Search Results

Search found 17841 results on 714 pages for 'non ascii characters'.

Page 551/714 | < Previous Page | 547 548 549 550 551 552 553 554 555 556 557 558  | Next Page >

  • SQL Server 2008 - Editing Tables: Bit columns require 'True' or 'False'

    - by CJM
    Not so much a question as an observation... I'm just upgrading to SQL Server 2008 on my development machine in anticipation of upgrading my live applications. I didn't anticipate any problems since [I think] I generally use standard T-SQL, and probably not too far from ANSI standard SQL. So far so good, but I was really thrown by a very simple change: I was creating a simple, small look-up table to store a list of codes and including a bit column to indicate the current default code. But when I used the new/modified 'Edit Top 200 Rows' option, and entered my 0s and 1s in the the bit column I got an error: 'Invalid value for cell - String was not recognised as a valid boolean' After a bit of head-scratching, I tried True and False - and they worked. So it seems this new Edit feature requires 4 or 5 characters to be typed, rather than the previous 1. Checking further, we can still use '...where bitval = 1' but can now also use '...where bitval = 'true''. But any results returned render these bit columns as 0 or 1 still. It all sounds like half a step backwards. Not the end of the world, but and unnecessary annoyance. Does anybody have any insight on this issue? Or there any other new Gotchas with SQL Server 2008?

    Read the article

  • Code Golf: Connect 4

    - by Matthieu M.
    If you don't know the Connect 4 game, follow the link :) I used to play it a lot when I was a child. At least until my little sister got bored with me winning... Anyway I was reading the Code Golf: Tic Tac Toe the other day and I thought that solving the Tic Tac Toe problem was simpler than solving the Connect 4... and wondered how much this would reflect on the number of characters a solution would yield. I thus propose a similar challenge: Find the winner The grid is given under the form of a string meant to passed as a parameter to a function. The goal of the code golf is to write the body of the function, the parameter will be b, of string type The image in the wikipedia article leads to the following representation: "....... ..RY... ..YYYR. ..RRYY. ..RYRY. .YRRRYR" (6 rows of 7 elements) but is obviously incomplete (Yellow has not won yet) There is a winner in the grid passed, no need to do error checking Remember that it might not be exactly 4 The expected output is the letter representing the winner (either R or Y) I expect perl mongers to produce the most unreadable script (along with Ook and whitespace, of course), but I am most interested in reading innovative solutions. I must admit the magic square solution for Tic Tac Toe was my personal fav and I wonder if there is a way to build a similar one with this. Well, happy Easter weekend :) Now I just have a few days to come up with a solution of my own!

    Read the article

  • XSLT: how to ignore unnecessary white space?

    - by arnaud
    Hi, Given this example XML file: <doc> <tag> Hello ! </tag> <tag> My name is John </tag> </doc> And the following XSLT sheet: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform"> <xsl:template match="/"> <xsl:for-each select="doc/tag"> <xsl:value-of select="."/> </xsl:for-each> </xsl:template> </xsl:stylesheet> How should I change it in order to ignore line feeds and convert any group of white-space characters to just one space in the items? In other words, I would like to obtain: Hello! My name is John Without all those those silly line feeds. ...the question is how. Thanks in advance !

