Search Results

Search found 41071 results on 1643 pages for 'post update'.

Page 559/1643 | < Previous Page | 555 556 557 558 559 560 561 562 563 564 565 566  | Next Page >

• A problem happened during install the ruby

  - by Alex

  I’m a freshman on Ruby and now trying to install ruby on my machine according to the Tutorial on http://wiki.openqa.org/display/WTR/Tutorial However, after I installed the ruby186-26, and run the command “gem update --system”, the following error occurred: C:\Documents and Settings\e482090\Desktopgem update --system c:/ruby/lib/ruby/site_ruby/1.8/rubygems/config_file.rb:51:in initialize': Inval id argument - <Not Set>/.gemrc (Errno::EINVAL) from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/config_file.rb:51:inopen' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/config_file.rb:51:in initi alize' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/gem_runner.rb:36:innew' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/gem_runner.rb:36:in do_con figuration' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/gem_runner.rb:25:inrun' from c:/ruby/bin/gem:23 C:\Documents and Settings\e482090\Desktopgem install watir c:/ruby/lib/ruby/site_ruby/1.8/rubygems/config_file.rb:51:in initialize': Inval id argument - <Not Set>/.gemrc (Errno::EINVAL) from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/config_file.rb:51:inopen' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/config_file.rb:51:in initi alize' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/gem_runner.rb:36:innew' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/gem_runner.rb:36:in do_con figuration' from c:/ruby/lib/ruby/site_ruby/1.8/rubygems/gem_runner.rb:25:inrun' from c:/ruby/bin/gem:23 Meanwhile, we have tried this on other machines and the result turned out ok. Thus, my question is why the error happened on my pc? Have you met this kind of error before?

  Read the article

• HTTP Error: 400 when sending msmq message over http

  - by dontera

  I am developing a solution which will utilize msmq to transmit data between two machines. Due to the seperation of said machines, we need to use HTTP transport for the messages. In my test environment I am using a Windows 7 x64 development machine, which is attempting to send messages using a homebrew app to any of several test machines I have control over. All machines are either windows server 2003 or server 2008 with msmq and msmq http support installed. For any test destination, I can use the following queue path name with success: FORMATNAME:DIRECT=TCP:[machine_name_or_ip]\private$\test_queue But for any test destination, the following always fails FORMATNAME:DIRECT=HTTP://[machine_name_or_ip]/msmq/private$/test_queue I have used all permutations of machine names/ips available. I have created mappings using the method described at this blog post. All result in the same HTTP Error: 400. The following is the code used to send messages: MessageQueue mq = new MessageQueue(queuepath); System.Messaging.Message msg = new System.Messaging.Message { Priority = MessagePriority.Normal, Formatter = new XmlMessageFormatter(), Label = "test" }; msg.Body = txtMessageBody.Text; msg.UseDeadLetterQueue = true; msg.UseJournalQueue = true; msg.AcknowledgeType = AcknowledgeTypes.FullReachQueue | AcknowledgeTypes.FullReceive; msg.AdministrationQueue = new MessageQueue(@".\private$\Ack"); if (SendTransactional) mq.Send(msg, MessageQueueTransactionType.Single); else mq.Send(msg); Additional Information: in the IIS logs on the destination machines I can see each message I send being recorded as a POST with a status code of 200. I am open to any suggestions.

  Read the article

• Problem between Glassfish and Spring Security Basic Authentication

  - by Raspayu

  Hi! I am enabling a simple HTTP Basic Authentication with Spring security in my project. My environment is an Glassfish Server (bundled with Netbeans), and almost everything works perfect: I have set up it to just ask for authentication with the POST method, with hardcoded users with "user-service", and it works with user names with no special characters. The problem comes when I set up an user with "@" or "." Here is the spring-security related part of my servlet.xml: <security:http> <security:intercept-url method="POST" pattern="/**" access="ROLE_USER" /> <security:http-basic/> </security:http> <security:authentication-manager alias="authenticationManager"> <security:authentication-provider user-service-ref="uservice"/> </security:authentication-manager> <security:user-service id="uservice"> <security:user name="[email protected]" password="pswd1" authorities="ROLE_USER" /> <security:user name="[email protected]" password="pswd2" authorities="ROLE_USER" /> <security:user name="pepe" password="pepito" authorities="ROLE_USER" /> </security:user-service> I have looked also for what did the browser send to the listening port, and it sends right the par "username:password" in base 64, so i think the problem is in my server(Glassfish v3). Does anyone have any idea? Thanks in advance! Raspayu

