Search Results

Search found 2875 results on 115 pages for 'anonymous human'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 55/115 | < Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >

  • Sorting a list of colors in one dimension?

    - by Ptah- Opener of the Mouth
    I would like to sort a one-dimensional list of colors so that colors that a typical human would perceive as "like" each other are near each other. Obviously this is a difficult or perhaps impossible problem to get "perfectly", since colors are typically described with three dimensions, but that doesn't mean that there aren't some sorting methods that look obviously more natural than others. For example, sorting by RGB doesn't work very well, as it will sort in the following order, for example: (1) R=254 G=0 B=0 (2) R=254 G=255 B=0 (3) R=255 G=0 B=0 (4) R=255 G=255 B=0 That is, it will alternate those colors red, yellow, red, yellow, with the two "reds" being essentially imperceivably different than each other, and the two yellows also being imperceivably different from each other. But sorting by HLS works much better, generally speaking, and I think HSL even better than that; with either, the reds will be next to each other, and the yellows will be next to each other. But HLS/HSL has some problems, too; things that people would perceive as "black" could be split far apart from each other, as could things that people would perceive as "white". Again, I understand that I pretty much have to accept that there will be some splits like this; I'm just wondering if anyone has found a better way than HLS/HSL. And I'm aware that "better" is somewhat arbitrary; I mean "more natural to a typical human". For example, a vague thought I've had, but have not yet tried, is perhaps "L is the most important thing if it is very high or very low", but otherwise it is the least important. Has anyone tried this? Has it worked well? What specifically did you decide "very low" and "very high" meant? And so on. Or has anyone found anything else that would improve upon HSL? I should also note that I am aware that I can define a space-filling curve through the cube of colors, and order them one-dimensionally as they would be encountered while travelling along that curve. That would eliminate perceived discontinuities. However, it's not really what I want; I want decent overall large-scale groupings more than I want perfect small-scale groupings. Thanks in advance for any help.

    Read the article

  • Assigning document.getElementById to another function

    - by Andreas Grech
    I am trying to do the following in JavaScript: var gete = document.getElementById; But I am getting the following error (From FireBug's Console): uncaught exception: [Exception... "Illegal operation on WrappedNative prototype object" nsresult: "0x8057000c (NS_ERROR_XPC_BAD_OP_ON_WN_PROTO)" location: "JS frame :: http://localhost:8080/im_ass1/ :: anonymous :: line 15" data: no] Now obviously I can wrap the function as follows: var gete = function (id) { return document.getElementById(id); }; But what is the reason I'm getting the above exception when assigning the function to another name?

    Read the article

  • Using linq select to provide a grid datasource, properties are read-only

    - by Kelly
    I am using the return from the following call as the datasource for a grid. public object GetPropertyDataSourceWithCheckBox( ) { return ( from p in LocalProperties join c in GetCities( ) on p.CityID equals c.CityID orderby p.StreetNumber select new { Selected = false, p.PropertyID, p.StreetNumber, p.StreetName, c.CityName } ).ToList( ); } I get a checkbox in the grid, but it is READ-ONLY. [For the record, the grid is DevExpress.] Is there a way around this, short of creating a non-anonymous class?

    Read the article

  • will mmap use user cpu instead of whole sys cpu? (solaris)

    - by Daniel
    when use mmap to allocate some anonymous mem, we often set the start address as 0/null so mmap will figure out the starting address by itself. And to get the start address, it will work thought the whole virtual memory space to find a hole which could put the chuck of mem to be allocated. I guess this is calculated as user cpu instead of sys cpu. If the virtual memory is fragmented, then the time to find the starting address will use more user cpu, is my understanding correct

    Read the article

  • Does Google punish content duplication across multiple country domains?

    - by Logan Koester
    I like the way Google handles internationalization, with domains such as google.co.uk, google.nl, google.de etc. I'd like to do this for my own site, but I'm concerned that Google will interpret this as content duplication, particularly across countries that speak the same human language, as there won't be any translation to hint that the content is different. My site is a web application, not a content farm, so is this a legitimate concern? Would I be better off with subdomains of my .com? Directories?

    Read the article

  • Coolest C# LINQ/Lambdas trick you've ever pulled?

    - by chakrit
    Saw a post about hidden features in C# but not a lot of people have written linq/lambdas example so... I wonder... What's the coolest (as in the most elegant) use of the C# LINQ and/or Lambdas/anonymous delegates you have ever saw/written? Bonus if it has went into production too!

    Read the article

  • How do I distinguish files and folders on an FTP server

    - by soulmerge
    I want to list all files on an FTP server using PHP. According to RFC 959 the FTP command LIST is allowed to print arbitrary human-readable information on files/folders, which seems to make it impossible to determine the file type correctly. But how do other FTP clients manage to distinguish files and folders? Is there an unwritten standard or such?

    Read the article

  • Is it possible to programmatically edit a sound file based on frequency?

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • Make MediaWiki use accounts on my site?

    - by acidzombie24
    I have a site in ASP.NET and i thought it would be cool if i can redirect users to wiki.mysite.com. Now i would like to know if i can easily make MediaWiki recognize users logged into my site. I dont want any anonymous posters. Is there a way to hook or have mediawiki use accounts/cookies from my site instead of using its own database/account system?

    Read the article

  • How to upload a file from app in VC++ 6 to a web server?

    - by Arvind Singh
    I have an application in VC++ 6 (not MFC) , feature requires it to upload a file to a web server on regular basis. Web server is under our control, anonymous upload scripts/page are already setup that would accept a file manually. How to program in VC++ 6 to upload? which classes to use? I understand it is much possible with smtp and ftp but how through http?

    Read the article

  • Instantiate defined object with Linq Query

    - by Heinz
    I know that you can instantiate anonymous types with Linq but I am looking to instantiate an object I have already defined. Every time I do, all the properties are returned with their defaults (null, 0, etc.) Is there a way to make this work? I've tried something like this: ServiceDepartment[] serviceDepartments = (from d in departments orderby d.department_name select new ServiceDepartment { DepartmentID = d.department_id, DepartmentName = d.department_name }).ToArray();

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • Multi language CMS?

    - by Adam
    Is there any CMS such as expression engine or wordpress that allows a user to click a button and convert all the text to another language (it would have to be human generated otherwise it has too many mistakes probably). I'd like to know if there are any good solutions out there that work for real world use, in like business company websites.

    Read the article

  • Captcha replacement

    - by portoalet
    Hi, I stumbled upon http://www.kettletime.com.au/chance where the user needs to drag and drop a box with a number into another box to prove that he is human. How do you implement this? Any free library to do this? Thanks

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >