="ModalPopupBG"> </cc1:ModalPopupExtender> <asp:Panel ID="Panel1" Style="display: none" runat="server"> <div class="HellowWorldPopup"> <div class="PopupHeader" id="PopupHeader"> Header</div> <div class="PopupBody"> <asp:Label ID="Label1" runat="server"></asp:Label> </div> <div class="Controls"> <input id="btnOkay" type="button" value="Done" /> <input id="btnCancel" type="button" value="Cancel" /> </div> </div> </asp:Panel> javascript function showModalPopup() { //show the ModalPopupExtender var value; value = document.getElementById("TextBox1").value; $get("<%=Label1.ClientID %>").value = value; $find("<%=ModalPopupExtender1.ClientID %>").show(); } I wonder what I miss out :(, Thanks and I hope someone could help me :)

    Read the article

  • Loading a RSA private key from memory using libxmlsec

    - by ereOn
    Hello, I'm currently using libxmlsec into my C++ software and I try to load a RSA private key from memory. To do this, I searched trough the API and found this function. It takes binary data, a size, a format string and several PEM-callback related parameters. When I call the function, it just stucks, uses 100% of the CPU time and never returns. Quite annoying, because I have no way of finding out what is wrong. Here is my code: d_xmlsec_dsig_context->signKey = xmlSecCryptoAppKeyLoadMemory( reinterpret_cast<const xmlSecByte*>(data), static_cast<xmlSecSize>(datalen), xmlSecKeyDataFormatBinary, NULL, NULL, NULL ); data is a const char* pointing to the raw bytes of my RSA key (using i2d_RSAPrivateKey(), from OpenSSL) and datalen the size of data. My test private key doesn't have a passphrase so I decided not to use the callbacks for the time being. Has someone already done something similar ? Do you guys see anything that I could change/test to get forward on this problem ? I just discovered the library on yesterday, so I might miss something obvious here; I just can't see it. Thank you very much for your help.

    Read the article

  • Parameterized Queries /Without/ using queries.

    - by Aren B
    I've got a bit of a poor situation here. I'm stuck working with commerce server, which doesn't do a whole lot of sanitization/parameterization. I'm trying to build up my queries to prevent SQL Injection, however some things like the searches / where clause on the search object need to be built up, and there's no parameterized interface. Basically, I cannot parameterize, however I was hoping to be able to use the same engine to BUILD my query text if possible. Is there a way to do this, aside from writing my own parameterizing engine which will probably still not be as good as parameterized queries? Update: Example The where clause has to be built up as a sql query where clause essentially: CatalogSearch search = /// Create Search object from commerce server search.WhereClause = string.Format("[cy_list_price] > {0} AND [Hide] is not NULL AND [DateOfIntroduction] BETWEEN '{1}' AND '{2}'", 12.99m, DateTime.Now.AddDays(-2), DateTime.Now); *Above Example is how you refine the search, however we've done some testing, this string is NOT SANITIZED. This is where my problem lies, because any of those inputs in the .Format could be user input, and while i can clean up my input from text-boxes easily, I'm going to miss edge cases, it's just the nature of things. I do not have the option here to use a parameterized query because Commerce Server has some insane backwards logic in how it handles the extensible set of fields (schema) & the free-text search words are pre-compiled somewhere. This means I cannot go directly to the sql tables What i'd /love/ to see is something along the lines of: SqlCommand cmd = new SqlCommand("[cy_list_price] > @MinPrice AND [DateOfIntroduction] BETWEEN @StartDate AND @EndDate"); cmd.Parameters.AddWithValue("@MinPrice", 12.99m); cmd.Parameters.AddWithValue("@StartDate", DateTime.Now.AddDays(-2)); cmd.Parameters.AddWithValue("@EndDate", DateTime.Now); CatalogSearch search = /// constructor search.WhereClause = cmd.ToSqlString();

    Read the article

  • How would you answer Joel's sample programming questions?

