Search Results

Search found 1545 results on 62 pages for 'manipulation'.

Page 55/62 | < Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >

• What can cause my code to run slower when the server JIT is activated?

  - by durandai

  I am doing some optimizations on an MPEG decoder. To ensure my optimizations aren't breaking anything I have a test suite that benchmarks the entire codebase (both optimized and original) as well as verifying that they both produce identical results (basically just feeding a couple of different streams through the decoder and crc32 the outputs). When using the "-server" option with the Sun 1.6.0_18, the test suite runs about 12% slower on the optimized version after warmup (in comparison to the default "-client" setting), while the original codebase gains a good boost running about twice as fast as in client mode. While at first this seemed to be simply a warmup issue to me, I added a loop to repeat the entire test suite multiple times. Then execution times become constant for each pass starting at the 3rd iteration of the test, still the optimized version stays 12% slower than in the client mode. I am also pretty sure its not a garbage collection issue, since the code involves absolutely no object allocations after startup. The code consists mainly of some bit manipulation operations (stream decoding) and lots of basic floating math (generating PCM audio). The only JDK classes involved are ByteArrayInputStream (feeds the stream to the test and excluding disk IO from the tests) and CRC32 (to verify the result). I also observed the same behaviour with Sun JDK 1.7.0_b98 (only that ist 15% instead of 12% there). Oh, and the tests were all done on the same machine (single core) with no other applications running (WinXP). While there is some inevitable variation on the measured execution times (using System.nanoTime btw), the variation between different test runs with the same settings never exceeded 2%, usually less than 1% (after warmup), so I conclude the effect is real and not purely induced by the measuring mechanism/machine. Are there any known coding patterns that perform worse on the server JIT? Failing that, what options are available to "peek" under the hood and observe what the JIT is doing there?

  Read the article

• Low-Hanging Fruit: Obfuscating non-critical values in JavaScript

  - by Piskvor

  I'm making an in-browser game of the type "guess what place/monument/etc. is in this satellite/aerial view", using Google Maps JS API v3. However, I need to protect against cheaters - you have to pass a google.maps.LatLng and a zoom level to the map constructor, which means a cheating user only needs to view source to get to this data. I am already unsetting every value I possibly can without breaking the map (such as center and the manipulation functions like setZoom()), and initializing the map in an anonymous function (so the object is not visible in global namespace). Now, this is of course in-browser, client-side, untrusted JavaScript; I've read much of the obfuscation tag and I'm not trying to make the script bullet-proof (it's just a game, after all). I only need to make the obfuscation reasonably hard against the 1337 Java5kryp7 haxz0rz - "kid sister encryption", as Bruce Schneier puts it. Anything harder than base64 encoding would deter most cheaters by eliminating the lowest-hanging fruit - if the cheater is smart and determined enough to use a JS debugger, he can bypass anything I can do (as I need to pass the value to Google Maps API in plaintext), but that's unlikely to happen on a mass scale (there will also be other, not-code-related ways to prevent cheating). I've tried various minimizers and obfuscators, but those will mostly deal with code - the values are still shown verbatim. TL;DR: I need to obfuscate three values in JavaScript. I'm not looking for bullet-proof armor, just a sneeze-guard. What should I use?

  Read the article

• CIE XYZ colorspace: do I have RGBA or XYZA?

  - by Tronic

  I plan to write a painting program based on linear combinations of xy plane points (0,1), (1,0) and (0,0). Such system works identically to RGB, except that the primaries are not within the gamut but at the corners of a triangle that encloses the entire gamut. I have seen the three points being referred to as X, Y and Z (upper case) somewhere, but I cannot find the page anymore (I marked them to the picture myself). My pixel format stores the intensity of each of those three components the same way as RGB does, together with alpha value. This allows using pretty much any image manipulation operation designed for RGBA without modifying the code. What is my format called? Is it XYZA, RGBA or something else? Google doesn't seem to know of XYZA. RGBA will get confused with sRGB + alpha (which I also need to use in the same program). Notice that the primaries X, Y and Z and their intensities have little to do with the x, y and z coordinates (lower case) that are more commonly used.

  Read the article

• pure/const functions in C++

  - by Albert

  Hi, I'm thinking of using pure/const functions more heavily in my C++ code. (pure/const attribute in GCC) However, I am curious how strict I should be about it and what could possibly break. The most obvious case are debug outputs (in whatever form, could be on cout, in some file or in some custom debug class). I probably will have a lot of functions, which don't have any side effects despite this sort of debug output. No matter if the debug output is made or not, this will absolutely have no effect on the rest of my application. Or another case I'm thinking of is the use of my own SmartPointer class. In debug mode, my SmartPointer class has some global register where it does some extra checks. If I use such an object in a pure/const function, it does have some slight side effects (in the sense that some memory probably will be different) which should not have any real side effects though (in the sense that the behaviour is in any way different). Similar also for mutexes and other stuff. I can think of many complex cases where it has some side effects (in the sense of that some memory will be different, maybe even some threads are created, some filesystem manipulation is made, etc) but has no computational difference (all those side effects could very well be left out and I would even prefer that). How does it work out in practice? If I mark such functions as pure/const, could it break anything (considering that the code is all correct)?

  Read the article

• I am looking for an actual functional web browser control for .NET, maybe a C++ library

  - by Joshua

  I am trying to emulate a web browser in order to execute JavaScript code and then parse the DOM. The System.Windows.Forms.WebBrowser object does not give me the functionality I need. It let's me set the headers, but you cannot set the proxy or clear cookies. Well you can, but it is not ideal and messes with IE's settings. I've been extending the WebBrowser control pinvoking native windows functions so far, but it is really one hack on top of another. I can mess with the proxy and also clear cookies and such, but this control has its issues as I mentioned. I found something called WebKit .NET (http://webkitdotnet.sourceforge.net/), but I don't see support for setting proxies or cookie manipulation. Can someone recommend a c++/.NET/whatever library to do this: Basically tell me what I need to do to get an interface to similar this in .NET: // this should probably pause the current thread for the max timeout, // throw an exception on failure or return null w/e, VAGUELY similar to this string WebBrowserEmu::FetchBrowserParsedHtml(Uri url, WebProxy p, int timeoutSeconds, byte[] headers, byte[] postdata); void WebBrowserEmu::ClearCookies(); I am not responsible for my actions.

  Read the article

• What image processing Library should I use

  - by Swippen

  I have been reading What is the best image manipulation library? And tried a few libraries and are now looking for inputs on what is the best for our need. I will start by describing our current setting and problems. We have a system that needs to resize and crop a large amount of images from big original images. We handle 50 000+ images every day on 2 powerfull servers. Today we use ImageGlue from WebSupergoo but we don't like it at all, it is slow and hangs the service now and then (Its in another unanswered stack overflow question). We have a threaded windows service that uses Microsoft ThreadPool to resize as much as possible on the 8 core machines. I have tried AForge and it went very well it was loads faster and never crashed or anything. But I had problems with quality on a few images. This due to what algorithms I used ofc so can be tweaked. But want to widen our eyes to see if thats the right way to go. so: It needs to be c# .net and run in a windows service. (Since we wont change the rest of the service only image handling) It needs to handle threaded environment well. We have a great need of it being fast since today its too slow. But we also want good quality and small filesize since the images are later displayed on webpage with loads of visitors and needs good quality. So we have a lot of demands on ability to get god quality at a fast pace, and also secondary keep filesizes lowered even if that can be adjusted with compression a bit. Any comments or suggestions on what library to use?

  Read the article

• Greasemonkey script not executed when unusual content loading is being used

  - by Sam Brightman

  I'm trying to write a Greasemonkey script for Facebook and having some trouble with the funky page/content loading that they do (I don't quite understand this - a lot of the links are actually just changing the GET, but I think they do some kind of server redirect to make the URL look the same to the browser too?). Essentially the only test required is putting a GM_log() on its own in the script. If you click around Facebook, even with facebook.com/* as the pattern, it is often not executed. Is there anything I can do, or is the idea of a "page load" fixed in Greasemonkey, and FB is "tricking" it into not running by using a single URL? If I try to do some basic content manipulation like this: GM.log("starting"); var GM_FB=new Object; GM_FB.birthdays = document.evaluate("//div[@class='UIUpcoming_Item']", document, null, XPathResult.UNORDERED_NODE_SNAPSHOT_TYPE, null); for (i = GM_FB.birthdays.snapshotLength - 1; i >= 0; i--) { if (GM_FB.birthdayRegex.test(GM_FB.birthdays.snapshotItem(i).innerHTML)) { GM_FB.birthdays.snapshotItem(i).setAttribute('style','font-weight: bold; background: #fffe88'); } } The result is that sometimes only a manual page refresh will make it work. Pulling up the Firebug console and forcing the code to run works fine. Note that this isn't due to late loading of certain parts of the DOM: I have adding some code later to wait for the relevant elements and, crucially, the message never gets logged for certain transitions. For example, when I switch from Messages to News Feed and back.

  Read the article

• How can I strip Python logging calls without commenting them out?

  - by cdleary

  Today I was thinking about a Python project I wrote about a year back where I used logging pretty extensively. I remember having to comment out a lot of logging calls in inner-loop-like scenarios (the 90% code) because of the overhead (hotshot indicated it was one of my biggest bottlenecks). I wonder now if there's some canonical way to programmatically strip out logging calls in Python applications without commenting and uncommenting all the time. I'd think you could use inspection/recompilation or bytecode manipulation to do something like this and target only the code objects that are causing bottlenecks. This way, you could add a manipulator as a post-compilation step and use a centralized configuration file, like so: [Leave ERROR and above] my_module.SomeClass.method_with_lots_of_warn_calls [Leave WARN and above] my_module.SomeOtherClass.method_with_lots_of_info_calls [Leave INFO and above] my_module.SomeWeirdClass.method_with_lots_of_debug_calls Of course, you'd want to use it sparingly and probably with per-function granularity -- only for code objects that have shown logging to be a bottleneck. Anybody know of anything like this? Note: There are a few things that make this more difficult to do in a performant manner because of dynamic typing and late binding. For example, any calls to a method named debug may have to be wrapped with an if not isinstance(log, Logger). In any case, I'm assuming all of the minor details can be overcome, either by a gentleman's agreement or some run-time checking. :-)

  Read the article

• about c# OBJECTS and the Possibilties it has.

  - by user527825

  As a novice programmer and i always wonder about c# capabilities.i know it is still early to judge that but all i want to know is can c# do complex stuffs or something outside windows OS. 1- I think c# is a proprietary language (i don't know if i said that right) meaning you can't do it outside visual studio or windows. 2-also you cant create your own controller(called object right?) like you are forced to use these available in toolbox and their properties and methods. 3-can c# be used with openGL API or DirectX API . 4-Finally it always bothers me when i think i start doing things in visual studio, i know it sounds arrogant to say but sometimes i feel that i don't like to be forced to use something even if its helpful, like i feel (do i have the right to feel?) that i want to do all things by myself? don't laugh i just feel that this will give me a better understanding. 5- is visual c# is like using MaxScript inside 3ds max in that c# is exclusive to do windows and forms and components that are windows related and maxscript is only for 3d editing and manipulation for various things in the software. If it is too difficult for a beginner i hope you don't answer the fourth question as i don't have enough motivation and i want to keep the little i have. thank you for your time. Note: 1-sorry for my English, i am self taught and never used the language with native speakers so expect so errors. 2-i have a lot of questions regarding many things, what is the daily ratio you think for asking (number of questions) that would not bother the admins of the site and the members here. thank you for your time.