    Read the article

  • ASP.NET required field validator firing on focus in Firefox

    - by ren33
    I have 2 asp.net textboxes in an update panel. Both textbox controls have some javascript attached to autotab to the next field and to allow only numeric input. When I enter some data into the first field and press enter, focus shifts to the next field and the requiredfieldvalidator of the second field displays its "* required" error message, even though I've just entered the field. This is only happening in Firefox. How can I prevent the validator from firing when I first enter the textbox? edit Here's the code: <asp:TextBox ID="add_ISBN" runat="server" Columns="14" MaxLength="17" CssClass="focus" /> <asp:TextBox ID="add_Qty" runat="server" Columns="4" MaxLength="4" /> <asp:RequiredFieldValidator ID="rfvQty" ControlToValidate="add_Qty" ErrorMessage="* required" ForeColor="Red" Display="Dynamic" EnableClientScript="true" ValidationGroup="Add" runat="server" /> In the codebehind: add_ISBN.Attributes.Add("onkeydown", "return isbnCheck(event, '" & add_Qty.ClientID & "')") And the javascript: function isbnCheck(e, id) { e = e || window.event; var key = e.which || e.keyCode if (validIsbnChars.indexOf(parseInt(key, 10)) >= 0) { return true; } else { if (key == 13) { var nextfield = document.getElementById(id); if (nextfield) nextfield.focus(); return false; } if (e.preventDefault) e.preventDefault(); e.returnValue = false; return false; } } The javascript allows only a valid subset of characters, and if the user presses enter, sets focus to the next field.

    Read the article

  • Need a regular expression to parse a text body

    - by Ali
    Hi guys, I need a regular expression to parse a body of text. Basically assume this that we have text files and each of which contains random text but within the text there would be lines in the following formats - basically they are a format for denoting flight legs. eg: 13FEB2009 BDR7402 1000 UUBB 1020 UUWW FLT This line of text is always on one line The first word is a date in the format DDMMMYYYY Second word could be of any length and hold alphanumeric characters third word is the time in format HHMM - its always numeric fourth word is a location code - its almost always just alphabets but could also be alphanumeric fifth word is the arrival time in format HHMM - its always numeric sixth word is a location code - its almost always just alphabets but could also be alphanumeric Any words which follow on the same line are just definitions A text file may contain among lots of random text information one or more such lines of text. I need a way to be able to extract all this information i.e just these lines within a text file and store them with their integral parts separated as mentioned in an associative array so I have something like this: array('0'=>array('date'=>'', 'time-dept'=>'', 'flightcode'=>'',....)) I'm assuming regular expressions would be in order here. I'm using php for this - would appreciate the help guys :)

    Read the article

  • Click event keeps firing

    - by Ben Shelock
    I have absolutely no idea why this is happening but the following code seems to be executed a huge ammount of times in all browsers. $('#save_albums').click(function(){ for(var i = 1; i <= 5; i++){ html = $('#your_albums ol li').eq(i).html(); alert(html); } }); Looks fairly innocent to me... Here's the code in it's entirety $(function(){ $('#query').keyup(function(){ var text = encodeURI($(this).val()); if(text.length > 3){ $('#results').load('search.php?album='+text, function(){ $('.album').hover(function(){ $(this).css('outline', '1px solid black') },function(){ $(this).css('outline', 'none') }); $('.album').click(function(){ $('#fores').remove(); $('#yours').show(); if($('#your_albums ol li').length <= 4){ albumInfo = '<li><div class="album">' + $(this).html() + '</div></li>'; if($('#your_albums ol li').length >= 1){ $('#your_albums ol li').last().after(albumInfo); } else{ $('#your_albums ol').html(albumInfo); } } else{ alert('No more than 5 please'); } }); $('#clear_albums').click(function(e){ e.preventDefault; $('#your_albums ol li').remove(); }); $('#save_albums').click(function(){ for(var i = 1; i <= 5; i++){ html = $('#your_albums ol li').eq(i).html(); alert(html); } }); }); } else{ $('#results').text('Query must be more than 3 characters'); } }); });

    Read the article

  • How to escape the character entities in XML?

    - by Chetan Vaity
    I want to pass XML as a string in an XML attribute. <activity evt="&lt;FHS&gt; &lt;act&gt; &lt;polyline penWidth=&quot;2&quot; points=&quot;256,435 257,432 &quot;/&gt; &lt;/act&gt; &lt;/FHS&gt; /> Here the "evt" attribute is the XML string, so escaping all the less-than, greater-than, etc characters by the appropriate character entities works fine. The problem is I want a fragment to be interpreted as is - the character entities themselves should be treated as simple strings. When the "evt" attribute is read and an XML is generated from it, it should look like <FHS> <act> &lt;polyline penWidth=&quot;2&quot; points=&quot;256,435 257,432 &quot;/&gt; </act> </FHS> Essentially, I want to escape the character entities. How is this possible?

