Search Results

Search found 35206 results on 1409 pages for 'string interning'.

Page 540/1409 | < Previous Page | 536 537 538 539 540 541 542 543 544 545 546 547  | Next Page >

  • Regex not working in one case

    - by Arnej65
    I have a string with the following information. Obabikon, ON 49°10'N 94°10’W 2278 km N69°W I have a regex search as follows: String LongPattern = @"(~)?([0-9\?])+°([0-9\?])*'[EWO]"; return FindPattern(source, LongPattern); It should be finding the <94°10’W But is it not. This regex is working for the rest of my data with out any problems. Any clues?

    Read the article

  • Get the type name

    - by Neir0
    How i can get full right name of generic type? For example: This code typeof(List<string>).Name return List`1 instead of List<string> How to get a right name?

    Read the article

  • Binary data instead of actual image in C#

    - by acadia
    Hello, I am using the below mentioned library to create a barcode which is storing in a specified location as shown below: My question is, is there a way instead of saving it to a png file I get byte data? thanks Code39 code = new Code39("10090"); code.Paint().Save("c:/NewBARCODE.png", ImageFormat.Png); using System; using System.Collections.Generic; using System.Drawing; using System.Drawing.Imaging; using System.Diagnostics; namespace BarCode39 { public class Code39Settings { private int height = 60; public int BarCodeHeight { get { return height; } set { height = value; } } private bool drawText = true; public bool DrawText { get { return drawText; } set { drawText = value; } } private int leftMargin = 10; public int LeftMargin { get { return leftMargin; } set { leftMargin = value; } } private int rightMargin = 10; public int RightMargin { get { return rightMargin; } set { rightMargin = value; } } private int topMargin = 10; public int TopMargin { get { return topMargin; } set { topMargin = value; } } private int bottomMargin = 10; public int BottomMargin { get { return bottomMargin; } set { bottomMargin = value; } } private int interCharacterGap = 2; public int InterCharacterGap { get { return interCharacterGap; } set { interCharacterGap = value; } } private int wideWidth = 2; public int WideWidth { get { return wideWidth; } set { wideWidth = value; } } private int narrowWidth = 1; public int NarrowWidth { get { return narrowWidth; } set { narrowWidth = value; } } private Font font = new Font(FontFamily.GenericSansSerif, 12); public Font Font { get { return font; } set { font = value; } } private int codeToTextGapHeight = 10; public int BarCodeToTextGapHeight { get { return codeToTextGapHeight; } set { codeToTextGapHeight = value; } } } public class Code39 { #region Static initialization static Dictionary<char, Pattern> codes; static Code39() { object[][] chars = new object[][] { new object[] {'0', "n n n w w n w n n"}, new object[] {'1', "w n n w n n n n w"}, new object[] {'2', "n n w w n n n n w"}, new object[] {'3', "w n w w n n n n n"}, new object[] {'4', "n n n w w n n n w"}, new object[] {'5', "w n n w w n n n n"}, new object[] {'6', "n n w w w n n n n"}, new object[] {'7', "n n n w n n w n w"}, new object[] {'8', "w n n w n n w n n"}, new object[] {'9', "n n w w n n w n n"}, new object[] {'A', "w n n n n w n n w"}, new object[] {'B', "n n w n n w n n w"}, new object[] {'C', "w n w n n w n n n"}, new object[] {'D', "n n n n w w n n w"}, new object[] {'E', "w n n n w w n n n"}, new object[] {'F', "n n w n w w n n n"}, new object[] {'G', "n n n n n w w n w"}, new object[] {'H', "w n n n n w w n n"}, new object[] {'I', "n n w n n w w n n"}, new object[] {'J', "n n n n w w w n n"}, new object[] {'K', "w n n n n n n w w"}, new object[] {'L', "n n w n n n n w w"}, new object[] {'M', "w n w n n n n w n"}, new object[] {'N', "n n n n w n n w w"}, new object[] {'O', "w n n n w n n w n"}, new object[] {'P', "n