Search Results

Search found 45324 results on 1813 pages for 'open source'.

Page 576/1813 | < Previous Page | 572 573 574 575 576 577 578 579 580 581 582 583  | Next Page >

  • C# file Decryption - Bad Data

    - by Jon
    Hi all, I am in the process of rewriting an old application. The old app stored data in a scoreboard file that was encrypted with the following code: private const String SSecretKey = @"?B?n?Mj?"; public DataTable GetScoreboardFromFile() { FileInfo f = new FileInfo(scoreBoardLocation); if (!f.Exists) { return setupNewScoreBoard(); } DESCryptoServiceProvider DES = new DESCryptoServiceProvider(); //A 64 bit key and IV is required for this provider. //Set secret key For DES algorithm. DES.Key = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Set initialization vector. DES.IV = ASCIIEncoding.ASCII.GetBytes(SSecretKey); //Create a file stream to read the encrypted file back. FileStream fsread = new FileStream(scoreBoardLocation, FileMode.Open, FileAccess.Read); //Create a DES decryptor from the DES instance. ICryptoTransform desdecrypt = DES.CreateDecryptor(); //Create crypto stream set to read and do a //DES decryption transform on incoming bytes. CryptoStream cryptostreamDecr = new CryptoStream(fsread, desdecrypt, CryptoStreamMode.Read); DataTable dTable = new DataTable("scoreboard"); dTable.ReadXml(new StreamReader(cryptostreamDecr)); cryptostreamDecr.Close(); fsread.Close(); return dTable; } This works fine. I have copied the code into my new app so that I can create a legacy loader and convert the data into the new format. The problem is I get a "Bad Data" error: System.Security.Cryptography.CryptographicException was unhandled Message="Bad Data.\r\n" Source="mscorlib" The error fires at this line: dTable.ReadXml(new StreamReader(cryptostreamDecr)); The encrypted file was created today on the same machine with the old code. I guess that maybe the encryption / decryption process uses the application name / file or something and therefore means I can not open it. Does anyone have an idea as to: A) Be able explain why this isn't working? B) Offer a solution that would allow me to be able to open files that were created with the legacy application and be able to convert them please? Thank you

    Read the article

  • WPF resource merged to Application.Resources but not resolved at runtime

    - by arconaut
    I have a brush that is part of a ResourceDictionary that is merged to Application.Resources. But for some reason it's not resolved at runtime when a style is being applied to one of the controls. However, if I call Application.Current.FindResource("BrushName") from the Immediate Window at the time when exception is thrown, the resource is found. Am I missing something? Isn't WPF supposed to try to look for the resource in the app's resources? UPDATE The application is quite big, so I can't post all actual code but here's the way the resources are merged and used: Brushes.xaml <ResourceDictionary ...> <SolidColorBrush x:Key="BrushName" Color="#12345678" /> <\ResourceDictionary> SomeStyles.xaml <ResourceDictionary ...> <Style x:Key="SomeStyle"> <Setter Property="SomeProperty" Value="{StaticResource BrushName}" /> </Style> </ResourceDictionary> App.xaml <Application ...> <Application.Resources> <ResourceDictionary> <ResourceDictionary.MergedDictionaries> <ResourceDictionary Source="Brushes.xaml" /> <ResourceDictionary Source="SomeStyles.xaml" /> </ResourceDictionary.MergedDictionaries> </ResourceDictionary> </Application.Resources> </Application ...> And then some control might use the style using the resource like this: ... Style={StaticResource SomeStyle} ...

    Read the article

  • known memory leaks in 3ds max?

    - by Denise
    I've set up a script in 3ds max to render a bunch of animations into frames. To do this, I open up a file with all of the materials, load an animation (as a bip) onto the figure, then render. We were seeing a problem where eventually the script would fail because it was unable to open the next file-- max had consumed all of the system memory. Closing max, of course, freed the memory, and we were able to continue with the script. I checked out the heapfree variable, hoping to see a memory leak within my script, hoping to see a memory leak within my own (maxscript) code-- but the amount of free space was the same after every animation. Then, it must be 3ds max which is consuming all of that memory. Nothing in max need be saved from animation to animation-- is there some way to get max to free that memory? (I've tried resetMaxFile() and manually deleting all of the objects in the scene). Is there any known sets of operations that cause max to grow out of control?