    Read the article

  • doublechecking: no db-wide 'unicode switch' for sql server in the foreseeable future, i.e. like Orac

    - by user72150
    Hi all, I believe I know the answer to this question, but wanted to confirm: Question Does Sql server (or will it in the foreseeable future), offer a database-wide "unicode switch" which says "store all characters in unicode (UTF-16, UCS-2, etc)", i.e. like Oracle. The Context Our application has provided "CJK" (Chinese-Japanese-Korean) support for years--using Oracle as the db store. Recently folks have been asking for the same support in sql server. We store our db schema definition in xml and generate the vendor-specific definitions (oracle, sql server) using vendor-specific xsl. We can make the change easily. The problem is for upgrades. Generated scripts would need to change the column types for 100+ columns from varchar to nvarchar, varchar(max) to nvarchar(max), etc. These changes require dropping and recreating indexes and foreign keys if the any indexes/fk's exist on the column. Non-trivial. Risky. DB-wide character encodings for us would eliminate programming changes. (I.e. we would not to change the column types from varchar to nvarchar; sql server would correctly store unicode data in varchar columns). I had thought that eventually sql server would "see the light" and allow storing unicode in varchar/clob columns. Evidently not yet. Recap So just to triple check: does mssql offer a database-wide switch for character encoding? Will it in SQL2008R3? or 2010? thanks, bill

    Read the article

  • Regex: Use start of line/end of line signs (^ or $) in different context

    - by fgysin
    While doing some small regex task I came upon this problem. I have a string that is a list of tags that looks e.g like this: foo,bar,qux,garp,wobble,thud What I needed to do was to check if a certain tag, e.g. 'garp' was in this list. (What it finally matches is not really important, just if there is a match or not.) My first and a bit stupid try at this was to use the following regex: [^,]garp[,$] My idea was that before 'garp' there should either be the start of the line/string or a comma, after 'garp' there should be either a comma or the end of the line/string. Now, it is instantly obvious that this regex is wrong: Both ^ and $ change their behaviour in the context of the character class [ ]. What I finally came up with is the following: ^garp$|^garp,|,garp,|,garp$ This regex just handles the 4 cases one by one. (Tag at beginning of list, in the center, at the end, or as the only element of the list.) The last regex is somehow a bit ugly in my eyes and just for funs sake I'd like to make it a bit more elegant. Is there a way how the start of line/end of line characters (^ and $) can be used in the context of character classes?

    Read the article

  • How do you word wrap a RichTextField for Blackberry

    - by Kai
    I've been trying to modify a rich text field to display correctly in its half of the horizontal field. The goal is this: --------------------------- | address is | ***********| | very long | ** IMAGE **| | state, zip | ***********| --------------------------- Where address is a single string separate from the city and zip. I am modifying the address field like this: RichTextField addrField = new RichTextField(address) { public int getPreferredWidth() { return 200; } protected void layout(int maxWidth,int maxHeight) { super.layout(getPreferredWidth(),maxHeight); setExtent(getPreferredWidth(), getHeight()); } }; The results look like this: ----------------------------- | address is ve| ***********| | state, zip | ** IMAGE **| | | ***********| ----------------------------- where clearly the address is just going under the image. Both horizontal fields are static 200 pixels wide. It's not like the system wouldn't know where to wrap the address. However, I have heard it is not easy to do this and is not done automatically. I have had no success finding a direct answer online. I have found people saying you need to do it in a custom layout manager, some refer to the RichTextField API, which is of no use. But nobody actually mentions how to do it. I understand that I may need to read character by character and set where the line breaks should happen. What I don't know is how exactly to do any of this. You can't just count characters and assume each is worth 5 pixels, and you shouldn't have to. Surely there must be some way to achieve this in a way that makes sense. Any suggestions?

