Search Results

Search found 6326 results on 254 pages for 'continuous operation'.

Page 56/254 | < Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >

  • Find the "largest" dense sub matrix in a large sparse matrix

    - by BCS
    Given a large sparse matrix (say 10k+ by 1M+) I need to find a subset, not necessarily continuous, of the rows and columns that form a dense matrix (all non-zero elements). I want this sub matrix to be as large as possible (not the largest sum, but the largest number of elements) within some aspect ratio constraints. Are there any known exact or aproxamate solutions to this problem? A quick scan on Google seems to give a lot of close-but-not-exactly results. What terms should I be looking for? edit: Just to clarify; the sub matrix need not be continuous. In fact the row and column order is completely arbitrary so adjacency is completely irrelevant. A thought based on Chad Okere's idea Order the rows from largest count to smallest count (not necessary but might help perf) Select two rows that have a "large" overlap Add all other rows that won't reduce the overlap Record that set Add whatever row reduces the overlap by the least Repeat at #3 until the result gets to small Start over at #2 with a different starting pair Continue until you decide the result is good enough

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Timer a usage in msp430 in high compiler optimization mode

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code, //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • My timer code is failing when IAR is configured to do max optimization

    - by Vishal
    Hi, I have used timer A in MSP430 with high compiler optimization, but found that my timer code is failing when high compiler optimization used. When none optimization is used code works fine. This code is used to achieve 1 ms timer tick. timeOutCNT is increamented in interrupt. Following is the code [Code] //Disable interrupt and clear CCR0 TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0; // timer interrupt flag disabled CCTL0 = CCIE; // CCR0 interrupt enabled CCR0 = 500; TIMER_A_TACTL &= TIMER_A_TAIE; //enable timer interrupt TIMER_A_TACTL &= TIMER_A_TAIFG; //enable timer interrupt TACTL = TIMER_A_TASSEL + MC_1 + ID_3; // SMCLK, upmode timeOutCNT = 0; //timeOutCNT is increased in timer interrupt while(timeOutCNT <= 1); //delay of 1 milisecond TIMER_A_TACTL = TIMER_A_TASSEL | // set the clock source as SMCLK TIMER_A_ID | // set the divider to 8 TACLR | // clear the timer MC_1; // continuous mode TIMER_A_TACTL &= ~TIMER_A_TAIE; // timer interrupt disabled TIMER_A_TACTL &= 0x00; // timer interrupt flag disabled [/code] Can anybody help me here to resolve this issue? Is there any other way we can use timer A so it works fine in optimization modes? Or do I have used is wrongly to achieve 1 ms interrupt? Thanks in advanced. Vishal N

    Read the article

  • What guidelines should be followed when using an unstable/testing/stable branching scheme?

    - by Elliot
    My team is currently using feature branches while doing development. For each user story in our sprint, we create a branch and work it in isolation. Hence, according to Martin Fowler, we practice Continuous Building, not Continuous Integration. I am interested in promoting an unstable/testing/stable scheme, similar to that of Debian, so that code is promoted from unstable = testing = stable. Our definition of done, I'd recommend, is when unit tests pass (TDD always), minimal documentation is complete, automated functional tests pass, and feature has been demo'd and accepted by PO. Once accepted by the PO, the story will be merged into the testing branch. Our test developers spend most of their time in this branch banging on the software and continuously running our automated tests. This scares me, however, because commits from another incomplete story may now make it into the testing branch. Perhaps I'm missing something because this seems like an undesired consequence. So, if moving to a code promotion strategy to solve our problems with feature branches, what strategy/guidelines do you recommend? Thanks.

    Read the article

  • Eclipse Error Exporting Web Project as WAR

    - by Anand
    Hi I have the following error when I export my war file org.eclipse.core.runtime.CoreException: Extended Operation failure: org.eclipse.jst.j2ee.internal.web.archive.operations.WebComponentExportOperation at org.eclipse.wst.common.frameworks.internal.datamodel.ui.DataModelWizard.performFinish(DataModelWizard.java:189) at org.eclipse.jface.wizard.WizardDialog.finishPressed(WizardDialog.java:752) at org.eclipse.jface.wizard.WizardDialog.buttonPressed(WizardDialog.java:373) at org.eclipse.jface.dialogs.Dialog$2.widgetSelected(Dialog.java:624) at org.eclipse.swt.widgets.TypedListener.handleEvent(TypedListener.java:228) at org.eclipse.swt.widgets.EventTable.sendEvent(EventTable.java:84) at org.eclipse.swt.widgets.Widget.sendEvent(Widget.java:1003) at org.eclipse.swt.widgets.Display.runDeferredEvents(Display.java:3880) at org.eclipse.swt.widgets.Display.readAndDispatch(Display.java:3473) at org.eclipse.jface.window.Window.runEventLoop(Window.java:825) at org.eclipse.jface.window.Window.open(Window.java:801) at org.eclipse.ui.internal.handlers.WizardHandler$Export.executeHandler(WizardHandler.java:97) at org.eclipse.ui.internal.handlers.WizardHandler.execute(WizardHandler.java:273) at org.eclipse.ui.internal.handlers.HandlerProxy.execute(HandlerProxy.java:294) at org.eclipse.core.commands.Command.executeWithChecks(Command.java:476) at org.eclipse.core.commands.ParameterizedCommand.executeWithChecks(ParameterizedCommand.java:508) at org.eclipse.ui.internal.handlers.HandlerService.executeCommand(HandlerService.java:169) at org.eclipse.ui.internal.handlers.SlaveHandlerService.executeCommand(SlaveHandlerService.java:241) at org.eclipse.ui.internal.actions.CommandAction.runWithEvent(CommandAction.java:157) at org.eclipse.ui.internal.actions.CommandAction.run(CommandAction.java:171) at org.eclipse.ui.actions.ExportResourcesAction.run(ExportResourcesAction.java:116) at org.eclipse.ui.actions.BaseSelectionListenerAction.runWithEvent(BaseSelectionListenerAction.java:168) at org.eclipse.jface.action.ActionContributionItem.handleWidgetSelection(ActionContributionItem.java:584) at org.eclipse.jface.action.ActionContributionItem.access$2(ActionContributionItem.java:501) at org.eclipse.jface.action.ActionContributionItem$5.handleEvent(ActionContributionItem.java:411) at org.eclipse.swt.widgets.EventTable.sendEvent(EventTable.java:84) at org.eclipse.swt.widgets.Widget.sendEvent(Widget.java:1003) at org.eclipse.swt.widgets.Display.runDeferredEvents(Display.java:3880) at org.eclipse.swt.widgets.Display.readAndDispatch(Display.java:3473) at org.eclipse.ui.internal.Workbench.runEventLoop(Workbench.java:2405) at org.eclipse.ui.internal.Workbench.runUI(Workbench.java:2369) at org.eclipse.ui.internal.Workbench.access$4(Workbench.java:2221) at org.eclipse.ui.internal.Workbench$5.run(Workbench.java:500) at org.eclipse.core.databinding.observable.Realm.runWithDefault(Realm.java:332) at org.eclipse.ui.internal.Workbench.createAndRunWorkbench(Workbench.java:493) at org.eclipse.ui.PlatformUI.createAndRunWorkbench(PlatformUI.java:149) at org.eclipse.ui.internal.ide.application.IDEApplication.start(IDEApplication.java:113) at org.eclipse.equinox.internal.app.EclipseAppHandle.run(EclipseAppHandle.java:194) at org.eclipse.core.runtime.internal.adaptor.EclipseAppLauncher.runApplication(EclipseAppLauncher.java:110) at org.eclipse.core.runtime.internal.adaptor.EclipseAppLauncher.start(EclipseAppLauncher.java:79) at org.eclipse.core.runtime.adaptor.EclipseStarter.run(EclipseStarter.java:368) at org.eclipse.core.runtime.adaptor.EclipseStarter.run(EclipseStarter.java:179) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at org.eclipse.equinox.launcher.Main.invokeFramework(Main.java:559) at org.eclipse.equinox.launcher.Main.basicRun(Main.java:514) at org.eclipse.equinox.launcher.Main.run(Main.java:1311) Caused by: org.eclipse.core.commands.ExecutionException: Error exportingWar File at org.eclipse.jst.j2ee.internal.archive.operations.J2EEArtifactExportOperation.execute(J2EEArtifactExportOperation.java:131) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl$1.run(DataModelPausibleOperationImpl.java:376) at org.eclipse.core.internal.resources.Workspace.run(Workspace.java:1800) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.runOperation(DataModelPausibleOperationImpl.java:401) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.runOperation(DataModelPausibleOperationImpl.java:352) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.doExecute(DataModelPausibleOperationImpl.java:242) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.executeImpl(DataModelPausibleOperationImpl.java:214) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.cacheThreadAndContinue(DataModelPausibleOperationImpl.java:89) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.execute(DataModelPausibleOperationImpl.java:202) at org.eclipse.wst.common.frameworks.internal.datamodel.ui.DataModelWizard$1$CatchThrowableRunnableWithProgress.run(DataModelWizard.java:218) at org.eclipse.jface.operation.ModalContext$ModalContextThread.run(ModalContext.java:121) Caused by: org.eclipse.jst.j2ee.commonarchivecore.internal.exception.SaveFailureException: Error opening archive for export.. at org.eclipse.jst.j2ee.internal.web.archive.operations.WebComponentExportOperation.export(WebComponentExportOperation.java:64) at org.eclipse.jst.j2ee.internal.archive.operations.J2EEArtifactExportOperation.execute(J2EEArtifactExportOperation.java:123) ... 10 more Caused by: org.eclipse.jst.jee.archive.ArchiveSaveFailureException: Error saving archive: WebComponentArchiveLoadAdapter, Component: P/Nautilus2 to output path: D:/Nautilus2.war at org.eclipse.jst.jee.archive.internal.ArchiveFactoryImpl.saveArchive(ArchiveFactoryImpl.java:84) at org.eclipse.jst.j2ee.internal.archive.operations.J2EEArtifactExportOperation.saveArchive(J2EEArtifactExportOperation.java:306) at org.eclipse.jst.j2ee.internal.web.archive.operations.WebComponentExportOperation.export(WebComponentExportOperation.java:50) ... 11 more Caused by: java.io.FileNotFoundException: D:\myproject.war (Access is denied) at java.io.FileOutputStream.open(Native Method) at java.io.FileOutputStream.(Unknown Source) at java.io.FileOutputStream.(Unknown Source) at org.eclipse.jst.jee.archive.internal.ArchiveFactoryImpl.createSaveAdapterForJar(ArchiveFactoryImpl.java:108) at org.eclipse.jst.jee.archive.internal.ArchiveFactoryImpl.saveArchive(ArchiveFactoryImpl.java:74) ... 13 more Contains: Extended Operation failure: org.eclipse.jst.j2ee.internal.web.archive.operations.WebComponentExportOperation org.eclipse.core.commands.ExecutionException: Error exportingWar File at org.eclipse.jst.j2ee.internal.archive.operations.J2EEArtifactExportOperation.execute(J2EEArtifactExportOperation.java:131) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl$1.run(DataModelPausibleOperationImpl.java:376) at org.eclipse.core.internal.resources.Workspace.run(Workspace.java:1800) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.runOperation(DataModelPausibleOperationImpl.java:401) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.runOperation(DataModelPausibleOperationImpl.java:352) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.doExecute(DataModelPausibleOperationImpl.java:242) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.executeImpl(DataModelPausibleOperationImpl.java:214) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.cacheThreadAndContinue(DataModelPausibleOperationImpl.java:89) at org.eclipse.wst.common.frameworks.internal.datamodel.DataModelPausibleOperationImpl.execute(DataModelPausibleOperationImpl.java:202) at org.eclipse.wst.common.frameworks.internal.datamodel.ui.DataModelWizard$1$CatchThrowableRunnableWithProgress.run(DataModelWizard.java:218) at org.eclipse.jface.operation.ModalContext$ModalContextThread.run(ModalContext.java:121) Caused by: org.eclipse.jst.j2ee.commonarchivecore.internal.exception.SaveFailureException: Error opening archive for export.. at org.eclipse.jst.j2ee.internal.web.archive.operations.WebComponentExportOperation.export(WebComponentExportOperation.java:64) at org.eclipse.jst.j2ee.internal.archive.operations.J2EEArtifactExportOperation.execute(J2EEArtifactExportOperation.java:123) ... 10 more Caused by: org.eclipse.jst.jee.archive.ArchiveSaveFailureException: Error saving archive: WebComponentArchiveLoadAdapter, Component: P/Nautilus2 to output path: D:/Nautilus2.war at org.eclipse.jst.jee.archive.internal.ArchiveFactoryImpl.saveArchive(ArchiveFactoryImpl.java:84) at org.eclipse.jst.j2ee.internal.archive.operations.J2EEArtifactExportOperation.saveArchive(J2EEArtifactExportOperation.java:306) at org.eclipse.jst.j2ee.internal.web.archive.operations.WebComponentExportOperation.export(WebComponentExportOperation.java:50) ... 11 more Caused by: java.io.FileNotFoundException: D:\myproject.war (Access is denied) at java.io.FileOutputStream.open(Native Method) at java.io.FileOutputStream.(Unknown Source) at java.io.FileOutputStream.(Unknown Source) at org.eclipse.jst.jee.archive.internal.ArchiveFactoryImpl.createSaveAdapterForJar(ArchiveFactoryImpl.java:108) at org.eclipse.jst.jee.archive.internal.ArchiveFactoryImpl.saveArchive(ArchiveFactoryImpl.java:74) ... 13 more Can anyone help me out with this ?

    Read the article

  • Drag and Drop in MVVM with ScatterView

    - by Rich McGuire
    I'm trying to implement drag and drop functionality in a Surface Application that is built using the MVVM pattern. I'm struggling to come up with a means to implement this while adhering to the MVVM pattern. Though I'm trying to do this within a Surface Application I think the solution is general enough to apply to WPF as well. I'm trying to produce the following functionality: User contacts a FrameworkElement within a ScatterViewItem to begin a drag operation (a specific part of the ScatterViewItem initiates the drag/drop functionality) When the drag operation begins a copy of that ScatterViewItem is created and imposed upon the original ScatterViewItem, the copy is what the user will drag and ultimately drop The user can drop the item onto another ScatterViewItem (placed in a separate ScatterView) The overall interaction is quite similar to the ShoppingCart application provided in the Surface SDK, except that the source objects are contained within a ScatterView rather than a ListBox. I'm unsure how to proceeded in order to enable the proper communication between my ViewModels in order to provide this functionality. The main issue I've encountered is replicating the ScatterViewItem when the user contacts the FrameworkElement.

    Read the article

  • Unhandled Exception: C# RESTful Webservice

    - by Debby
    Hi, I am trying a simple C# Restful Webservice example. I have the service running. I create a console client to test the Webservice, i get the following exception: Unhandled Exception: System.ServiceModel.CommunicationException: Internal Server Error Server stack trace: at System.ServiceModel.Dispatcher.WebFaultClientMessageInspector.AfterReceiveReply(Message& reply, Object correlationState ) at System.ServiceModel.Dispatcher.ImmutableClientRuntime.AfterReceiveReply(ProxyRpc& rpc) at System.ServiceModel.Channels.ServiceChannel.HandleReply(ProxyOperationRuntime operation, ProxyRpc& rpc) at System.ServiceModel.Channels.ServiceChannel.Call(String action, Boolean oneway, ProxyOperationRuntime operation, Object [] ins, Object[] outs, TimeSpan timeout) at System.ServiceModel.Channels.ServiceChannelProxy.InvokeService(IMethodCallMessage methodCall, ProxyOperationRuntime ope ration) at System.ServiceModel.Channels.ServiceChannelProxy.Invoke(IMessage message) Exception rethrown at [0]: at System.Runtime.Remoting.Proxies.RealProxy.HandleReturnMessage(IMessage reqMsg, IMessage retMsg) at System.Runtime.Remoting.Proxies.RealProxy.PrivateInvoke(MessageData& msgData, Int32 type) at WebServiceClient.IService.GetData(String Data) at TestClient.Program.Main() in C:\My Documents\Visual Studio 2008\Projects\WebServiceTesting\WebServiceClient\WebServiceC lient\Program.cs:line 38 Does anyone know, why I am getting this unhandled exception and what can be done?

    Read the article

  • .NET Web Service (asmx) Timeout Problem

    - by Barry Fandango
    I'm connecting to a vendor-supplied web ASMX service and sending a set of data over the wire. My first attempt hit the 1 minute timeout that Visual Studio throws in by default in the app.config file when you add a service reference to a project. I increased it to 10 minutes, another timeout. 1 hour, another timeout: Error: System.TimeoutException: The request channel timed out while waiting for a reply after 00:59:59.6874880. Increase the timeout value passed to the call to Request or increase the SendTimeout value on the Binding. The time allotted to this operation may have been a portion of a longer timeout. ---> System.TimeoutE xception: The HTTP request to 'http://servername/servicename.asmx' has exceeded the allotted timeout of 01:00:00. The time allotted to this operation may have been a portion of a longer timeout. ---> System.Net.WebExcept ion: The operation has timed out at System.Net.HttpWebRequest.GetResponse() [... lengthly stacktrace follows] I contacted the vendor. They confirmed the call may take over an hour (don't ask, they are the bane of my existence.) I increased the timeout to 10 hours to be on the safe side. However the web service call continues to time out at 1 hour. The relevant app.config section now looks like this: <basicHttpBinding> <binding name="BindingName" closeTimeout="10:00:00" openTimeout="10:00:00" receiveTimeout="10:00:00" sendTimeout="10:00:00" allowCookies="false" bypassProxyOnLocal="false" hostNameComparisonMode="StrongWildcard" maxBufferSize="2147483647" maxBufferPoolSize="524288" maxReceivedMessageSize="2147483647" messageEncoding="Text" textEncoding="utf-8" transferMode="Buffered" useDefaultWebProxy="true"> <readerQuotas maxDepth="32" maxStringContentLength="8192" maxArrayLength="2147483647" maxBytesPerRead="4096" maxNameTableCharCount="16384" /> <security mode="None"> <transport clientCredentialType="None" proxyCredentialType="None" realm="" /> <message clientCredentialType="UserName" algorithmSuite="Default" /> </security> </binding> </basicHttpBinding> Pretty absurd, but regardless the timeout is still kicking in at 1 hour. Unfortunately every change takes at least an additional hour to test. Is there some internal limit that I'm bumping into - another timeout setting to be changed somewhere? All changes to these settings up to one hour had the expected effect. Thanks for any help you can provide!

    Read the article

  • SOAP Web Service method naming conventions

    - by dbguy
    Consider a Web Service (e.g. SOAP-based) that has an operation which accepts a bulk of data from the client. From the server's point of view it is receiving data, but from the client's point of view it's sending data. How should that operation be named? The options are ImportData ExportData / SendData Is there a de facto standard for naming these things? How do web services usually name these? Thank you for your opinions.

    Read the article

  • What is the meaning of NSXMLParserErrorDomain error 5.?

    - by mobibob
    Ok, I am back on this task. I have my XML properly download from my webserver with a URL pointing to the server's file, however, when I detect the network is 'unreachable' I simply point the URL to my application's local XML and I get the following error (N.B. the file is a direct copy of the one on the server). I cannot find detail description, but I think it is saying that the URL is pointing to an inaccessible location. Am I storing this resource in the wrong location? I think I want it in the HomeDirectory / Library?? Debug output loadMyXml: /var/mobile/Applications/950569B0-6113-48FC-A184-4F1B67A0510F/MyApp.app/SampleHtml.xml 2009-10-14 22:08:17.257 MyApp[288:207] Wah! It didn't work. Error Domain=NSXMLParserErrorDomain Code=5 "Operation could not be completed. (NSXMLParserErrorDomain error 5.)" 2009-10-14 22:08:17.270 MyApp[288:207] Operation could not be completed. (NSXMLParserErrorDomain error 5.)

    Read the article

  • [.NET Performance Counter] "System.ComponentModel.Win32Exception: Access is denied" is thrown when c

    - by Ricky
    Hi guys: Calling PerformanceCounterCategory.Create() below on my machine thorws out this exception: System.ComponentModel.Win32Exception: Access is denied Do you know what's the issue about it? Thank you! if (!PerformanceCounterCategory.Exists("MyCategory")) { CounterCreationDataCollection counters = new CounterCreationDataCollection(); CounterCreationData avgDurationBase = new CounterCreationData(); avgDurationBase.CounterName = "average time per operation base"; avgDurationBase.CounterHelp = "Average duration per operation execution base"; avgDurationBase.CounterType = PerformanceCounterType.AverageBase; counters.Add(avgDurationBase); // create new category with the counters above PerformanceCounterCategory.Create("MyCategory", "Sample category for Codeproject", PerformanceCounterCategoryType.SingleInstance, counters); }

    Read the article

  • SQL Server deadlocks between select/update or multiple selects

    - by RobW
    All of the documentation on SQL Server deadlocks talks about the scenario in which operation 1 locks resource A then attempts to access resource B and operation 2 locks resource B and attempts to access resource A. However, I quite often see deadlocks between a select and an update or even between multiple selects in some of our busy applications. I find some of the finer points of the deadlock trace output pretty impenetrable but I would really just like to understand what can cause a deadlock between two single operations. Surely if a select has a read lock the update should just wait before obtaining an exclusive lock and vice versa? This is happening on SQL Server 2005 not that I think this makes a difference.

    Read the article

  • ReportBuilder.application fails on my PC - but works on localhost

    - by JayTee
    We're running SQL 2005 on Win2K3 server and are using SSRS. Here's the situation: I can run Report Builder from localhost My coworker can run Report Builder on his Vista computer Another coworker can run Report Builder on his XP SP3 computer (IE7) I can NOT run Report Builder on my XP SP3 computer (IE7) I'm told that it could be anything from an errant registry entry to a group policy problem. Here is what I've tried: Put the site into "Trusted Sites" with "low" security re-install .NET create a new local user account and attempt to run it The results? Every single time, I get a dialog box: "Application cannot be started. Contact the application vendor" I click the details button and get this: PLATFORM VERSION INFO Windows : 5.1.2600.196608 (Win32NT) Common Language Runtime : 2.0.50727.3607 System.Deployment.dll : 2.0.50727.3053 (netfxsp.050727-3000) mscorwks.dll : 2.0.50727.3607 (GDR.050727-3600) dfdll.dll : 2.0.50727.3053 (netfxsp.050727-3000) dfshim.dll : 2.0.50727.3053 (netfxsp.050727-3000) SOURCES Deployment url : http://www.example.com/ReportServer/ReportBuilder/ReportBuilder.application Server : Microsoft-IIS/6.0 X-Powered-By : ASP.NET X-AspNet-Version: 2.0.50727 IDENTITIES Deployment Identity : ReportBuilder.application, Version=9.0.3042.0, Culture=neutral, PublicKeyToken=c3bce3770c238a49, processorArchitecture=msil APPLICATION SUMMARY * Online only application. * Trust url parameter is set. ERROR SUMMARY Below is a summary of the errors, details of these errors are listed later in the log. * Activation of http://www.example.com/ReportServer/ReportBuilder/ReportBuilder.application resulted in exception. Following failure messages were detected: + Value does not fall within the expected range. COMPONENT STORE TRANSACTION FAILURE SUMMARY No transaction error was detected. WARNINGS There were no warnings during this operation. OPERATION PROGRESS STATUS * [4/7/2010 2:53:57 PM] : Activation of http://www.example.com/ReportServer/ReportBuilder/ReportBuilder.application has started. * [4/7/2010 2:53:58 PM] : Processing of deployment manifest has successfully completed. ERROR DETAILS Following errors were detected during this operation. * [4/7/2010 2:53:58 PM] System.ArgumentException - Value does not fall within the expected range. - Source: System.Deployment - Stack trace: at System.Deployment.Application.NativeMethods.CorLaunchApplication(UInt32 hostType, String applicationFullName, Int32 manifestPathsCount, String[] manifestPaths, Int32 activationDataCount, String[] activationData, PROCESS_INFORMATION processInformation) at System.Deployment.Application.ComponentStore.ActivateApplication(DefinitionAppId appId, String activationParameter, Boolean useActivationParameter) at System.Deployment.Application.SubscriptionStore.ActivateApplication(DefinitionAppId appId, String activationParameter, Boolean useActivationParameter) at System.Deployment.Application.ApplicationActivator.Activate(DefinitionAppId appId, AssemblyManifest appManifest, String activationParameter, Boolean useActivationParameter) at System.Deployment.Application.ApplicationActivator.PerformDeploymentActivation(Uri activationUri, Boolean isShortcut, String textualSubId, String deploymentProviderUrlFromExtension, BrowserSettings browserSettings, String& errorPageUrl) at System.Deployment.Application.ApplicationActivator.ActivateDeploymentWorker(Object state) COMPONENT STORE TRANSACTION DETAILS * Transaction at [4/7/2010 2:53:58 PM] + System.Deployment.Internal.Isolation.StoreOperationSetDeploymentMetadata - Status: Set - HRESULT: 0x0 + System.Deployment.Internal.Isolation.StoreTransactionOperationType (27) - HRESULT: 0x0 I'm really at a loss. I'm certain there is something on my PC preventing the application from running - but I just don't know what. Google hasn't been much of a help because most problems are related to the server configuration (which I know is correct since it works on other PCs) Help me, Overflow Kenobi, you're my only hope..