  Read the article

• Warning: cast increases required alignment

  - by dash-tom-bang

  I'm recently working on this platform for which a legacy codebase issues a large number of "cast increases required alignment to N" warnings, where N is the size of the target of the cast. struct Message { int32_t id; int32_t type; int8_t data[16]; }; int32_t GetMessageInt(const Message& m) { return *reinterpret_cast<int32_t*>(&data[0]); } Hopefully it's obvious that a "real" implementation would be a bit more complex, but the basic point is that I've got data coming from somewhere, I know that it's aligned (because I need the id and type to be aligned), and yet I get the message that the cast is increasing the alignment, in the example case, to 4. Now I know that I can suppress the warning with an argument to the compiler, and I know that I can cast the bit inside the parentheses to void* first, but I don't really want to go through every bit of code that needs this sort of manipulation (there's a lot because we load a lot of data off of disk, and that data comes in as char buffers so that we can easily pointer-advance), but can anyone give me any other thoughts on this problem? I mean, to me it seems like such an important and common option that you wouldn't want to warn, and if there is actually the possibility of doing it wrong then suppressing the warning isn't going to help. Finally, can't the compiler know as I do how the object in question is actually aligned in the structure, so it should be able to not worry about the alignment on that particular object unless it got bumped a byte or two?

  Read the article

• Program repeats each time a character is scanned .. How to stop it ?

  - by ZaZu

  Hello there, I have a program that has this code : #include<stdio.h> main(){ int input; char g; do{ printf("Choose a numeric value"); printf(">"); scanf("\n%c",&input); g=input-'0'; }while((g>=-16 && g<=-1)||(g>=10 && g<=42)||(g>=43 && g<=79)); } It basically uses ASCII manipulation to allow the program to accept numbers only .. '0' is given the value 48 by default...the ASCII value - 48 gives a ranges of numbers above (in the while statement) Anyway, whenever a user inputs numbers AND alphabets, such as : abr39293afakvmienb23 The program ignores : a,b,r .. But takes '3' as the first input. For a b and r, the code under the do loop repeats. So for the above example, I get : Choose a numeric value >Choose a numeric value> Choose a numeric value >3 Is there a way I can stop this ??? I tried using \n%c to scan the character and account for whitespace, but that didnt work :( Please help thank you very much !

  Read the article

• CSS style refresh in IE after dynamic removal of style link

  - by rybz

  Hi! I've got a problem with the dynamic style manipulation in IE7 (IE8 is fine). Using javascript I need to add and remove the < link / node with the definition of css file. Adding and removing the node as a child of < head / works fine under Firefox. Unfortunately, after removing it in the IE, although The tag is removed properly, the page style does not refresh. In the example below a simple css (makes background green) is appended and removed. After the removal in FF the background turns default, but in IE stays green. index.html <html> <head> </head> <script language="javascript" type="text/javascript"> var node; function append(){ var headID = document.getElementsByTagName("head")[0]; node = document.createElement('link'); node.type = 'text/css'; node.rel = 'stylesheet'; node.href = "s.css"; node.media = 'screen'; headID.appendChild(node); } function remove(){ var headID = document.getElementsByTagName("head")[0]; headID.removeChild(node); } </script> <body> <div onClick="append();"> add </div> <div onClick="remove();"> remove </div> </body> </html> And the style sheet: s.css body { background-color:#00CC33 } Here is the live example: http://rlab.pl/dynamic-style/ Is there a way to get it working?

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Algorithm for assigning a unique series of bits for each user?