n w n w n n w n"}, new object[] {'Q', "n n n n n n w w w"}, new object[] {'R', "w n n n n n w w n"}, new object[] {'S', "n n w n n n w w n"}, new object[] {'T', "n n n n w n w w n"}, new object[] {'U', "w w n n n n n n w"}, new object[] {'V', "n w w n n n n n w"}, new object[] {'W', "w w w n n n n n n"}, new object[] {'X', "n w n n w n n n w"}, new object[] {'Y', "w w n n w n n n n"}, new object[] {'Z', "n w w n w n n n n"}, new object[] {'-', "n w n n n n w n w"}, new object[] {'.', "w w n n n n w n n"}, new object[] {' ', "n w w n n n w n n"}, new object[] {'*', "n w n n w n w n n"}, new object[] {'$', "n w n w n w n n n"}, new object[] {'/', "n w n w n n n w n"}, new object[] {'+', "n w n n n w n w n"}, new object[] {'%', "n n n w n w n w n"} }; codes = new Dictionary<char, Pattern>(); foreach (object[] c in chars) codes.Add((char)c[0], Pattern.Parse((string)c[1])); } #endregion private static Pen pen = new Pen(Color.Black); private static Brush brush = Brushes.Black; private string code; private Code39Settings settings; public Code39(string code) : this(code, new Code39Settings()) { } public Code39(string code, Code39Settings settings) { foreach (char c in code) if (!codes.ContainsKey(c)) throw new ArgumentException("Invalid character encountered in specified code."); if (!code.StartsWith("*")) code = "*" + code; if (!code.EndsWith("*")) code = code + "*"; this.code = code; this.settings = settings; } public Bitmap Paint() { string code = this.code.Trim('*'); SizeF sizeCodeText = Graphics.FromImage(new Bitmap(1, 1)).MeasureString(code, settings.Font); int w = settings.LeftMargin + settings.RightMargin; foreach (char c in this.code) w += codes[c].GetWidth(settings) + settings.InterCharacterGap; w -= settings.InterCharacterGap; int h = settings.TopMargin + settings.BottomMargin + settings.BarCodeHeight; if (settings.DrawText) h += settings.BarCodeToTextGapHeight + (int)sizeCodeText.Height; Bitmap bmp = new Bitmap(w, h, PixelFormat.Format32bppArgb); Graphics g = Graphics.FromImage(bmp); int left = settings.LeftMargin; foreach (char c in this.code) left += codes[c].Paint(settings, g, left) + settings.InterCharacterGap; if (settings.DrawText) { int tX = settings.LeftMargin + (w - settings.LeftMargin - settings.RightMargin - (int)sizeCodeText.Width) / 2; if (tX < 0) tX = 0; int tY = settings.TopMargin + settings.BarCodeHeight + settings.BarCodeToTextGapHeight; g.DrawString(code, settings.Font, brush, tX, tY); } return bmp; } private class Pattern { private bool[] nw = new bool[9]; public static Pattern Parse(string s) { Debug.Assert(s != null); s = s.Replace(" ", "").ToLower(); Debug.Assert(s.Length == 9); Debug.Assert(s.Replace("n", "").Replace("w", "").Length == 0); Pattern p = new Pattern(); int i = 0; foreach (char c in s) p.nw[i++] = c == 'w'; return p; } public int GetWidth(Code39Settings settings) { int width = 0; for (int i = 0; i < 9; i++) width += (nw[i] ? settings.WideWidth : settings.NarrowWidth); return width; } public int Paint(Code39Settings settings, Graphics g, int left) { #if DEBUG Rectangle gray = new Rectangle(left, 0, GetWidth(settings), settings.BarCodeHeight + settings.TopMargin + settings.BottomMargin); g.FillRectangle(Brushes.Gray, gray); #endif int x = left; int w = 0; for (int i = 0; i < 9; i++) { int width = (nw[i] ? settings.WideWidth : settings.NarrowWidth); if (i % 2 == 0) { Rectangle r = new Rectangle(x, settings.TopMargin, width, settings.BarCodeHeight); g.FillRectangle(brush, r); } x += width; w += width; } return w; } } } }

    Read the article

  • Html code clearner

    - by Blanca
    Hi! Is there any library or method to input a String with html code, and which has a return value another String whitout this htmlo code, just the information??? I am watching libraries such JTidy, or HtmlParser, but I don't know how to use it! Something easier??? Thank you!