  Read the article

• Silverlight HttpWebRequest.Create hangs inside async block

  - by jack2010

  I am trying to prototype a Rpc Call to a JBOSS webserver from Silverlight (4). I have written the code and it is working in a console application - so I know that Jboss is responding to the web request. Porting it to silverlight 4, is causing issues: let uri = new Uri(queryUrl) // this is the line that hangs let request : HttpWebRequest = downcast WebRequest.Create(uri) request.Method <- httpMethod; request.ContentType <- contentType It may be a sandbox issue, as my silverlight is being served off of my file system and the Uri is a reference to the localhost - though I am not even getting an exception. Thoughts? Thx UPDATE 1 I created a new project and ported my code over and now it is working; something must be unstable w/ regard to the F# Silverlight integration still. Still would appreciate thoughts on debugging the "hanging" web create in the old model... UPDATE 2 let uri = Uri("http://localhost./portal/main?isSecure=IbongAdarnaNiFranciscoBalagtas") // this WebRequest.Create works fine let req : HttpWebRequest = downcast WebRequest.Create(uri) let Login = async { let uri = new Uri("http://localhost/portal/main?isSecure=IbongAdarnaNiFranciscoBalagtas") // code hangs on this WebRequest.Create let request : HttpWebRequest = downcast WebRequest.Create(uri) return request } Login |> Async.RunSynchronously I must be missing something; the Async block works fine in the console app - is it not allowed in the Silverlight App?

  Read the article

• Website (jQuery) consistently crashes Internet Explorer (REALLY STUCK!)

  - by Bradley Bell

  Hey Guys. I posted this question yesterday, but haven't had a response. Basically, I'm totally stuck and clueless over crashing in Internet Explorer. The website now works fine in all browsers except internet explorer. The website is heavily reliant on jQuery and as far as I'm aware, I cant spot anything wrong with the script. Internet Explorer displays no errors and I don't know what I can possibly change. It displays fine, which would suggest that its nothing up with the CSS or HTML? I'm fairly sure it has to be the script, because it only crashes when you hover over one of the mouseover links. I'm already over the deadline and time is ticking! Its driving me crazy. I've uploaded it onto a test directory here: www.openyourheart.org.uk/test/index.html (I'll add the script/css links below as a comment, It wont let me post more than one here!) I would reaaly, really appreciate any help on this. I can also send the website compressed and post scripts here if required/preferred. Thanks in advance, Bradley

  Read the article

• Rails RJS template displays code instead of the html page

  - by Anand

  After having Googled and hurting my brain for hours on this, I finally decided to post this question. Here's the code... view1.html.erb -------------- <%=link_to_remote_redbox "Link", :url => {:action => :action1, :id => @some.id} some_controller.rb ------------------ def action1 render :layout => false end def action2 do some processing end action1.html.erb -------------------- <form onsubmit="new Ajax.Request('/some_controller/action2', {asynchronous:true, evalScripts:true, onComplete:function(request){RedBox.close(); return false;}, parameters:Form.serialize(this)}); return false;}" method="post" action="/some_controller/action2"> <input type=text name='username'> <input type='submit' value='submit'> </form> action2.rjs ----------- page.replace_html("some_div", (render(:partial => "some_partial"))) with that code in place when action2.rjs kicks in it should display the html page instead I am getting this Element.update("some_div", "<style type=\"text/css\">\n\n.............. As suggested on other posts I read, they say its caused because of the ":update = some_div" in the link_to_remote_redbox function but clearly my code doesn't have that. Help is always appreciated. Many Thanks