  - by Mark

  The problem seems simple at first: just assign an id and represent that in binary. The issue arises because the user is capable of changing as many 0 bits to a 1 bit. To clarify, the hash could go from 0011 to 0111 or 1111 but never 1010. Each bit has an equal chance of being changed and is independent of other changes. What would you have to store in order to go from hash - user assuming a low percentage of bit tampering by the user? I also assume failure in some cases so the correct solution should have an acceptable error rate. I would an estimate the maximum number of bits tampered with would be about 30% of the total set. I guess the acceptable error rate would depend on the number of hashes needed and the number of bits being set per hash. I'm worried with enough manipulation the id can not be reconstructed from the hash. The question I am asking I guess is what safe guards or unique positioning systems can I use to ensure this happens.

  Read the article

• PHP: Join two separate mysql queries into the same json data object

  - by Dan

  I'm trying to mesh the below mysql query results into a single json object, but not quite sure how to do it properly. //return data $sql_result = mysql_query($sql,$connection) or die ("Fail."); $arr = array(); while($obj = mysql_fetch_object($sql_result)) { $arr[] = $obj; } echo json_encode($arr); //return json //plus the selected options $sql_result2 = mysql_query($sql2,$connection) or die ("Fail."); $arr2 = array(); while($obj2 = mysql_fetch_object($sql_result2)) { $arr2[] = $obj2; } echo json_encode($arr2); //return json Here's the current result: [{"po_number":"test","start_date":"1261116000","end_date":"1262239200","description":"test","taa_required":"0","account_overdue":"1","jobs_id":null,"job_number":null,"companies_id":"4","companies_name":"Primacore Inc."}][{"types_id":"37"},{"types_id":"4"}] Notice how the last section [{"types_id":"37"},{"types_id":"4"}] is placed into a separate chunk under root. I'm wanting it to be nested inside the first branch under a name like, "types". I think my question has more to do with Php array manipulation, but I'm not the best with that. Thank you for any guidance.

  Read the article

• UIButton stops responding after going into landscape mode - iPhone

  - by casey

  I've been trying different things the last few days and I've run out of ideas so I'm looking for help. The situation is that I'm displaying my in-app purchasing store view after the user clicks a button. Button pressed, view is displayed. The store shows fine. Inside this view, I have a few labels with descriptions of the product, and then below them I have the price and a Buy button which triggers the in-app purchase. Problem is when I rotate the phone to landscape, that Buy button no longer responds, weird. Works fine in portrait. The behavior in landscape when the I touch the button is nothing. It doesn't appear to press down and be selected or anything, just not responding to my touches. But then when I rotate back to portrait or even upside down portrait, it works fine. Here is the rough structure of my view in IB, all the rotating and layout is setup in IB. I set the autoresizing in IB so that everything looks ok in landscape and the Buy button expands horizontally a little bit. The only layout manipulation I do in my code is after loading, I set the content size of the scroll view. File Owner with view set to the scrollView / scrollView ----/ view --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ label --------/ uibutton (Buy) After orientation changes I printed out the userInteractionEnabled property of the scrollView and the button, and they were both TRUE at all orientations. Ideas? Or maybe some other way of displaying a buy button that won't be nonfunctional? I've already begun a branch that plays with a toolbar and placing the buy button there, but I can't seem to get the bar to stay in place while scrolling.

  Read the article

• Is it a good idea to use an integer column for storing US ZIP codes in a database?

  - by Yadyn

  From first glance, it would appear I have two basic choices for storing ZIP codes in a database table: Text (probably most common), i.e. char(5) or varchar(9) to support +4 extension Numeric, i.e. 32-bit integer Both would satisfy the requirements of the data, if we assume that there are no international concerns. In the past we've generally just gone the text route, but I was wondering if anyone does the opposite? Just from brief comparison it looks like the integer method has two clear advantages: It is, by means of its nature, automatically limited to numerics only (whereas without validation the text style could store letters and such which are not, to my knowledge, ever valid in a ZIP code). This doesn't mean we could/would/should forgo validating user input as normal, though! It takes less space, being 4 bytes (which should be plenty even for 9-digit ZIP codes) instead of 5 or 9 bytes. Also, it seems like it wouldn't hurt display output much. It is trivial to slap a ToString() on a numeric value, use simple string manipulation to insert a hyphen or space or whatever for the +4 extension, and use string formatting to restore leading zeroes. Is there anything that would discourage using int as a datatype for US-only ZIP codes?