    Read the article

  • SyncFramework upgrade from 1.0 to 2.0 Sql Server CE database change tracking issue

    - by Andronicus
    I'm trying to upgrade an application that uses Sync Framework 1.0 to synchronise a SqlServerCe database with SqlServer 2005. On the client, the existing database already has change tracking enabled, but when the sync is initiated SyncFramework 2.0 fails to find the last Sync Received anchor and then tries to re=initialize the Change tracking, which fails. I get the exception... {System.Exception} = {"The specified change tracking operation is not supported. To carry out this operation on the table, disable the change tracking on the table, and enable the change tracking."} It seems like all I can do is delete the local database and recreate it. Which is not a great solution for us, since some of the data in the clients database is not synced with the server, and our users would prefer not to loose this data in the upgrade. Is there any reason why SyncFramework 2.0 cannot locate the existing Last received sync anchor?

    Read the article

  • Serializing data using IEnumerable<T> with WebGet

    - by Jim
    possible duplicate: Cannot serialize parameter of type ‘System.Linq.Enumerable… ’ when using WCF, LINQ, JSON Hi, If my method signiature looks like this, it works fine. [WebGet] MyClass[] WebMethod() If the signiature looks like this [WebGet] IEnumerable<T> WebMethod() I get the following error: Cannot serialize parameter of type 'X.Y.Z.T+<WebMethod>d__2c' (for operation 'WebMethod', contract 'IService') because it is not the exact type 'System.Collections.Generic.IEnumerable`1[X.Y.Z.T]' in the method signature and is not in the known types collection. In order to serialize the parameter, add the type to the known types collection for the operation using ServiceKnownTypeAttribute. I have tried adding. ServiceKnownType(typeof(IEnumerable)) Same error. Is this a bug in 2010 beta 2, or is this likely to be correct going forward? Thanks

    Read the article

  • Unlocking SVN working copy with unversioned resources

    - by Vijay Dev
    I have a repository which contains some unversioned directories and files. The server running svn was recently changed and since the checkout was done using the url svn://OLD-IP, I relocated my svn working copy, this time to the url svn://NEW-DOMAIN-NAME. Now since there are some unversioned resources, the switch did not happen properly and the working copy got locked. A cleanup operation did not work either because of these unversioned resources. I looked up in the net and found about svn ignore and tried that but to no use. I am unable to release all locks. Any ideas on solving the problem? Once I release the locks, I believe I can use svn ignore and carry on the relocate operation.

    Read the article

  • SSL Domain Error in IPhone- https connection

    - by Krishnan
    Hi All, I am using CFNetwork to connect to a https webservice , whose server is a Verisign certified. I get the appropriate response from the server some times. But the rest of the time I am getting two kind of errors. 1."Operation could not be completed. (kCFStreamErrorDomainSSL error -9807.) 2."Operation could not be completed. (kCFStreamErrorDomainSSL error -4.)" I am using SDK 3.0 and tested it in 3.1 also. I don't get a consistent result. Please some one help me to solve the issue. Regards, Krishnan

    Read the article

  • Multi-threading mechanisms to run some lengthy operations from winforms code and communication with

    - by tmarouda
    What do I want to achieve: I want to perform some time consuming operations from my MDI winforms application (C# - .NET). An MDI child form may create the thread with the operation, which may take long time (from 0.1 seconds, to even half hour) to complete. In the meantime I want the UI to respond to user actions, including manipulation of data in some other MDI child form. When the operation completes, the thread should notify the MDI child that the calculations are done, so that the MDI child can perform the post-processing. How can I achieve this: Should I use explicit threading (i.e., create explicit threads), thread pools? Or simply just propose your solution. Should I create foreground or background threads? And how does the thread communicates with the GUI, according the solution you propose? If you know of a working example that handles a similar situation, please make a note.

    Read the article

  • Image Application in WPF and Perfomance.

    - by Harsha
    Hello All, I am planning to build Image processing application using WPF. Brightness /Contrast and Histogram are main operation of this application. I have downloaded the application " Foundations: Bitmaps and Pixel Bits" from http://msdn.microsoft.com/en-us/magazine/cc534995.aspx . But when I tried to open the images which are more than 1200x1600, It is very slow. How to increase the performance. Is any one worked on Image processing in WPF. Please suggest me how to solve this perfomance issue in WPF for image(more than 1600x1200) operation. Thanks you, Harsha

    Read the article

  • ASP.NET / WCF - Execute Server.Execute Asynchronously

    - by user208662
    Hello, I need to run the HttpContext.Current.Server.Execute method in my ASP.NET application. This application has a WCF operation that does some processing. Currently, I am to do my processing correctly from within my WCF operation. However, I would like to do this asynchronously. In an error to attempt this asynchronously, I tried running Server.Execute in the DoWork event handler of a BackgroundWorker. Unfortunately, this throws an error that says "object reference not set to an instance of an object" The HttpContext element is not null. I checked that. It is some property nested in the HttpContext object that appears to be null. However, I have not been able to identify why this won't work. It happens as soon as I move the processing to the BackgroundWorker thread. My question is, how can I asynchronously execute the Server.Execute method? Thank you,

    Read the article

  • Filtering MySQL query result according to a interval of timestamp

    - by celalo
    Let's say I have a very large MySQL table with a timestamp field. So I want to filter out some of the results not to have too many rows because I am going to print them. Let's say the timestamps are increasing as the number of rows increase and they are like every one minute on average. (Does not necessarily to be exactly once every minute, ex: 2010-06-07 03:55:14, 2010-06-07 03:56:23, 2010-06-07 03:57:01, 2010-06-07 03:57:51, 2010-06-07 03:59:21 ...) As I mentioned earlier I want to filter out some of the records, I do not have specific rule to do that, but I was thinking to filter out the rows according to the timestamp interval. After I achieve filtering I want to have a result set which has a certain amount of minutes between timestamps on average (ex: 2010-06-07 03:20:14, 2010-06-07 03:29:23, 2010-06-07 03:38:01, 2010-06-07 03:49:51, 2010-06-07 03:59:21 ...) Last but not least, the operation should not take incredible amount of time, I need this functionality to be almost fast as a normal select operation. Do you have any suggestions?

    Read the article

  • Exceptions using CruiseControl.NET

    - by Andy
    I recently updated to CC.NET 1.5 and I'm now getting some strange exceptions. On one project I get: - ThoughtWorks.CruiseControl.Core.CruiseControlException: Source control operation failed: svn: Can't create a character converter from native encoding to 'UTF-8' This happens when CC is checking a subversion repository for any mods. If I run the actual command line CC says is failing it works and returns an empty XML (there are no mods). Some other projects also fail to check mods with another "Source control operation failed" exception but no further info. Again the command is an "svn log" which when run from command line works ok. I'm using subversion 1.4.5 client side and my source repository exists on a separate box than my build server. Anyone got any ideas?

    Read the article

< Previous Page | 52 53 54 55 56 57 58 59 60 61 62 63  | Next Page >