    Read the article

  • Display html text in uitextview

    - by milanjansari
    Hello, How to display html text in textview for example string <h1>Krupal testing <span style="font-weight: bold;">Customer WYWO</span></h1> Suppose text is bold so it display in textview as bold string but i want display normal text.is this possible in iphone sdk. Thanks you,

    Read the article

  • regex question: independent position of words

    - by Fuxi
    hi all, is it possible to define a regex pattern which checks eg. for 3 terms independent to their position in the main string? eg. my string is something like "click here to unsubscribe: http://www.url.com" the pattern should also work with "http:// unsubscribe click" thx

    Read the article

  • please help turn a simple Python2 code to PHP

    - by user296516
    Hi guys, Sorry to bother again, but I really need help transforming this Python2 code into PHP. net, cid, lac = 25002, 9164, 4000 import urllib a = '000E00000000000000000000000000001B0000000000000000000000030000' b = hex(cid)[2:].zfill(8) + hex(lac)[2:].zfill(8) c = hex(divmod(net,100)[1])[2:].zfill(8) + hex(divmod(net,100)[0])[2:].zfill(8) string = (a + b + c + 'FFFFFFFF00000000').decode('hex') data = urllib.urlopen('http://www.google.com/glm/mmap',string) r = data.read().encode('hex') print float(int(r[14:22],16))/1000000, float(int(r[22:30],16))/1000000 Would be great if someone could help, thanks in advance!

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • How to create a 2D map in Java?

    - by Roman
    I would like to have a mapping which maps two string into one string. For example: map["MainServer","Status"] return "active". What is the best way to do it in Java. Should I use HashMap which include another HashMap as its elements?

    Read the article

  • Weird Javascript Regex Replace Backreference Behavior

    - by arshaw
    why does the following js expression: "test1 foo bar test2".replace(/foo.bar/, "$'") result in the following string? "test1 test2 test2" is the $' in the replace string some sort of control code for including everything after the match??? this behavior was screwing with me most of the day. can anyone explain this? thanks a lot ps- this is the case in all browsers i've tested

    Read the article

  • Java regex return after first match

    - by user216915
    hi how do i return after the first match of regular expression? (does the Matcher.find() method do that? ) say I have a string "abcdefgeee". I want to ask the regex engine stop finding immediately after it finds the first match of "e" for example. I am writing a method to return true/false if the pattern is found and i don't want to find the whole string for "e". (I am looking for a regex solution ) thanks

    Read the article

  • How efficient is Python substring extraction?

    - by Cameron
    I've got the entire contents of a text file (at least a few KB) in string myStr. Will the following code create a copy of the string (less the first character) in memory? myStr = myStr[1:] I'm hoping it just refers to a different location in the same internal buffer. If not, is there a more efficient way to do this? Thanks! Note: I'm using Python 2.5.

    Read the article

  • Need help for a complex linq query

    - by Jipy
    Ok so I've got a DataTable here's the schema DataTable dt = new DataTable(); dt.Columns.Add("word", typeof(string)); dt.Columns.Add("pronunciation", typeof(string)); The table is filled already and I'm trying to make a linq query so that i can output to the console or anywhere something like : Pronunciation : akses9~R => (list of words) I want to output the pronunciations the most common and all the words that use it.

    Read the article

  • Can I make Axis2 generate a WSDL with 'unwrapped' types?