  Read the article

• django customizing form labels

  - by Henri

  I have a problem in customizing labels in a Django form This is the form code in file contact_form.py: from django import forms class ContactForm(forms.Form): def __init__(self, subject_label="Subject", message_label="Message", email_label="Your email", cc_myself_label="Cc myself", *args, **kwargs): super(ContactForm, self).__init__(*args, **kwargs) self.fields['subject'].label = subject_label self.fields['message'].label = message_label self.fields['email'].label = email_label self.fields['cc_myself'].label = cc_myself_label subject = forms.CharField(widget=forms.TextInput(attrs={'size':'60'})) message = forms.CharField(widget=forms.Textarea(attrs={'rows':15, 'cols':80})) email = forms.EmailField(widget=forms.TextInput(attrs={'size':'60'})) cc_myself = forms.BooleanField(required=False) The view I am using this in looks like: def contact(request, product_id=None): . . . if request.method == 'POST': form = contact_form.ContactForm(request.POST) if form.is_valid(): . . else: form = contact_form.ContactForm( subject_label = "Subject", message_label = "Your Message", email_label = "Your email", cc_myself_label = "Cc myself") The strings used for initializing the labels will eventually be strings dependent on the language, i.e. English, Dutch, French etc. When I test the form the email is not sent and instead of the redirect-page the form returns with: <QueryDict: {u'cc_myself': [u'on'], u'message': [u'message body'], u'email':[u'[email protected]'], u'subject': [u'test message']}>: where the subject label was before. This is obviously a dictionary representing the form fields and their contents. When I change the file contact_form.py into: from django import forms class ContactForm(forms.Form): """ def __init__(self, subject_label="Subject", message_label="Message", email_label="Your email", cc_myself_label="Cc myself", *args, **kwargs): super(ContactForm, self).__init__(*args, **kwargs) self.fields['subject'].label = subject_label self.fields['message'].label = message_label self.fields['email'].label = email_label self.fields['cc_myself'].label = cc_myself_label """ subject = forms.CharField(widget=forms.TextInput(attrs={'size':'60'})) message = forms.CharField(widget=forms.Textarea(attrs={'rows':15, 'cols':80})) email = forms.EmailField(widget=forms.TextInput(attrs={'size':'60'})) cc_myself = forms.BooleanField(required=False) i.e. disabling the initialization then everything works. The form data is sent by email and the redirect page shows up. So obviously something the the init code isn't right. But what? I would really appreciate some help.

  Read the article

• Why won't .attr('checked','checked') set?

  - by Jason

  I have the following snippet of code (I'm using jQuery 1.4.2): $.post('/Ads/GetAdStatsRow/', { 'ad_id': id }, function(result) { $('#edit_ads_form tbody').prepend(result); $(result).find('td.select-ad input').attr('checked','checked').click(); }); Assume that the post works correctly and returns a correct pre-built <tr> with some <td>s. Here's the weirdness: the $(result).find() line finds the correct input (which is a checkbox, as it's the only input in the cell) and runs the chained click() function correctly, but it REFUSES to set the box as checked, which I need to happen. Here's a crazy twist, too... when I get super specific and change the $(result).find() line to this (the id of the checkbox): $('#ad_' + id).click(); It checks the box, but doesn't run the click() function! If I set it to $('#ad_' + id).attr('checked','checked').click(); it runs the click function as though the box were checked, but the box remains unchecked, and if I do $('#ad_' + id).click().attr('checked','checked'); it does nothing at all. What in the world could be the matter with this? I'm running out of hair.... Thanks!

  Read the article

• wait for CLLocationManager to finish before tweeting

  - by user295944

  I want to wait for latitude.text and longtitude.text to be filled in before sending a tweet, this code works fine, but I would rather not put the tweeting part in locationManager because I also want to sometimes update the current location without sending a tweet. How can I make sure the txt gets filled in before sending the tweet without doing this? - (IBAction)update { latitude.text =@""; longitude.text =@""; locmanager = [[CLLocationManager alloc] init]; [locmanager setDelegate:self]; [locmanager setDesiredAccuracy:kCLLocationAccuracyBest]; [locmanager startUpdatingLocation]; } - (void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { CLLocationCoordinate2D location = [newLocation coordinate]; latitude.text = [NSString stringWithFormat: @"%f", location.latitude]; longitude.text = [NSString stringWithFormat: @"%f", location.longitude]; TwitterRequest * t = [[TwitterRequest alloc] init]; t.username = @"****"; t.password = @"****"; [twitterMessageText resignFirstResponder]; loadingActionSheet = [[UIActionSheet alloc] initWithTitle:@"Posting To Twitter..." delegate:nil cancelButtonTitle:nil destructiveButtonTitle:nil otherButtonTitles:nil]; [loadingActionSheet showInView:self.view]; [t statuses_update:twitterMessageText.text andLat:latitude.text andLong:longitude.text delegate:self requestSelector:@selector(status_updateCallback:)]; twitterMessageText.text=@""; }

  Read the article

• form with multiple upload but allow no upload on edit problems

  - by minus4

  hiya i have a section that when created takes in images, however when you edit this item i dont want them to re-upload none changes images just to change a description or name. i have created this that deals with uploading files: public void UploadFiles(string currentFileName, FormCollection form) { // loop through all files in form post foreach (string file in Request.Files) { HttpPostedFileBase hpf = Request.Files[file]; // if no file is uploaded, we could be editing so set to current value if (hpf.ContentLength == 0) { form[file] = currentFileName; } else { //rename the file unique so we dont clash with names var filename = hpf.FileName.Replace(" ", "_").Replace(".", DateTime.Now.Date.Ticks + "."); UploadFileName = filename; hpf.SaveAs(Server.MapPath("~/Content/custom/" + filename)); // set the name of the file in our post to the new name form[file] = UploadFileName; } } // ensure value is still sent when no files are uploaded on edit if(Request.Files.Count <= 0) { UploadFileName = currentFileName; } } all works fine when only one image is required (CurrentFileName), however there is now a new image available taking it to a total of 2 images in the database therefor currentFileName is obsolete. has anyone tackled this and how as i have hit a wall with this one. thought of string[] currentFiles but cant see how to match this into string file in Request.Files. if it helps i am also working with models for the form so i could pass over the model but i dont think your able to do model.file without some kind of reflection. help much appreciated. thanks

  Read the article

• c# (wcf) architecture file and directory structure (and instantiation)

  - by stevenrosscampbell

  Hello and thanks for any assistance. I have a wcf service that I'm trying to properly modularize. I'm interested in finding out if there is a better way or implementing the file and directory structure along with instanciatation, is there a more appropriate way of abstraction that I may be missing? Is this the best approach? especially if performance and the ability to handle thousands of simultanious request? Currently I have this following structure: -Root\Service.cs public class Service : IService { public void CreateCustomer(Customer customer) { CustomerService customerService = new CustomerService(); customerService.Create(customer); } public void UpdateCustomer(Customer customer) { CustomerService customerService = new CustomerService(); customerService.Update(customer); } } -Root\Customer\CustomerService.cs pulbic class CustomerService { public void Create(Customer customer) { //DO SOMETHING } public void Update(Customer customer) { //DO SOMETHING } public void Delete(int customerId) { //DO SOMETHING } public Customer Retrieve(int customerId) { //DO SOMETHING } } Note: I do not include the Customer Object or the DataAccess libraries in this example as I am only concerned about the service. If you could either let me know what you think, if you know a better way, or a resource that could help out. Thanks Kindly. Steven

  Read the article

• How to build an android test app with a dependency on another app using ant?

  - by Mike

  I have a module called MyApp, and another module called MyAppTests which has a dependency on MyApp. Both modules produce APKs, one named MyApp.apk and the other MyAppTests.apk. I normally build these in IntelliJ or Eclipse, but I'd like to create an ant buildfile for them for the purpose of continuous integration. I used "android update" to create a buildfile for MyApp, and thanks to commonsware's answer to my previous question I've been able to build it successfully using ant. I'd now like to build MyAppTests.apk using ant. I constructed the buildfile as before using "android update", but when I run it I get an error indicating that it's not finding any of the classes in MyApp. Taking a que from my previous question, I tried putting MyApp.apk into my MyAppTests/libs, but unfortunately that didn't miraculously solve the problem. What's the best way to build a test app APK using ant when it depends on classes in another APK? $ ant debug Buildfile: build.xml [setup] Project Target: Google APIs [setup] Vendor: Google Inc. [setup] Platform Version: 1.5 [setup] API level: 3 [setup] WARNING: No minSdkVersion value set. Application will install on all Android versions. dirs: [echo] Creating output directories if needed... resource-src: [echo] Generating R.java / Manifest.java from the resources... aidl: [echo] Compiling aidl files into Java classes... compile: [javac] Compiling 5 source files to /Users/mike/Projects/myapp/android/MyAppTests/bin/classes [javac] /Users/mike/Projects/myapp/android/MyAppTests/src/com/myapp/test/GsonTest.java:3: cannot find symbol [javac] symbol : class MyApplication [javac] location: package com.myapp [javac] import com.myapp.MyApplication; [javac] ^