  Read the article

• trying to append a list, but something breaks

  - by romunov

  I'm trying to create an empty list which will have as many elements as there are num.of.walkers. I then try to append, to each created element, a new sub-list (length of new sub-list corresponds to a value in a. When I fiddle around in R everything goes smooth: list.of.dist[[1]] <- vector("list", a[1]) list.of.dist[[2]] <- vector("list", a[2]) list.of.dist[[3]] <- vector("list", a[3]) list.of.dist[[4]] <- vector("list", a[4]) I then try to write a function. Here is my feeble attempt that results in an error. Can someone chip in what am I doing wrong? countNumberOfWalks <- function(walk.df) { list.of.walkers <- sort(unique(walk.df$label)) num.of.walkers <- length(unique(walk.df$label)) #Pre-allocate objects for further manipulation list.of.dist <- vector("list", num.of.walkers) a <- c() # Count the number of walks per walker. for (i in list.of.walkers) { a[i] <- nrow(walk.df[walk.df$label == i,]) } a <- as.vector(a) # Add a sublist (length = number of walks) for each walker. for (i in i:num.of.walkers) { list.of.dist[[i]] <- vector("list", a[i]) } return(list.of.dist) } > num.of.walks.per.walker <- countNumberOfWalks(walk.df) Error in vector("list", a[i]) : vector size cannot be NA

  Read the article

• JQuery autocomplete problem

  - by heffaklump

  Im using JQuerys Autocomplete plugin, but it doesn't autocomplete upon entering anything. Any ideas why it doesnt work? The basic example works, but not mine. var ppl = {"ppl":[{"name":"peterpeter", "work":"student"}, {"name":"piotr","work":"student"}]}; var options = { matchContains: true, // So we can search inside string too minChars: 2, // this sets autocomplete to begin from X characters dataType: 'json', parse: function(data) { var parsed = []; data = data.ppl; for (var i = 0; i < data.length; i++) { parsed[parsed.length] = { data: data[i], // the entire JSON entry value: data[i].name, // the default display value result: data[i].name // to populate the input element }; } return parsed; }, // To format the data returned by the autocompleter for display formatItem: function(item) { return item.name; } }; $('#inputplace').autocomplete(ppl, options); Ok. Updated: <input type="text" id="inputplace" /> So, when entering for example "peter" in the input field. No autocomplete suggestions appear. It should give "peterpeter" but nothing happens. And one more thing. Using this example works perfectly. var data = "Core Selectors Attributes Traversing Manipulation CSS Events Effects Ajax Utilities".split(" "); $("#inputplace").autocomplete(data);

  Read the article

• Sizing issues while adding a .Net UserControl to a TabPage

  - by TJ_Fischer

  I have a complex Windows Forms GUI program that has a lot of automated control generation and manipulation. One thing that I need to be able to do is add a custom UserControl to a newly instatiated TabPage. However, when my code does this I get automatic resizing events that cause the formatting to get ugly. Without detailing all of the different Containers that could possibly be involved, the basic issue is this: At a certain point in the code I create a new tab page: TabPage tempTabPage = new TabPage("A New Tab Page"); Then I set it to a certain size that I want it to maintain: tempTabPage.Width = 1008; tempTabPage.Height = 621; Then I add it to a TabControl: tabControl.TabPages.Add(tempTabPage); Then I create a user control that I want to appear in the newly added TabPage: CustomView customView = new CustomView("A new custom control"); Here is where the problem comes in. At this point both the tempTabPage and the customView are the same size with no padding or margin and they are the size I want them to be. I now try to add this new custom UserControl to the tab page like this: tempTabPage.Controls.Add(customView); When making this call the customView and it's children controls get resized to be larger and so parts of the customView are hidden. Can anyone give me any direction on what to look for or what could be causing this kind of issue? Thanks ahead of time.