    Read the article

  • How to unencode escaped XML with xQuery

    - by mbrevoort
    I have a variable in xQuery of type xs:string with the value of an encoded HTML snippet (the content of a twitter tweet). It looks like this: Headlines-Today &#8226; AP sources: &lt;b&gt;Obama&lt;/b&gt; pick for Justice post withdraws : News - Rest Of World - &lt;a href=&quot;http://shar.es/mqMAG&quot;&gt;http://shar.es/mqMAG&lt;/a&gt; When I try to write this out in an HTML block, I need the string to be unescaped so that the HTML snippet will be interpreted by the browser. Instead the string is getting written out as is and the browser is rendering it as just text (so you see <a href="blah.... ). Here's how I'm writing out this string: {$entry/atom:content/text()} How can I have the escaped characters unencoded so it writes < rather tha &lt; ? I've tried to do a replacelike this but it always replaces the &lt; with &lt; ! fn:replace($s, "&lt;", "<")

    Read the article

  • What's wrong with this regex (VBScript/Javascript flavor)

    - by OtherMichael
    I'm trying to run a regular expression in VBA code that uses Microsoft VBScript Regular Expressions 5.5 (should be the same as JavaScript regex) regex: ^[0-9A-Z]?[0-9A-Z]{3}[A-Z]?([0-9A-Z]{6})-?([0-9])?$ input: X123A1234567 match: 123456 the six characters I'm interested in give a good match of 123456, ignoring the last (check) digit. Perfect. (The check digit is captured, but it's not a major concern to me). But when BOTH the optional portions are gone (they are optional) the match grabs the last digit GOOD input: 123A1234567 match: 123456 Leave in the optional middle alpha, take out the optional leading alpha, and we still get the good match of 123456 GOOD input: X1231234567 match: 123456 Leave in the optional leading alpha, take out the middle optional alpha, and we still get a good match of 123456 BAD input: 1231234567 match: 234567 Take out BOTH optional alphas, and we get a bad match of 234567 Have a looksee @ the regex testers on http://www.regular-expressions.info/javascriptexample.html or http://www.regular-expressions.info/vbscriptexample.html What am I missing, here? How can I get the regex to ignore the last digit when both optional alphas are missing? The regex is used to feed a lookup system, so that no matter what format the input data, we can match to a complete value.

    Read the article

  • validation properties by attribute

    - by netmajor
    I create class with two property - name,link(below). I use simple property validation by Required and StringLength attribute. I bind this class object to WPF ListBox(with textBoxs). But when I have textbox empty or write words longer than 8 sign nothing happens :/ What should I do to fires ErrorMessage? Or how to implement validation in other way ? I also try use : if (value is int) { throw new ArgumentException("Wpisales stringa!!"); } But it only fires in debug mode :/ My class with implementation of attribute validation: public class RssInfo : INotifyPropertyChanged { public RssInfo() { } public RssInfo(string _nazwa, string _link) { nazwa = _nazwa; link = _link; } private string nazwa; [Required(ErrorMessage = "To pole jest obowiazkowe nAZWA")] public string Nazwa { get { return nazwa; } set { if (value != nazwa) { nazwa = value; onPropertyChanged("Nazwa"); } if (value is int) { throw new ArgumentException("Wpisales stringa!!"); } } } private string link; [Required(ErrorMessage="To pole jest obowiazkowe link")] [StringLength(8, ErrorMessage = "Link cannot be longer than 8 characters")] public string Link { get { return link; } set { if (value != link) { link = value; onPropertyChanged("Link"); } } } #region INotifyPropertyChanged Members public event PropertyChangedEventHandler PropertyChanged; #endregion private void onPropertyChanged(string propertyName) { if (this.PropertyChanged != null) { PropertyChanged(this, new PropertyChangedEventArgs(propertyName)); } } }