  Read the article

• Render a Form from an XSLT file

  - by Russ Clark

  I've generated the following XSLT file, and have created a Form that will post to an ASP.Net MVC action called Home/ProcessRequest: <?xml version="1.0" encoding="utf-8"?> <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" > <xsl:output method="html" indent="yes"/> <xsl:template match="/"> <html> <body> <xsl:value-of select="Employee/Name"/> <br /> <xsl:value-of select="Employee/ID"/> <form method="post" action="/Home/ProcessRequest?id=42"> <input id="Action" name="Action" type="radio" value="Approved"></input> Approved <br /> <input id="Action" name="Action" type="radio" value="Rejected"></input> Rejected <br /> <input type="submit" value="Submit"></input> </form> </body> </html> Here is my XML File: <Employee xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xsd="http://www.w3.org/2001/XMLSchema"> <Name>Russ</Name> <ID>42</ID> </Employee> This works fine the way it is, but I need to change the id parameter in my from from a hard coded integer, to use the ID element from my XML file. Does anyone know how to do this?

  Read the article

• Guaranteed way to find the ildasm.exe and ilasm.exe files regardless of .NET version/environment?

  - by m-y

  Is there a way to programmatically get the FileInfo/Path of the ildasm.exe/ilasm.exe executables? I'm attempting to decompile and recompile a dll/exe file appropriately after making some alterations to it (I'm guessing PostSharp does something similar to alter the IL after the compilation). I found a blog post that pointed to: var pfDir = Environment.GetFolderPath(Environment.SpecialFolders.ProgramFiles)); var sdkDir = Path.Combine(pfDir, @"Microsoft SDKs\Windows\v6.0A\bin"); ... However, when I ran this code the directory did not exist (mainly because my SDK version is 7.1), so on my local machine the correct path is @"Microsoft SDKs\Windows\v7.1\bin". How do I ensure I can actually find the ildasm.exe? Similarly, I found another blog post on how to get access to ilasm.exe as: string windows = Environment.GetFolderPath(Environment.SpecialFolder.System); string fwork = Path.Combine(windows, @"..\Microsoft.NET\Framework\v2.0.50727"); ... While this works, I noticed that I have Framework and Framework64, and within Framework itself I have all of the versions up to v4.0.30319 (same with Framework64). So, how do I know which one to use? Should it be based on the .NET Framework version I'm targetting? Summary: How do I appropriately guarantee to find the correct path to ildasm.exe? How do I appropriately select the correct ilasm.exe to compile?

  Read the article

• x-dom-event-stream in Opera 10 Only Working on First Event

  - by Brad

  I have a python script (in the CherryPy framework) that sends Event: and data: text as this Opera blog post describes to a client browser. The javascript that recieves the x-dom-event-stream content is almost identical to what they show in the blog post. However, the browser displays only the first event sent. Anyone know what I'm missing? I tried a few older versions of Opera and found that it works in Opera 9.52 but not in any newer versions. What did they change? Here is the python code: class dumpData(object): def index(self): cherrypy.response.headers['Content-Type'] = "application/x-dom-event-stream" def yieldData(): i = 0 while 1: yield "Event: count\n" yield "data: " yield i yield "\n\n" i = i + 1 time.sleep(3); return yieldData() index._cp_config = {'response.stream': True} index.exposed = True And here is the javascript/html. Making a request to /data/ runs the python function above. <head> <script> onload = function() { document.getElementById("count").addEventListener("cout", cout, false); } function count(e) { document.getElementById("stream").firstChild.nodeValue = e.data; } </script> <event-source id="count" src="/data/"> </head> <body> <div id="stream"></div> </body> Opening the direct /data/ url in Firefox saves the stream to a file. So I know the output is in the correct format and that the stream works at all.

  Read the article

• Unable to call RESTful web services methods

  - by Alessandro

  Hello, I'm trying to dive into the RESTful web services world and have started with the following template: [ServiceContract] [AspNetCompatibilityRequirements(RequirementsMode = AspNetCompatibilityRequirementsMode.Allowed)] [ServiceBehavior(InstanceContextMode = InstanceContextMode.PerCall)] public class Test { // TODO: Implement the collection resource that will contain the SampleItem instances [WebGet(UriTemplate = ""), OperationContract] public List<SampleItem> GetCollection() { // TODO: Replace the current implementation to return a collection of SampleItem instances return new List<SampleItem>() {new SampleItem() {Id = 1, StringValue = "Hello"}}; } [WebInvoke(UriTemplate = "", Method = "POST"), OperationContract] public SampleItem Create(SampleItem instance) { // TODO: Add the new instance of SampleItem to the collection throw new NotImplementedException(); } [WebGet(UriTemplate = "{id}"), OperationContract] public SampleItem Get(string id) { // TODO: Return the instance of SampleItem with the given id throw new NotImplementedException(); } [WebInvoke(UriTemplate = "{id}", Method = "PUT"), OperationContract] public SampleItem Update(string id, SampleItem instance) { return new SampleItem { Id = 99, StringValue = "Done" }; } [WebInvoke(UriTemplate = "{id}", Method = "DELETE"), OperationContract] public void Delete(string id) { // TODO: Remove the instance of SampleItem with the given id from the collection throw new NotImplementedException(); } } I am able to perform the GET operation but I am unable to perform PUT, POST or DELETE requests. Can anyone explain me how to perform these operations and how to create the correct URLs? Best regards Alessandro

  Read the article

• Using StringBuilder to process csv files to save heap space

  - by portoalet

  I am reading a csv file that has about has about 50,000 lines and 1.1MiB in size (and can grow larger). In Code1, I use String to process the csv, while in Code2 I use StringBuilder (only one thread executes the code, so no concurrency issues) Using StringBuilder makes the code a little bit harder to read that using normal String class. Am I prematurely optimizing things with StringBuilder in Code2 to save a bit of heap space and memory? Code1 fr = new FileReader(file); BufferedReader reader = new BufferedReader(fr); String line = reader.readLine(); while ( line != null ) { int separator = line.indexOf(','); String symbol = line.substring(0, seperator); int begin = separator; separator = line.indexOf(',', begin+1); String price = line.substring(begin+1, seperator); // Publish this update publisher.publishQuote(symbol, price); // Read the next line of fake update data line = reader.readLine(); } Code2 fr = new FileReader(file); StringBuilder stringBuilder = new StringBuilder(reader.readLine()); while( stringBuilder.toString() != null ) { int separator = stringBuilder.toString().indexOf(','); String symbol = stringBuilder.toString().substring(0, separator); int begin = separator; separator = stringBuilder.toString().indexOf(',', begin+1); String price = stringBuilder.toString().substring(begin+1, separator); publisher.publishQuote(symbol, price); stringBuilder.replace(0, stringBuilder.length(), reader.readLine()); }