    - by Khorkrak
    I recently interviewed a candidate for a new position here. I wish though that I'd read Joel's Guerrilla Guide to Interviewing prior to that interview - naturally I happened upon it the night afterwards :P http://www.joelonsoftware.com/articles/GuerrillaInterviewing3.html So I tried answering the easy questions myself - yeah I used the python interpreter to type stuff in and tested the results a bit - I didn't look up any solutions beforehand though and I also thought about how long it took me to come up with answers for each one and what I'd look for the next time I interview someone. I'd let them type stuff into the interpreter and see how did used python's introspection capabilities too to find out things like what's the re module's method for building a regex etc. Here are my answers - these are in python of course - what are yours in your favourite language? Do you see any issues with the answers I came up with - i.e. how could they be improved upon - what did I miss? Joel's example questions: Write a function that determines if a string starts with an upper-case letter A-Z. import re upper_regex = re.compile("^[A-Z]") def starts_with_upper(text): return upper_regex.match(text) is not None Write a function that determines the area of a circle given the radius. from math import pi def area(radius): return pi * radius**2 Add up all the values in an array. sum([1, 2, 3, 4, 5]) Harder Question: Write an example of a recursive function - so how about the classic factorial one: def factorial(num): if num > 1: return num * factorial(num - 1) else: return 1

    Read the article

  • How does 'lazy' work?

    - by Matt Fenwick
    What is the difference between these two functions? I see that lazy is intended to be lazy, but I don't understand how that is accomplished. -- | Identity function. id :: a -> a id x = x -- | The call '(lazy e)' means the same as 'e', but 'lazy' has a -- magical strictness property: it is lazy in its first argument, -- even though its semantics is strict. lazy :: a -> a lazy x = x -- Implementation note: its strictness and unfolding are over-ridden -- by the definition in MkId.lhs; in both cases to nothing at all. -- That way, 'lazy' does not get inlined, and the strictness analyser -- sees it as lazy. Then the worker/wrapper phase inlines it. -- Result: happiness Tracking down the note in MkId.lhs (hopefully this is the right note and version, sorry if it's not): Note [lazyId magic] ~~~~~~~~~~~~~~~~~~~ lazy :: forall a?. a? -> a? (i.e. works for unboxed types too) Used to lazify pseq: pseq a b = a `seq` lazy b Also, no strictness: by being a built-in Id, all the info about lazyId comes from here, not from GHC.Base.hi. This is important, because the strictness analyser will spot it as strict! Also no unfolding in lazyId: it gets "inlined" by a HACK in CorePrep. It's very important to do this inlining after unfoldings are exposed in the interface file. Otherwise, the unfolding for (say) pseq in the interface file will not mention 'lazy', so if we inline 'pseq' we'll totally miss the very thing that 'lazy' was there for in the first place. See Trac #3259 for a real world example. lazyId is defined in GHC.Base, so we don't have to inline it. If it appears un-applied, we'll end up just calling it. I don't understand that because it refers to lazyId instead of lazy. How does lazy work?

    Read the article

  • What are alternatives to Win32 PulseEvent() function?

    - by Bill
    The documentation for the Win32 API PulseEvent() function (kernel32.dll) states that this function is “… unreliable and should not be used by new applications. Instead, use condition variables”. However, condition variables cannot be used across process boundaries like (named) events can. I have a scenario that is cross-process, cross-runtime (native and managed code) in which a single producer occasionally has something interesting to make known to zero or more consumers. Right now, a well-known named event is used (and set to signaled state) by the producer using this PulseEvent function when it needs to make something known. Zero or more consumers wait on that event (WaitForSingleObject()) and perform an action in response. There is no need for two-way communication in my scenario, and the producer does not need to know if the event has any listeners, nor does it need to know if the event was successfully acted upon. On the other hand, I do not want any consumers to ever miss any events. In other words, the system needs to be perfectly reliable – but the producer does not need to know if that is the case or not. The scenario can be thought of as a “clock ticker” – i.e., the producer provides a semi-regular signal for zero or more consumers to count. And all consumers must have the correct count over any given period of time. No polling by consumers is allowed (performance reasons). The ticker is just a few milliseconds (20 or so, but not perfectly regular). Raymen Chen (The Old New Thing) has a blog post pointing out the “fundamentally flawed” nature of the PulseEvent() function, but I do not see an alternative for my scenario from Chen or the posted comments. Can anyone please suggest one? Please keep in mind that the IPC signal must cross process boundries on the machine, not simply threads. And the solution needs to have high performance in that consumers must be able to act within 10ms of each event.

    Read the article

  • How to Disable/Enable WYSIWYG editor in Magento 1.4

    - by latvian
    Hi When entering code in CMS static block(possible page as well) and in this code there is empty DIV tags such us: <a href="javascript:hide1(),show2(),hide3()"><div class="dropoff_button"></div></a> The DIV tags will be gone next time you open the block to edit. it will look as this <a href="javascript:hide1(),show2(),hide3()"> </a> without the div tags ...and saving again it modifies your code. I think it something to do with the 'show/hide editor'. By default it goes into the WYSIWYG editor, so when updating static block i don't see any other solution than 1."hide the editor' by clicking 'show/hide editor' 2.delete the old code from the editor 3. get code that doesn't miss the DIVs 4. Merge new code with code in 3 in some other editing software than magento 5. paste result in the magento editor, 6. Save Is this bug? What is your solution? Can i turn of WYSIWYG editor?