  Read the article

• What good open source programs exist for fuzzing popular image file types?

  - by JohnnySoftware

  I am looking for a free, open source, portable fuzzing tool for popular image file types that is written in either Java, Python, or Jython. Ideally, it would accept specifications for the fuzzable fields using some kind of declarative constraints. Non-procedural grammar for specifying constraints are greatly preferred. Otherwise, might as well write them all in Python or whatever. Just specifying ranges of valid values or expressions for them. Ideally, it would support some kind of generative programming to export the fuzzer into various programming languages to suit cases where more customization was required. If it supported a direct-manipulation GUI for controlling parameter values and ranges, that would be nice too. The file formats that should be supported are: GIF JPEG PNG So basically, it should be sort of a toolkit consisting of ready-to-run utility, a framework or library, and be capable of generating the fuzzed files directly as well as from programs it generates. It needs to be simple so that test images can be created quickly. It should have a batch capability for creating a series of images. Creating just one at a time would be too painful. I do not want a hacking tool, just a QA tool. Basically, I just want to address concerns that it is taking too long to get commonplace image rendering/parsing libraries stable and trustworthy.

  Read the article

• Modifying SQL Database on Shared Hosting

  - by apocalypse9

  I have a live database on a shared hosting server. I am making some major changes to my site's code and I would like to fix some stupid mistakes I made in initially designing the database. These changes involve altering the size of a large number of fields, and enforcing referential integrity between tables properly. I would like to make the changes on both my local test server and the remote server if possible. I should note that while I'm fairly comfortable with writing complex queries to handle data, I have very little experience modifying database structure without a graphical interface. I can access the remote database in the visual studio database explorer but I can not use that for anything other than data manipulation. I installed Sql Management Studio express last night and after 40+ crashes I gave up - I couldn't even patch the damn thing. The remote server is SQL 2005 / The MyLittleAdmin web interface is available. So my question is what is the best way to accomplish these changes. Is there a graphical interface I can use on the remote server? If not is there an easy way to copy the database to my local machine, fix it, and re upload? Finally if none of the above are viable does anyone have links to a decent info on fixing referential integrity via query? Sorry for the somewhat general question - I feel like I am making this far harder than it should be but after searching / trying all night i haven't gotten anywhere. Thanks in advance for the help. I really appreciate it. ...Also does anyone have a time machine I can borrow- I need to go kick my past self's ass for this.

  Read the article

• Subset and lagging list data structure R

  - by user1234440

  I have a list that is indexed like the following: >list.stuff [[1]] [[1]]$vector ... [[1]]$matrix .... [[1]]$vector [[2]] null [[3]] [[3]]$vector ... [[3]]$matrix .... [[3]]$vector . . . Each segment in the list is indexed according to another vector of indexes: >index.list 1, 3, 5, 10, 15 In list.stuff, only at each of the indexes 1,3,5,10,15 will there be 2 vectors and one matrix; everything else will be null like [[2]]. What I want to do is to lag like the lag.xts function so that whatever is stored in [[1]] will be pushed to [[3]] and the last one drops off. This also requires subsetting the list, if its possible. I was wondering if there exists some functions that handle list manipulation. My thinking is that for xts, a time series can be extracted based on an index you supply: xts.object[index,] #returns the rows 1,3,5,10,15 From here I can lag it with: lag.xts(xts.object[index,]) Any help would be appreciated thanks: EDIT: Here is a reproducible example: list.stuff<-list() vec<-c(1,2,3,4,5,6,7,8,9) vec2<-c(1,2,3,4,5,6,7,8,9) mat<-matrix(c(1,2,3,4,5,6,7,8),4,2) list.vec.mat<-list(vec=vec,mat=mat,vec2=vec2) ind<-c(2,4,6,8,10) for(i in ind){ list.stuff[[i]]<-list.vec.mat }