    - by Bedwyr Humphreys
    I'm trying to consume a hello world AXIS2 SOAP web service using a PHP client. The Java class is written in Netbeans and the AXIS2 aar file is generated using the Netbeans AXIS2 plugin. You've all seen it before but here's the java class: public class SOAPHello { public String sayHello(String username) { return "Hello, "+username; } } The wsdl genereated by AXIS2 seems to wrap all the parameters so that when I consume the service i have to use a crazy PHP script like this: $client = new SoapClient("http://myhost:8080/axis2/services/SOAPHello?wsdl"); $parameters["username"] = "Dave"; $response = $client->sayHello($parameters)->return; echo $response."!"; When all I really want to do is echo $client->sayHello("Dave")."!"; My question is two-fold: why is this happening? and what can I do to stop it? :) Here's are the types, message and porttype sections of the generated wsdl: <wsdl:types> <xs:schema attributeFormDefault="qualified" elementFormDefault="qualified" targetNamespace="http://soap.axis2.myhost.co.uk"> <xs:element name="sayHello"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="username" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="sayHelloResponse"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="return" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> </wsdl:types> <wsdl:message name="sayHelloRequest"> <wsdl:part name="parameters" element="ns:sayHello"/> </wsdl:message> <wsdl:message name="sayHelloResponse"> <wsdl:part name="parameters" element="ns:sayHelloResponse"/> </wsdl:message> <wsdl:portType name="SOAPHelloPortType"> <wsdl:operation name="sayHello"> <wsdl:input message="ns:sayHelloRequest" wsaw:Action="urn:sayHello"/> <wsdl:output message="ns:sayHelloResponse" wsaw:Action="urn:sayHelloResponse"/> </wsdl:operation> </wsdl:portType>

    Read the article

  • need to display proper JP char in the output

    - by Amit
    Hello All, I am creating a string containing HTML tags and some data and storing it in 2 diff formats ( eng and Jp) and finally saving complete stirng using streamwriter in a file as HTML. Output written in English is perfect but JP output is not coming as expected ? Issue: I need to display proper JP char in the output, as of now thay are not appearing as expected..any suggestion ? Thanks in advance... Not sure but could this b b/c of encoding supported by string/stringbuilder ?

    Read the article

  • Regular expression to extract text between either square or curly brackets

    - by ObiWanKenobi
    Related to my previous question, I have a string on the following format: this {is} a [sample] string with [some] {special} words. [another one] What is the regular expression to extract the words within either square or curly brackets, ie. {is} [sample] [some] {special} [another one] Note: In my use case, brackets cannot be nested. I would also like to keep the enclosing characters, so that I can tell the difference between them when processing the results.

    Read the article

  • Bash: Correct way to Iterate over Map

    - by Lars Tackmann
    In Bash I can create a map (hashtable) with this common construction hput() { eval "$1""$2"='$3' } hget() { eval echo '${'"$1$2"'#hash}' } and then use it like this: hput capitols France Paris hput capitols Spain Madrid echo "$(hget capitols France)" But how do I best iterate over the entries in the map ?. For instance, in Java I would do: for (Map.Entry<String, String> entry : capitols.entrySet()) { System.out.println("Country " + entry.getKey() + " capital " + entry.getValue()); } is there a common way of accomplishing something similar in Bash ?.

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • Help with storing/accessing user access roles C# Winforms

    - by user222453
    Hello, firstly I would like to thank you in advance for any assistance provided. I am new to software development and have designed several Client/Server applications over the last 12 months or so, I am currently working on a project that involves a user logging in to gain access to the application and I am looking at the most efficient and "simple" method of storing the users permissions once logged in to the application which can be used throughout restricting access to certain tabs on the main form. I have created a static class called "User" detailed below: static class User { public static int _userID; public static string _moduleName; public static string _userName; public static object[] UserData(object[] _dataRow) { _userID = (int)_dataRow[0]; _userName = (string)_dataRow[1]; _moduleName = (string)_dataRow[2]; return _moduleName; } } When the user logs in and they have been authenticated, I wish to store the _moduleName objects in memory so I can control which tabs on the main form tab control they can access, for example; if the user has been assigned the following roles in the database: "Sales Ledger", "Purchase Ledger" they can only see the relevant tabs on the form, by way of using a Switch - Case block once the login form is hidden and the main form is instantiated. I can store the userID and userName variables in the main form once it loads by means of say for example: Here we process the login data from the user: DataAccess _dal = new DataAccess(); switch (_dal.ValidateLogin(txtUserName.Text, txtPassword.Text)) { case DataAccess.ValidationCode.ConnectionFailed: MessageBox.Show("Database Server Connection Failed!"); break; case DataAccess.ValidationCode .LoginFailed: MessageBox.Show("Login Failed!"); _dal.RecordLogin(out errMsg, txtUserName.Text, workstationID, false); break; case DataAccess.ValidationCode .LoginSucceeded: frmMain frmMain = new frmMain(); _dal.GetUserPrivList(out errMsg,2); //< here I access my DB and get the user permissions based on the current login. frmMain.Show(); this.Hide(); break; default: break; } private void frmMain_Load(object sender, EventArgs e) { int UserID = User._userID; } That works fine, however the _modules object contains mutiple permissions/roles depending on what has been set in the database, how can I store the multiple values and access them via a Switch-Case block? Thank you again in advance.

    Read the article

  • ASP.NET MVC BaseController to dynamically set MasterPage file

    - by rockinthesixstring
    I've built a Base Controller that all of my Controllers inherit from, and I've got it setup so that it checks the browser type and returns the appropriate MasterPageFile on the fly. I'm wondering if this is an efficient way to do this or if I should optimize it another way. Public Class BaseController : Inherits System.Web.Mvc.Controller Protected Overrides Function View(ByVal viewName As String, ByVal masterName As String, ByVal model As Object) As System.Web.Mvc.ViewResult If Request.Browser.IsMobileDevice Then Return MyBase.View(viewName, "Mobile", model) Else Return MyBase.View(viewName, "Site", model) End If End Function End Class

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • Is it possible to route a Webmethod?

    - by Philip
    I have a .aspx page with some Webmethods that I use for jQuery ajax calls. [WebMethod] public static string HelloWorld(string s) { return "Hello"+ s; } And call this with Url: /ajax/Test.aspx/HelloWorld I wonder if it is possible to route this method to another url like /ajax/helloworld/?

    Read the article

  • C# Spell checker Problem

    - by reggie
    I've incorporated spell check into my win forms C# project. This is my code. public void CheckSpelling() { try { // declare local variables to track error count // and information int SpellingErrors = 0; string ErrorCountMessage = string.Empty; // create an instance of a word application Microsoft.Office.Interop.Word.Application WordApp = new Microsoft.Office.Interop.Word.Application(); // hide the MS Word document during the spellcheck //WordApp.WindowState = WdWindowState.wdWindowStateMinimize; // check for zero length content in text area if (this.Text.Length > 0) { WordApp.Visible = false; // create an instance of a word document _Document WordDoc = WordApp.Documents.Add(ref emptyItem, ref emptyItem, ref emptyItem, ref oFalse); // load the content written into the word doc WordDoc.Words.First.InsertBefore(this.Text); // collect errors form new temporary document set to contain // the content of this control Microsoft.Office.Interop.Word.ProofreadingErrors docErrors = WordDoc.SpellingErrors; SpellingErrors = docErrors.Count; // execute spell check; assumes no custom dictionaries WordDoc.CheckSpelling(ref oNothing, ref oIgnoreUpperCase, ref oAlwaysSuggest, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing, ref oNothing); // format a string to contain a report of the errors detected ErrorCountMessage = "Spell check complete; errors detected: " + SpellingErrors; // return corrected text to control's text area object first = 0; object last = WordDoc.Characters.Count - 1; this.Text = WordDoc.Range(ref first, ref last).Text; } else { // if nothing was typed into the control, abort and inform user ErrorCountMessage = "Unable to spell check an empty text box."; } WordApp.Quit(ref oFalse, ref emptyItem, ref emptyItem); System.Runtime.InteropServices.Marshal.ReleaseComObject(WordApp); // return report on errors corrected // - could either display from the control or change this to // - return a string which the caller could use as desired. // MessageBox.Show(ErrorCountMessage, "Finished Spelling Check"); } catch (Exception e) { MessageBox.Show(e.ToString()); } } The spell checker works well, the only problem is when I try to move the spell checker the main form blurs up for some reason. Also when I close the spell checker the main form is back to normal. It seems like it is opening up Microsoft word then hiding the window, only allowing the spell checker to be seen. Please help.

    Read the article

< Previous Page | 536 537 538 539 540 541 542 543 544 545 546 547  | Next Page >