    Read the article

  • WCF Service Layer in n-layered application: performance considerations

    - by Marconline
    Hi all. When I went to University, teachers used to say that in good structured application you have presentation layer, business layer and data layer. This is what I heard for more than 5 years. When I started working I discovered that this is true but sometimes is better to have more than just three layers. Two or three days ago I discovered this article by John Papa that explain how to use Entity Framework in layered application. According to that article you should have: UI Layer and Presentation Layer (Model View Pattern) Service Layer (WCF) Business Layer Data Access Layer Service Layer is, to me, one of the best ideas I've ever heard since I work. Your UI is then completely "diconnected" from Business and Data Layer. Now when I went deeper by looking into provided source code, I began to have some questions. Can you help me in answering them? Question #0: is this a good enterpise application template in your opinion? Question #1: where should I host the service layer? Should it be a Windows Service or what else? Question #2: in the source code provided the service layer expose just an endpoint with WSHttpBinding. This is the most interoperable binding but (I think) the worst in terms of performances (due to serialization and deserializations of objects). Do you agree? Question #3: if you agree with me at Question 2, which kind of binding would you use? Looking forward to hear from you. Have a nice weekend! Marco

    Read the article

  • RuntimeException from xmlbeans - can't find compiled schema

    - by findango
    I'm getting a RuntimeException while executing some code that depends on generated xmlbeans classes. I can't figure out if this is: me missing something during code-generation or packaging a runtime dependency missing a misleading error message, and I should be looking elsewhere. The xbean.jar version is the same in the build and execution environment. Anyone seen this before or have any ideas? Thanks. ...snip... Caused by: java.lang.RuntimeException: Could not instantiate SchemaTypeSystemImpl (java.lang.reflect.InvocationTargetException): is the version of xbean.jar correct? at schemaorg_apache_xmlbeans.system.s2B8331230CBD98F4933B0B025B6BF726.TypeSystemHolder.loadTypeSystem(Unknown Source) at schemaorg_apache_xmlbeans.system.s2B8331230CBD98F4933B0B025B6BF726.TypeSystemHolder.(Unknown Source) ... 38 more Caused by: java.lang.reflect.InvocationTargetException at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:39) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:27) at java.lang.reflect.Constructor.newInstance(Constructor.java:494) ... 40 more Caused by: org.apache.xmlbeans.SchemaTypeLoaderException: XML-BEANS compiled schema: Could not locate compiled schema resource schemaorg_apache_xmlbeans/system/s2B8331230CBD98F4933B0B025B6BF726/index.xsb (schemaorg_apache_xmlbeans.system.s2B8331230CBD98F4933B0B025B6BF726.index) - code 0 at org.apache.xmlbeans.impl.schema.SchemaTypeSystemImpl$XsbReader.(SchemaTypeSystemImpl.java:1504) at org.apache.xmlbeans.impl.schema.SchemaTypeSystemImpl.initFromHeader(SchemaTypeSystemImpl.java:260) at org.apache.xmlbeans.impl.schema.SchemaTypeSystemImpl.(SchemaTypeSystemImpl.java:183) ... 44 more ...snip...

    Read the article

  • Indy IdSMTP and attachments in Thunderbird

    - by Lobuno
    Hello! Using the latest snapshot of Indy tiburon on D2010. A very simple project like: var stream: TFileStream; (s is TidSMTP and m is TidMessage) begin s.Connect; Stream := TFileStream.Create('c:\Test.zip', fmOpenRead or fmShareExclusive); try with TIdAttachmentMemory.Create(m.MessageParts, Stream) do begin ContentType := 'application/x-zip-compressed'; Name := ExtractFilePath('C:\'); //' FileName := 'Test.zip'; end; finally FreeAndNil(Stream); end; s.Send(m); s.Disconnect(); end; Everything works Ok in Outlook, The bat!, OE, yahoo, etc... but in Thunderbird the attachment is not shown. Looking at the source of the message in Thunderbird, the attachment is there. The only difference I can find between messages send by indy and other clients is that Indy messages have this order: Content-Type: multipart/mixed; boundary="Z\=_7oeC98yIhktvxiwiDTVyhv9R9gwkwT1" MIME-Version: 1.0 while any other clients have the order: MIME-Version: 1.0 Content-Type: multipart/mixed; boundary="Z\=_7oeC98yIhktvxiwiDTVyhv9R9gwkwT1" Don't know if THAT is the source of the problem, but if so: is this a bug on Thunderbird or is this a problem with indy which "malforms" the headers of the messages? Is this order a problem? Does that matter anyway?