  Read the article

• WPF Binding to variable / DependencyProperty

  - by Peter

  I'm playing around with WPF Binding and variables. Apparently one can only bind DependencyProperties. I have come up with the following, which works perfectly fine: The code-behind file: public partial class MainWindow : Window { public MainWindow() { InitializeComponent(); } public string Test { get { return (string)this.GetValue(TestProperty); } set { this.SetValue(TestProperty, value); } //set { this.SetValue(TestProperty, "BBB"); } } public static readonly DependencyProperty TestProperty = DependencyProperty.Register( "Test", typeof(string), typeof(MainWindow), new PropertyMetadata("CCC")); private void button1_Click(object sender, RoutedEventArgs e) { MessageBox.Show(Test); Test = "AAA"; MessageBox.Show(Test); } } XAML: <Window x:Class="WpfApplication3.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:diag="clr-namespace:System.Diagnostics;assembly=WindowsBase" Title="MainWindow" Height="350" Width="525" DataContext="{Binding RelativeSource={RelativeSource Self}}"> <Grid> <TextBox Height="31" HorizontalAlignment="Left" Margin="84,86,0,0" Name="textBox1" VerticalAlignment="Top" Width="152" Text="{Binding Test, Mode=TwoWay, diag:PresentationTraceSources.TraceLevel=High}"/> <Button Content="Button" Height="23" HorizontalAlignment="Left" Margin="320,85,0,0" Name="button1" VerticalAlignment="Top" Width="75" Click="button1_Click" /> <TextBox Height="31" HorizontalAlignment="Left" Margin="84,138,0,0" Name="textBox2" Text="{Binding Test, Mode=TwoWay}" VerticalAlignment="Top" Width="152" /> </Grid> The two TextBoxes update one an other. And the Button sets them to "AAA". But now I replaced the Setter function with the one that is commented out (simulating some manipulation of the given value). I would expect that whenever the property value is changed it will be reset to "BBB". It does so when you press the button, that is when you set the property in code. But it does for some reason not affect the WPF Bindings, that is you can change the TextBox contents and thus the property, but apparently the Setter is never called. I wonder why that is so, and how one would go about to achive the expected behaviour.

  Read the article

• Creating a web application that can be extended by plugins/modules

  - by Adam Pope

  I'm currently involved with developing a C# CMS-like web application which will be used to standardise our development of websites. From the outset, the idea has been to keep the core as simple as possible to avoid the complexity and menu/option overload that blights many CMS systems. This simple core is now complete and working very well. We envisisaged that the system would be able to accept plugins or modules which would extend the core functionality to suit a given projects needs. These would also be re-usable across projects. For example, a basic catalogue and shopping basket might be needed. All the code for such extensions should be in seperate assemblies. They should be able to provide their own admin interfaces and front-end code from this library. The system should search for available plugins and give the admin user the option to enable/disable the feature. (This is all very much like WordPress plugins) It is crucial that we attack this problem in the correct way, so I'm trying to perform as much due dilligence as possible before jumping in. I am aware of the Plugin Pattern (http://msdn.microsoft.com/en-us/library/ms972962.aspx) and have read some articles on it's use. It seems reasonable but I'm not convinced it's necessarily the correct/best technique for this situation. It seems more suited to processing applications (image/audio manipulation, maths etc). Are there any other options for achieving this kind of UI extensibility functionality? Or is the plugin pattern the way to go? I'd also be interested if anybody has links to articles that explain using the plugin pattern for this purpose?

  Read the article

< Previous Page | 51 52 53 54 55 56 57 58 59 60 61 62  | Next Page >