    Read the article

  • Long running stateful service in .NET

    - by Asaf R
    Hi, I need to create a service in .NET that maintains (inner) state in-memory, spawns multiple threads and is generally long-running. There are a lot options - Good-old Windows Service Windows Communication Services Windows Workflow Foundation I really don't know which to choose. Most of the functionality is in a library used by this service, so the service itself is rather simple. On one hand, it's important the service host is as close to "simply working" as possible, which excludes Windows Service. On the other hand, it's important that the service is not taken down by the host just because there's no external activity, which makes WCF kind o' "scary". As for WF, it's strongest selling point is the ability to create processes as, um..., workflows, which is something I don't need nor want. To sum it up, the plethora of Microsoft technologies got me a bit confused. I'd appreciate help regarding the pros and cons of each solution (or other's I've failed to mention) for the problem of a stateful, long running service in .NET Thanks, Asaf P.S., I'm using .NET 4. EDIT: What I mean by the host "simply working" is, for example, that the service I create be reactivated if it crashes. I guess the reason for this question is that I've created Windows Services in the past (I think it was in plain C++ with Win32 API), and I don't want to miss out on something simpler if there's is such as thing. Thanks for all the replies thus far! Asaf.

    Read the article

  • Publish Maven artifacts on FTP with Hudson FTP Publisher Plugin

    - by jaguard
    I'm building a number of artefacts (zip files for different environments: test, dev) using the maven-assembly-plugin using a specialized Maven profile. These artefacts I want to copy/collect on on a FTP server keeping the version (01.07.10.16.Wed-1626) as a folder, so I need to copy from test/build/01.07.10.16.Wed-1626/ to ftp://my-ftp-server:21/projects/myserver-1.7/01.07.10.16.Wed-1626/ The layout for the Maven output is this: target/ build/ 01.07.10.16.Wed-1626/ my-server-01.07.10.16.Wed-1626-dev.zip my-server-01.07.10.16.Wed-1626-test.zip For copying the artefacts I'm using FTP Publisher Plugin but it seams I miss something since that even the build is OK and the artefacts are build without problem but the job is finishing without copying the artefacts, and in the console there is no log info about copying the artefacts My FTP publisher config (FTP repository hosts) is: Hostname: my-ftp-server Port: 21 Timeout: 10000 Root Repository Path: projects User Name: my-user Password: my-pass My Hudson job FTP publisher config (Publish artifacts to FTP) is: FTP site: my-ftp-server Files to upload Source: target/build/** Destination: myserver-1.7 1: There is any log to check if there are any FTP copy errors ? 2: There is any problem with the file pattern (source) or with the dest ?

    Read the article

  • Project with multiple binaries in Eclipse CDT

    - by Robert Schneider
    I think it is quite normal to have more than one binary in a project. However, with Eclipse CDT I don't know how to set up the IDE to get things done. I know I can create several projects - one per binary. And I know I can set the dependencies per project. However, I cannot regard them as one project in Eclipse. If I'd like to share the code with a version control system (like svn), each developer has to import the projects separately. What I miss is something like the Solution (sln file) in Visual Studio. Should I create a single project and create the make files by myself? I haven't tried it out yet, but there is this 'project set' which can be ex- and imported. Is this the solution? Can this be put into version control? My goal it to put everything under version control, not only subprojects. I cannot imagine that CDT makes only sense for single-binary applications. How can I work properly?

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Defining jUnit Test cases Correctly