    Read the article

  • Multi-base conversion - using all combinations for URL shortener

    - by Guffa
    I am making an URL shortener, and I am struggling with the optimal way of encoding a number (id) into a character string. I am using the characters 0-9,A-Z,a-z so it will basically be a base-62 encoding. That is pretty basic, but it doesn't make use of all possible codes. The codes that it would produce would be: 0, 1, ... y, z, 10, 11, ... zy, zz, 100, 101, ... Notice that the codes 00 to 0z is not used, the same for 000 to 0zz, and so on. I would like to use all the codes, like this: 0, 1, ... y, z, 00, 01, ... zy, zz, 000, 001, ... It would be some combination of base-62 and base-63, with different bases depending on the position... Using base-62 is easy, for example: create procedure tiny_GetCode @UrlId int as set nocount on declare @Code varchar(10) set @Code = '' while (@UrlId > 0 or len(@Code) = 0) begin set @Code = substring('0123456789ABCDEFGHIJKLMNOPQRSTUVWXYZabcdefghijklmnopqrstuvwxyz', @UrlId % 62 + 1, 1) + @Code set @UrlId = @UrlId / 62 end select @Code But I haven't yet managed to make a multi-base conversion out of it, to make use of all the codes.

    Read the article

  • iPhone contacts app styled indexed table view implementation

    - by KSH
    My Requirement: I have this straight forward requirement of listing names of people in alphabetical order in a Indexed table view with index titles being the starting letter of alphabets (additionally a search icon at the top and # to display misc values which start with a number and other special characters). What I have done so far: 1. I am using core data for storage and "last_name" is modelled as a String property in the Contacts entity 2.I am using a NSFetchedResultsController to display the sorted indexed table view. Issues accomplishing my requirement: 1. First up, I couldn't get the section index titles to be the first letter of alphabets. Dave's suggestion in the following post, helped me achieve the same: http://stackoverflow.com/questions/1112521/nsfetchedresultscontroller-with-sections-created-by-first-letter-of-a-string The only issue I encountered with Dave' suggestion is that I couldn't get the misc named grouped under "#" index. What I have tried: 1. I tried adding a custom compare method to NSString (category) to check how the comparison and section is made but that custom method doesn't get called when specified in the NSSortDescriptor selector. Here is some code: `@interface NSString (SortString) -(NSComparisonResult) customCompare: (NSString*) aStirng; @end @implementation NSString (SortString) -(NSComparisonResult) customCompare:(NSString *)aString { NSLog(@"Custom compare called to compare : %@ and %@",self,aString); return [self caseInsensitiveCompare:aString]; } @end` Code to fetch data: `NSArray *sortDescriptors = [NSArray arrayWithObject:[[[NSSortDescriptor alloc] initWithKey:@"last_name" ascending:YES selector:@selector(customCompare:)] autorelease]]; [fetchRequest setSortDescriptors:sortDescriptors]; fetchedResultsController = [[NSFetchedResultsController alloc] initWithFetchRequest:fetchRequest managedObjectContext:managedObjectContext sectionNameKeyPath:@"lastNameInitial" cacheName:@"MyCache"];` Can you let me know what I am missing and how the requirement can be accomplished ?

    Read the article

  • JSF ISO-8859-2 charset

    - by Vladimir
    Hi! I have problem with setting proper charset on my jsf pages. I use MySql db with latin2 (ISO-8859-2 charset) and latin2_croatian_ci collation. But, I have problems with setting values on backing managed bean properties. Page directive on top of my page is: <%@ page language="java" pageEncoding="ISO-8859-2" contentType="text/html; charset=ISO-8859-2" %> In head I included: <meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-2"> And my form tag is: <h:form id="entityDetails" acceptcharset="ISO-8859-2"> I've created and registered Filter in web.xml with following doFilter method implementation: public void doFilter(ServletRequest request, ServletResponse response, FilterChain chain) throws IOException, ServletException { request.setCharacterEncoding("ISO-8859-2"); response.setCharacterEncoding("ISO-8859-2"); chain.doFilter(request, response); } But, i.e. when I set managed bean property through inputText, all special (unicode) characters are replaced with '?' character. I really don't have any other ideas how to set charset to pages to perform well. Any suggestions? Thanks in advance.

    Read the article

  • Keyword to SQL search

    - by jdelator
    Use Case When a user goes to my website, they will be confronted with a search box much like SO. They can search for results using plan text. ".net questions", "closed questions", ".net and java", etc.. The search will function a bit different that SO, in that it will try to as much as possible of the schema of the database rather than a straight fulltext search. So ".net questions" will only search for .net questions as opposed to .net answers (probably not applicable to SO case, just an example here), "closed questions" will return questions that are closed, ".net and java" questions will return questions that relate to .net and java and nothing else. Problem I'm not too familiar with the words but I basically want to do a keyword to SQL driven search. I know the schema of the database and I also can datamine the database. I want to know any current approaches there that existing out already before I try to implement this. I guess this question is for what is a good design for the stated problem. Proposed My proposed solution so far looks something like this Clean the input. Just remove any special characters Parse the input into chunks of data. Break an input of "c# java" into c# and java Also handle the special cases like "'c# java' questions" into 'c# java' and "questions". Build a tree out of the input Bind the data into metadata. So convert stuff like closed questions and relate it to the isclosed column of a table. Convert the tree into a sql query. Thoughts/suggestions/links?

    Read the article

  • How does MatchEvaluator works? ( C# regex replace)

    - by Marin Doric
    This is the input string 23x * y34x2. I want to insert " * " (star surrounded by whitespaces) after every number followed by letter, and after every letter followed by number. So my input string would look like this: 23 * x * y * 34 * x * 2. This is the regex that does the job: @"\d(?=[a-z])|a-z". This is the function that I wrote that inserts the " * ". Regex reg = new Regex(@"\d(?=[a-z])|[a-z](?=\d)"); MatchCollection matchC; matchC = reg.Matches(input); int ii = 1; foreach (Match element in matchC)//foreach match I will find the index of that match { input = input.Insert(element.Index + ii, " * ");//since I' am inserting " * " ( 3 characters ) ii += 3; //I must increment index by 3 } return input; //return modified input My question how to do same job using .net MatchEvaluator? I'am new to regex and don't understand good replacing with MatchEvaluator. This is the code that I tried to wrote: Regex reg = new Regex(@"\d(?=[a-z])|[a-z](?=\d)"); MatchEvaluator matchEval = new MatchEvaluator(ReplaceStar); input = reg.Replace(input, matchEval); return input; } public string ReplaceStar( Match match ) { //return What?? }

    Read the article

  • Extract wrong data from a frame in C?

    - by ipkiss
    I am writing a program that reads the data from the serial port on Linux. The data are sent by another device with the following frame format: |start | Command | Data | CRC | End | |0x02 | 0x41 | (0-127 octets) | | 0x03| ---------------------------------------------------- The Data field contains 127 octets as shown and octet 1,2 contains one type of data; octet 3,4 contains another data. I need to get these data. Because in C, one byte can only holds one character and in the start field of the frame, it is 0x02 which means STX which is 3 characters. So, in order to test my program, On the sender side, I construct an array as the frame formatted above like: char frame[254]; frame[0] = 0x02; // starting field frame[1] = 0x41; // command field which is character 'A' ..so on.. And, then On the receiver side, I take out the fields like: char result[254]; // read data read(result); printf("command = %c", result[1]); // get the command field of the frame // get other field's values the command field value (result[1]) is not character 'A'. I think, this because the first field value of the frame is 0x02 (STX) occupying 3 first places in the array frame and leading to the wrong results on the receiver side. How can I correct the issue or am I doing something wrong at the sender side? Thanks all. related questions: http://stackoverflow.com/questions/2500567/parse-and-read-data-frame-in-c http://stackoverflow.com/questions/2531779/clear-data-at-serial-port-in-linux-in-c

    Read the article

  • Python win32com - Automating Word - How to replace text in a text box?

    - by Greg
    I'm trying to automate word to replace text in a word document using Python. (I'm on word 2003 if that matters and Python 2.4) The first part of my replace method below works on everything except text in text boxes. The text just doesn't get selected. I notice when I go into Word manually and hit ctrl-A all of the text gets selected except for the text box. Here's my code so far: class Word: def __init__(self,visible=0,screenupdating=0): pythoncom.CoInitialize() self.app=gencache.EnsureDispatch(WORD) self.app.Visible = visible self.app.DisplayAlerts = 0 self.app.ScreenUpdating = screenupdating print 'Starting word' def open(self,doc): self.opendoc=os.path.basename(doc) self.app.Documents.Open(FileName=doc) def replace(self,source,target): if target=='':target=' ' alltext=self.app.Documents(self.opendoc).Range(Start=0,End=self.app.Documents(self.opendoc).Characters.Count) #select all alltext.Find.Text = source alltext.Find.Replacement.Text = target alltext.Find.Execute(Replace=1,Forward=True) #Special handling to do replace in text boxes #http://word.tips.net/Pages/T003879_Updating_a_Field_in_a_Text_Box.html for shp in self.app.Documents(self.opendoc).Shapes: if shp.TextFrame.HasText: shp.TextFrame.TextRange.Find.Text = source shp.TextFrame.TextRange.Find.Replacement.Text = target shp.TextFrame.TextRange.Find.Execute(Replace=1,Forward=True) #My Usage word=Word(visible=1,screenupdating=1) word.open(r'C:\Invoice Automation\testTB.doc') word.replace('[PGN]','1') The for shp in self.app .. section is my attempt to hit the text boxes. It seems to find the text box, but it doesn't replace anything.

    Read the article

  • How can I make this Matlab program possible?

    - by lebland-matlab
    I do not know how to combine the indices with the characters, Could you help me to make this program possible: clc; clear all; set1={F,G,FF,GG,X,Y,XX,L,BH,JK}; %set of name vectors set2={J,K,HG,UY,TR,BC,XW,IOP,ES,QA}; %set of name vectors set3={AJ,RK,DS,TU,WS,ZZE,ZXW,TYP,ZAA,QWW}; %set of name vectors for i=1:1:9 load('C:\Users\Documents\MATLAB\myFile\matrice_'set1(i)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set1(i+1)'.mat'); 'set1(i)' = m_'set1(i)'; 'set1(i+1)' = m_'set1(i+1)'; for j=1:1:9 load('C:\Users\Documents\MATLAB\myFile\matrice_'set2(j)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set2(j+1)'.mat'); 'set2(j)' = m_'set2(j)'; 'set2(j+1)' = m_'set2(j+1)'; for k=1:1:8 load('C:\Users\Documents\MATLAB\myFile\matrice_'set3(k)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set3(k+1)'.mat'); load('C:\Users\Documents\MATLAB\myFile\matrice_'set3(k+2)'.mat'); 'set3(k)' = m_'set3(k)' ; 'set3(k+1)' = m_'set3(k+1)'; 'set3(k+2)' = m_'set3(k+2)'; [Result1'index',Result2'index',Result3'index',Result4'index',Result5'index'] = myFun('set1(i)','set1(i+1)','set2(j)','set2(j+1)','set3(k)','set3(k+1)','set3(k+2)'); %% 9x9x8=648 index=1,2,...,648 file_name = 'matrice_final'index'.mat'; save(file_name,'Result1'index'','Result2'index'','Result3'index'','Result4'index'','Result5'index''); clear 'set3(k)' 'set3(k+1)' 'set3(k+2)' end clear 'set2(j)' 'set2(j+1)' end clear 'set1(i)' 'set1(i+1)' end

    Read the article

  • php mailer char-coding problem

    - by Holian
    Hello! I try to use Phpmailer to send registration, activation..etc mail to users... require("class.phpmailer.php"); $mail -> charSet = "UTF-8"; $mail = new PHPMailer(); $mail->IsSMTP(); $mail->Host = "smtp.mydomain.org"; $mail->From = "[email protected]"; $mail->SMTPAuth = true; $mail->Username ="username"; $mail->Password="passw"; //$mail->FromName = $header; $mail->FromName = mb_convert_encoding($header, "UTF-8", "auto"); $mail->AddAddress($emladd); $mail->AddAddress("[email protected]"); $mail->AddBCC('[email protected]', 'firstadd'); $mail->Subject = $sub; $mail->Body = $message; $mail->WordWrap = 50; if(!$mail->Send()) { echo 'Message was not sent.'; echo 'Mailer error: ' . $mail->ErrorInfo; } The $message is contain latin characters. Unfortunatelly all webmail (gmail, webmail.mydomain.org, emailaddress.domain.xx) use different coding. How can i force to use UTF-8 coding to show my mail exactly same on all mailbox? I try to convert the mail header width mb_convert_encoding(), but with no luck. Thank you.

    Read the article

  • How to change identifier quote character in SSIS for connection to ODBC DSN

    - by William Rose
    I'm trying to create an SSIS 2008 Data Source View that reads from an Ingres database via the ODBC driver for Ingres. I've downloaded the Ingres 10 Community Edition to get the ODBC driver, installed it, set up the data access server and a DSN on the server running SSIS. If I connect to the SQL Server 2008 Database Engine on the server running SSIS, I can retrieve data from Ingres over the ODBC DSN by running the following command: SELECT * FROM OPENROWSET( 'MSDASQL' , 'DSN=IngresODBC;UID=testuser;PWD=testpass' , 'SELECT * FROM iitables') So I am quite sure that the ODBC setup is correct. If I try the same query with SQL Server style bracketed identifier quotes, I get an error, as Ingres doesn't support this syntax. SELECT * FROM OPENROWSET( 'MSDASQL' , 'DSN=IngresODBC;UID=testuser;PWD=testpass' , 'SELECT * FROM [iitables]') The error is "[Ingres][Ingres 10.0 ODBC Driver][Ingres 10.0]line 1, Unexpected character '['.". What I am finding is that I get the same error when I try to add tables from Ingres to an SSIS Data Source View. The initial step of selecting the ODBC Provider works fine, and I am shown a list of tables / views to add. I then select any table, and try to add it to the view, and get "ERROR [5000A] [Ingres][Ingres 10.0 ODBC Driver][Ingres 10.0]line 3, Unexpected character '['.". Following Ed Harper's suggestion of creating a named query also seems to be stymied. If I put into my named query the following text: SELECT * FROM "iitables" I still get an error: "ERROR [5000A] [Ingres][Ingres 10.0 ODBC Driver][Ingres 10.0]line 2, Unexpected character '['". According to the error, the query text passed by SSIS to ODBC was: SELECT [iitables].* FROM ( SELECT * FROM "iitables" ) AS [iitables] It seems that SSIS assumes that bracket quote characters are acceptable, when they aren't. How can I persuade it not to use them? Double quotes are acceptable.

    Read the article

  • looking for a license key algorithm.

    - by giulio
    There are a lot of questions relating to license keys asked on stackoverflow. But they don't answer this question. Can anyone provide a simple license key algorithm that is technology independent and doesn't required a diploma in mathematics to understand ? The license key algorithm is similar to public key encryption. I just need something simple that can be implemented in any platform .Net/Java and uses simple data like characters. Preferably no byte translations required. So if a person presents a string, a complementary string can be generated that is the authorisation code. Below is a common scenario that it would be used for. Customer downloads s/w which generates a unique key upon initial startup/installation. S/w runs during trial period. At end of trial period an authorisation key is required. Customer goes to designated web-site, enters their code and get authorisation code to enable s/w, after paying :) Don't be afraid to describe your answer as though you're talking to a 5 yr old as I am not a mathemtician. Just need a decent basic algorithm, we're not launching nukes... NB: Please no philosophy on encryption nor who is Diffie-Hellman. I just need a basic solution.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

< Previous Page | 547 548 549 550 551 552 553 554 555 556 557 558  | Next Page >