  Read the article

• Ajax.BeginForm driving me crazy

  - by Fabio Milheiro

  ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

  Read the article

• Eclipse PDE - Plug-in, Feature, and Product Versioning

  - by Michael

  I am having much confusion over the process of upgrading version numbers in dependent plug-ins, features, and products in a fairly large eclipse workspace. I have made API changes to java code residing in an existing plug-in and thus requires an increase of the Major part of the version identifier. This plug-in serves as a dependency to a given feature, where the feature is later included in a product. From the documentation at http://wiki.eclipse.org/Version_Numbering, I understand (for the most part) when the proper number should be increased on the containing plug-in itself. However, how would this Major version number change on the plug-in affect dependent, "down-the-line" items (e.g., features, products)? For example, assume we have the typical "Hello World" setup as follows: Plug-in: com.example.helloworld, version 1.0.0 Feature: com.example.helloworld.feature, version 1.0.0 Product: com.example.helloworld.product, version 1.0.0 If I were to make an API change in the plug-in, this would require a version update to be that of 2.0.0. What would then be the version of the feature, 1.1.0? The same question can be applied for the product level as well (e.g., if the feature is 1.1.0 OR 2.0.0, what is the product version number)? I'm sure this is quite the newbie question so I apologize for wasting anyone's time and effort. I have searched for this type of content but all I am finding is are examples showing how to develop a plug-in, feature, product, and update site for the first time. The only other content related to my search has been developing feature patches and have not touched on the versioning aspect as much as I would prefer. I am having difficulty coming into (for the first time) an Eclipse RCP / PDE environment and need to learn the proper way and / or best practices for making such versioning updates and how to best reflect this throughout other dependent projects in the workspace.

  Read the article

• Input validation in WPF

  - by irfanali-wpfexpert

  i am developing an application in wpf using MVVM design pattern. i have a listbox when an item is slected then a dialog is open having the same record in editable mode. this dialog is binded with the selected item of the list. i have apply the validation rule for textbox using IDataErrorInfo. when the user update a record on dialogbox then at every key press, the selected record in listbox is also changed. if the user press save button then i submit changes to database. but if user click cancel button then i do not submit changes to database but the list box is updated with the current updation in GUI. when i refresh the list then old value appears again. My requirement is to update the listbox only when the user hit the save button but not on every key press on dialog box. I first fill the generic list with the linq to sql classes then bind the listbox with it. Please let me know what i have to do. Thanks in advance

  Read the article

• jQuery - Not sure which method to use, closest() and parent() don't work.

  - by Nike

  Hello, again. :) God i feel like i'm spamming stackoverflow, this is my 3rd post for today. Sorry, heh. I even posted a question regarding this before, kind of, but i've changed the code a bit since so i thought it was better to post a new question. $('.pmlist ul li h4 .toggle').click(function() { $(this).closest('.meddel').toggle(250); }); That's what i've got now. The reason why the closest() method isn't working is because the div .meddel is just next to the h4 element. And closest() only crawls right up the DOM tree, ignoring other child elements. Right? parent() works almost the same and doesn't work either. And as i only want to toggle the closest .meddel div in the element, i need something that, yeah justs grabs the nearest one, and not all of them. To clear it up a bit, here's the HTML for one list item: <li class="item"> <h4><a class="toggle">ämne</a><small>2010-04-17 kl 12:54 by <u>nike1</u></small></h4> <div class="meddel"> <span> <img style="max-width: 70%; min-height: 70%;" src="profile-images/nike1.jpg" alt="" /> <a href="account.php?usr=47">nike1</a> </span> <p>text</p> </div> </li> I have several items like that, and if i click one toggle link, i just want the nearest .meddel to be toggled, as mentioned before. Thanks. -Nike

  Read the article

• why DbCommandBuilder (Oracle) produces weird WHERE-clause to UpdateCommand in C# / ADO.NET 2.0?

  - by matti

  I have a table HolidayHome in oracle db which has unique db index on Id (I haven't specified this in the code in any way for adapter/table/dataset, don't know if i should/can). DbDataAdapter.SelectCommand is like this: SELECT Id, ExtId, Label, Location1, Location2, Location3, Location4, ClassId, X, Y, UseType FROM HolidayHome but UpdateCommand generated by DbCommandBuilder has very weird where clause: UPDATE HOLIDAYHOME SET ID = :p1, EXTID = :p2, LABEL = :p3, LOCATION1 = :p4, LOCATION2 = :p5, LOCATION3 = :p6, LOCATION4 = :p7, CLASSID = :p8, X = :p9, Y = :p10, USETYPE = :p11 WHERE ((ID = :p12) AND ((:p13 = 1 AND EXTID IS NULL) OR (EXTID = :p14)) AND ((:p15 = 1 AND LABEL IS NULL) OR (LABEL = :p16)) AND ((:p17 = 1 AND LOCATION1 IS NULL) OR (LOCATION1 = :p18)) AND ((:p19 = 1 AND LOCATION2 IS NULL) OR (LOCATION2 = :p20)) AND ((:p21 = 1 AND LOCATION3 IS NULL) OR (LOCATION3 = :p22)) AND ((:p23 = 1 AND LOCATION4 IS NULL) OR (LOCATION4 = :p24)) AND (CLASSID = :p25) AND (X = :p26) AND (Y = :p27) AND (USETYPE = :p28)) the code is like this: static bool CreateInsertUpdateDeleteCmds(DbDataAdapter dataAdapter) { DbCommandBuilder builder = _trgtProvFactory.CreateCommandBuilder(); builder.DataAdapter = dataAdapter; // Get the insert, update and delete commands. dataAdapter.InsertCommand = builder.GetInsertCommand(); dataAdapter.UpdateCommand = builder.GetUpdateCommand(); dataAdapter.DeleteCommand = builder.GetDeleteCommand(); } what to do? The UpdateCommand is utter madness. Thanks & Best Regards: Matti