    - by Epitaph
    I am new to Unit Testing and therefore wanted to do some practical exercise to get familiar with the jUnit framework. I created a program that implements a String multiplier public String multiply(String number1, String number2) In order to test the multiplier method, I created a test suite consisting of the following test cases (with all the needed integer parsing, etc) @Test public class MultiplierTest { Multiplier multiplier = new Multiplier(); // Test for 2 positive integers assertEquals("Result", 5, multiplier.multiply("5", "1")); // Test for 1 positive integer and 0 assertEquals("Result", 0, multiplier.multiply("5", "0")); // Test for 1 positive and 1 negative integer assertEquals("Result", -1, multiplier.multiply("-1", "1")); // Test for 2 negative integers assertEquals("Result", 10, multiplier.multiply("-5", "-2")); // Test for 1 positive integer and 1 non number assertEquals("Result", , multiplier.multiply("x", "1")); // Test for 1 positive integer and 1 empty field assertEquals("Result", , multiplier.multiply("5", "")); // Test for 2 empty fields assertEquals("Result", , multiplier.multiply("", "")); In a similar fashion, I can create test cases involving boundary cases (considering numbers are int values) or even imaginary values. 1) But, what should be the expected value for the last 3 test cases above? (a special number indicating error?) 2) What additional test cases did I miss? 3) Is assertEquals() method enough for testing the multiplier method or do I need other methods like assertTrue(), assertFalse(), assertSame() etc 4) Is this the RIGHT way to go about developing test cases? How am I "exactly" benefiting from this exercise? 5)What should be the ideal way to test the multiplier method? I am pretty clueless here. If anyone can help answer these queries I'd greatly appreciate it. Thank you.

    Read the article

  • Basic jUnit Questions

    - by Epitaph
    I was testing a String multiplier class with a multiply() method that takes 2 numbers as inputs (as String) and returns the result number (as String) `public String multiply(String num1, String num2); I have done the implementation and created a test class with the following test cases involving the input String parameter as 1) valid numbers 2) characters 3) special symbol 4) empty string 5) Null value 6) 0 7) Negative number 8) float 9) Boundary values 10) Numbers that are valid but their product is out of range 11) numbers will + sign (+23) 1) I'd like to know if "each and every" assertEquals() should be in it's own test method? Or, can I group similar test cases like testInvalidArguments() to contains all asserts involving invalid characters since ALL of them throw the same NumberFormatException ? 2) If testing an input value like character ("a"), do I need to include test cases for ALL scenarios? "a" as the first argument "a" as the second argument "a" and "b" as the 2 arguments 3) As per my understanding, the benefit of these unit tests is to find out the cases where the input from a user might fail and result in an exception. And, then we can give the user with a meaningful message (asking them to provide valid input) instead of an exception. Is that the correct? And, is it the only benefit? 4) Are the 11 test cases mentioned above sufficient? Did I miss something? Did I overdo? When is enough? 5) Following from the above point, have I successfully tested the multiply() method?

    Read the article

  • Looking for Hardware that will easily interface with my .NET code.

    - by SkippyFire
    I'm a .NET C# developer looking to do some hardware interfacing/programming. I just want something super simple to mess around with. I have done one of those basic stamp projects, but I want something with less electrical work. A self-contained piece of hardware would be fine. I'm not really looking to do embedded programming... but that would actually be pretty cool if something was capable of running .net code. I'm looking for something that would be easy to connect, hopefully via USB. Serial ports seems to be more hit or miss nowadays with laptops and netbooks. Something I can easily send data to, like a mini LCD, or series of LED's. Better yet would be something that provides feedback, like a temperature sensor. The best would be something more featured that I could talk to. I would be able to send data to it, and it would send back responses. Maybe something like a servo that could report it's position? Or maybe something that I could set parameters on? Any ideas? Thanks in advance!

    Read the article

  • check status application pool iis7 with csharp (access-denied)

    - by jack
    I need to monitor the status of an application in the applications pool of IIS 7 from an other machine on the same domain. My monitoring application must be in C# and running as a Windows service. On my server, I create a user with administration rights and I execute the command aspnet_regiis -ga machine\username wich worked succesfully. My problem is when I try to access the application pool i still get COMExcepttion "Access denied". What did i do wrong or wich step did i miss? I used code from http://patelshailesh.com/index.php/create-a-website-application-pool-programmatically-using-csharp as example. int status = 0; string ipAddress = "10.20.2.13"; string username = "username"; string password = "password"; try { DirectoryEntry de = new DirectoryEntry(string.Format("IIS://{0}/W3SVC/AppPools/MyAppPoolName", ipAddress), username, password); //the exception is thron here. status = (int)de.InvokeGet("AppPoolState"); switch (status) { case 2: //Runnig break; case 4: //Stopped break; default: break; } } catch (Exception ex) { }