    Read the article

  • Why isn't my assets folder being installed on emulator?

    - by Brad Hein
    Where are my assets being installed to? I utilize an assets folder in my new app. I have two files in the folder. When I install my app on the emulator, I cannot access my assets, and furthermore I cannot see them on the emulator filesystem. Extracted my apk and confirmed the assets folder exists: $ ls -ltr assets/ total 16 -rw-rw-r--. 1 brad brad 1050 2010-05-20 00:33 schema-DashDB.sql -rw-rw-r--. 1 brad brad 9216 2010-05-20 00:33 dash.db On the emulator, no assets folder: # pwd /data/data/com.gtosoft.dash # ls -l drwxr-xr-x system system 2010-05-20 00:46 lib # I just want to package a pre-built database with my app and then open it to obtain data when needed. Just tried it on my Moto Droid, unable to access/open the DB, just like the emulator: DBFile=/data/data/com.gtosoft.dash/assets/dash.db Building the DB on the fly from a schema file is out of the question because its such a slow process (about 5-10 statements per second is all I get for throughput).

    Read the article

  • jquery boxy plugin: prevent multiple instances of the same dialog when clicking the link multiple ti

    - by Lyon
    Hi, I'm using the Boxy jQuery plugin to open dialog windows and populating it through ajax. http://onehackoranother.com/projects/jquery/boxy/ Here's my code so far: $("a.create").click(function (e) { url = $(e.target).attr('href'); Boxy.load(url, {title:'Test'}); }); This opens up a dialog alright. However, if I click the link again, another dialog will open. How can I make it such that the previously opened Boxy dialog will come into focus? I only want one instance of this dialog. I tried assigning a variable to var ele = Boxy.load(); but the variable ele returns undefined... Alas, I can't make out much from the limited Boxy documentation available. Enabling the option modal: true would prevent the user from clicking on the link multiple times, but I don't want the overlay to show. Thanks for any light you can shed on this. -Lyon

    Read the article

  • WPF Update Binding when Bound directly to DataContext w/ Converter

    - by Adam
    Normally when you want a databound control to 'update,' you use the "PropertyChanged" event to signal to the interface that the data has changed behind the scenes. For instance, you could have a textblock that is bound to the datacontext with a property "DisplayText" <TextBlock Text="{Binding Path=DisplayText}"/> From here, if the DataContext raises the PropertyChanged event with PropertyName "DisplayText," then this textblock's text should update (assuming you didn't change the Mode of the binding). However, I have a more complicated binding that uses many properties off of the datacontext to determine the final look and feel of the control. To accomplish this, I bind directly to the datacontext and use a converter. In this case I am working with an image source. <Image Source="{Binding Converter={StaticResource ImageConverter}}"/> As you can see, I use a {Binding} with no path to bind directly to the datacontext, and I use an ImageConverter to select the image I'm looking for. But now I have no way (that I know of) to tell that binding to update. I tried raising the propertychanged event with "." as the propertyname, which did not work. Is this possible? Do I have to wrap up the converting logic into a property that the binding can attach to, or is there a way to tell the binding to refresh (without explicitly refreshing the binding)? Any help would be greatly appreciated. Thanks! -Adam

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Python urllib.urlopen IOError

    - by Michael
    So I have the following lines of code in a function sock = urllib.urlopen(url) html = sock.read() sock.close() and they work fine when I call the function by hand. However, when I call the function in a loop (using the same urls as earlier) I get the following error: > Traceback (most recent call last): File "./headlines.py", line 256, in <module> main(argv[1:]) File "./headlines.py", line 37, in main write_articles(headline, output_folder + "articles_" + term +"/") File "./headlines.py", line 232, in write_articles print get_blogs(headline, 5) File "/Users/michaelnussbaum08/Documents/College/Sophmore_Year/Quarter_2/Innovation/Headlines/_code/get_content.py", line 41, in get_blogs sock = urllib.urlopen(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 87, in urlopen return opener.open(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 203, in open return getattr(self, name)(url) File "/System/Library/Frameworks/Python.framework/Versions/2.6/lib/python2.6/urllib.py", line 314, in open_http if not host: raise IOError, ('http error', 'no host given') IOError: [Errno http error] no host given Any ideas?