  Read the article

• Vlad the deployer on Dreamhost - initial script

  - by xmariachi

  Hi, I'm trying to deploy an app with SVN and Vlad the deployer. Vlad and its dependencies are installed and seem OK. I'm trying the following: rake prod vlad:update Being my config/deploy.rb file: task :prod do set :application, "xxx" set :deploy_timestamped, "false" set :user, "username" set :scm_user, "scmusername" set :repository, "http://domain.com/svn/app" set :domain, "domain.com" set :deploy_to, "/home/username/deployments/app" puts "Production deployment to #{deploy_to}" end I have done "rake prod vlad:setup" already, that's fine. But when calling "rake prod vlad:update", I get the following A ...file Exported revision 14. ln: creating symbolic link `/home/username/deployments/drupalgestalt/releases/20100503164225/public/system' to `/home/username/deployments/drupalgestalt/shared/system': No such file or directory rake aborted! execution failed with status 1: ssh domain.com ln -s /home/username/deployments/app/shared/log /home/username/deployments/app/releases/20100503164225/log && ln -s /home/username/deployments/app/shared/system /home/username/deployments/app/releases/20100503164225/public/system && ln -s /home/username/deployments/app/shared/pids /home/username/deployments/app/releases/20100503164225/tmp/pids Apparently it complains when creating the ln, but permissions are all set up fine. Am I doing anything wrong? I'm just starting with Vlad on the assumption it was super-easy to set up. Had played a bit with cap in the past, and I do like Vlad idea.

  Read the article

• How to implement two way binding between an ActiveX control and a WPF MVVM View Model

  - by Zamboni

  I have a WPF application implemented using the MVVM framework that uses an ActiveX control and I need to keep the WPF and ActiveX UI synchronised. So far I can update the ActiveX UI when I change the WPF UI using the code at the bottom of the question that I got from the article Hosting an ActiveX Control in WPF and this question. But I cannot update the WPF UI when I make a change in the ActiveX UI. I suspect that I need to fire the PropertyChanged event from my ActiveX control but I have no idea how to do this or if it is even possible. The ActiveX controls I have written are in VB6 and MFC as I am just prototying at this time for the eventual integration of VB6 ActiveX controls in a WPF contaner application. Here is a code snipet that indicates the work done so far: System.Windows.Forms.Integration.WindowsFormsHost host = new System.Windows.Forms.Integration.WindowsFormsHost(); // Create the ActiveX control. AxTEXTBOXActiveXLib.AxTEXTBOXActiveX axWmp = new AxTEXTBOXActiveXLib.AxTEXTBOXActiveX(); // Assign the ActiveX control as the host control's child. host.Child = axWmp; axWmp.DataBindings.Add(new System.Windows.Forms.Binding("ActiveXStatus", (MainWindowViewModel)this.DataContext, "ModelStatus", true, DataSourceUpdateMode.OnPropertyChanged )); // Add the interop host control to the Grid // control's collection of child controls. this.activexRow.Children.Add(host); How to implement two way binding between an ActiveX control and a WPF MVVM View Model?

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

< Previous Page | 555 556 557 558 559 560 561 562 563 564 565 566  | Next Page >