    Read the article

  • Jquery with multi level json data array

    - by coder
    var data = [{"Address":{"Address":"4 Selby Road\nHowden","AddressId":"1414449","AddressLine1":"4 Selby Road","AddressLine2":"Howden","ContactId":"14248844","County":"North Humberside","Country":"UK","Postcode":"DN14 7JW","Town":"GOOLE","FullAddress":"4 Selby Road\nHowden\r\nGOOLE\r\nNorth Humberside\r\nDN14 7JW\r\nUnited Kingdom"},"ContactId":14248844,"Title":"Mrs","FirstName":"","Surname":"Neild","FullName":" Neild","PostCode":"DN14 7JW"},{"Address":{"Address":"466 Manchester Road\nBlackrod","AddressId":"1669615","AddressLine1":"466 Manchester Road","AddressLine2":"Blackrod","ContactId":"16721687","County":"","Country":"UK","Postcode":"BL6 5SU","Town":"BOLTON","FullAddress":"466 Manchester Road\nBlackrod\r\nBOLTON\r\nBL6 5SU\r\nUnited Kingdom"},"ContactId":16721687,"Title":"Miss","FirstName":"Andrea","Surname":"Neild","FullName":"Andrea Neild","PostCode":"BL6 5SU"},{"Address":{"Address":"5 Prospect Vale\nHeald Green","AddressId":"2127294","AddressLine1":"5 Prospect Vale","AddressLine2":"Heald Green","ContactId":"21178752","County":"Cheshire","Country":"UK","Postcode":"SK8 3RJ","Town":"CHEADLE","FullAddress":"5 Prospect Vale\nHeald Green\r\nCHEADLE\r\nCheshire\r\nSK8 3RJ\r\nUnited Kingdom"},"ContactId":21178752,"Title":"Mrs","FirstName":"","Surname":"Neild","FullName":" Neild","PostCode":"SK8 3RJ"}]; I'm tring to retrieve above json fommated data in jquery as below: var source = { localdata: data, sort: customsortfunc, datafields: [ { name: 'Surname', type: 'string' }, { name: 'FirstName', type: 'string' }, { name: 'Title', type: 'string' }, { name: 'Address.Address', type: 'string' } ], datatype: "array" }; var dataAdapter = new $.jqx.dataAdapter(source); $("#jqxgrid").jqxGrid( { width: 670, source: dataAdapter, theme: theme, sortable: true, pageable: true, autoheight: true, ready: function () { //$("#jqxgrid").jqxGrid('sortby', 'firstname', 'asc'); $("#jqxgrid").jqxGrid('sortby', 'FirstName', 'asc'); }, columns: [ { text: 'Title', datafield: 'Title', width: 100 }, { text: 'First Name', datafield: 'FirstName', width: 100 }, { text: 'Last Name', datafield: 'Surname', width: 100 }, { text: 'Address', datafield: 'Address.Address', width: 100 }, ] }); The only issue is there is no display for "Address.Adress". Can anyone advise me ?

    Read the article

  • Why won't this DOM element disappear?

    - by George Edison
    I have a page that uses jQuery with a small glitch. I managed to get this down to a simple example that demonstrates the problem: <html> <head> <script type="text/javascript" src="jquery.js"></script> <script type="text/javascript"> function hideIt() { $('#hideme').fadeOut('slow', function() { $(this).remove(); } ); } </script> </head> <body> <div id='#hideme'>Hide me!</div> <button onclick='hideIt();'>Hide</button> </body> </html> As you would expect, the problem is simple: the caption doesn't disappear. What simple thing did I overlook? (Or if it's not a simple thing, what complicated thing did I miss?)

    Read the article

  • Why is XmlSerializer so hard to use?

    - by mafutrct
    I imagine to use XML serialization like this: class Foo { public Foo (string name) { Name1 = name; Name2 = name; } [XmlInclude] public string Name1 { get; private set; } [XmlInclude] private string Name2; } StreamWriter wr = new StreamWriter("path.xml"); new XmlSerializer<Foo>().Serialize (wr, new Foo ("me")); But this does not work at all: XmlSerializer is not generic. I have to cast from and to object on (de)serialization. Every property has to be fully public. Why aren't we just using Reflection to access private setters? Private fields cannot be serialized. I'd like to decorate private fields with an attribute to have XmlSerializer include them. Did I miss something and XmlSerializer is actually offering the described possibilities? Are there alternate serializers to XML that handle these cases more sophisticatedly? If not: We're in 2010 after all, and .NET has been around for many years. XML serialization is often used, totally standard and should be really easy to perform. Or is my understanding possibly wrong and XML serialization ought not to expose the described features for a good reason? (Feel free to adjust caption or tags. If this should be CW, please just drop a note.)

    Read the article

< Previous Page | 50 51 52 53 54 55 56 57 58 59 60 61  | Next Page >