    Read the article

  • Binding an ASP.NET GridView Control to a string array

    - by Michael Kniskern
    I am trying to bind an ASP.NET GridView control to an string array and I get the following item: A field or property with the name 'Item' was not found on the selected data source. What is correct value I should use for DataField property of the asp:BoundField column in my GridView control. Here is my source code: ASPX page <asp:GridView ID="MyGridView" runat="server" AutoGenerateColumns="false"> <Columns> <asp:BoundField DataField="Item" /> <asp:CommandField ButtonType="Link" ShowSelectButton="true" SelectText="Click Me!" /> </Columns> </asp:GridView> Code Behind: string[] MyArray = new string[1]; MyArray[0] = "My Value"; MyGridView.DataSource = MyArray; MyGridView.DataBind(); UPDATE I need to have the AutoGenerateColumns attribute set to false because I need to generate additional asp:CommandField columns. I have updated my code sample to reflect this scenarion

    Read the article

  • Currency exchange rates for paypal

    - by Jacco
    Does anyone know a way to get the currency exchange rates for paypal? We have custom shopping cart and use Paypal (Website Payments Standard) to handle payments. Our 'home' currency is Euro, but we would like to present our customers the option to pay in different currencies (USD, CAD, AUD and GBP). PayPal offers the option to:     a) automatically convert our Euro quoted prices to, for example, USD upon checkout     b) checkout in USD directly With option a): We get paid in Euro, the customer pays for the currency exchange (good). The customer does not know what he/she is going to be charged in USD until checkout. (bad) With option b) The customer pays in USD, then the currency is converted into EUR and we pay the the currency exchange. The customer never has to worry about the different currencies (excellent) We do not know the exchange rate PayPal is going to use so we cannot quote the correct prices to our customer (showstopper) So my question is:   Does anybody know a way to get the PayPal exchange rates? or   Does anybody know how to make a good estimate? Update: PayPal updates it's exchange rate 2 times a day. (at least, that is what they state). They use the Interbank Exchange Rate provided by ??? and add a 2.5% spread above this rate to determine their retail foreign exchange rates. Unforunately, there the Interbank Exchange Rates vary from source to source and from minute to minute. We have been monitoring the PayPal exchange rates and cross referenced them with the Official reference rates provides by the European Central Bank. the results vary widely, somewhere from 1 to 6 ! percent...

    Read the article

  • 'Hot code replace' not working -- Eclipse doesn't change any code on JBoss

    - by Bernhard V
    Hello, fellow visitors! I'm currently experiencing a problem with 'hot code replace' not working on Eclipse Galileo and JBoss 4.2.3. Among other applications I'm running an exploded Java WAR on my local JBoss. The project from which it is build is managed by Maven. I build the project using the Maven goal war:exploded and then I copy that directory to JBoss with an ANT script. When I'm now running the application and set a breakpoint anywhere in the code, Eclipse properly halts at that line in the debug mode. But when I'm making a change to the source file and save it, Eclipse doesn't apply this change to the JBoss. For example, when I make a normal code line into a comment, the debugger still steps over this comment as if it was regular Java code. Or when I remove a line, the debugger seems to get out of sync with the file and starts stepping over parenthesis. But I'm not getting any 'hot code replace error'-messages either. It seems to me that Eclipse applies the changes to the source files, but doesn't apply it to the JBoss. Are there any special preferences that have to be turned on in order to make hot code replace work? Or are there any mistakes in how I build and deploy the application to the JBoss? I'd appreciate your help very much. Thank you. Bernhard V

    Read the article

  • C++ JSON parser

    - by pollux
    Dear reader, I'm working on a twitter client which uses the twitter streaming json api. Twitter advices JSON as XML version is deprecated. I'm looking for a good JSON parser which can parse the json data below. I'm receiving this JSON which I want to be able to read/parse using a JSON parser. { "in_reply_to_status_id": null, "text": "Home-plate umpire Crawford gets stung http://tinyurl.com/27ujc86", "favorited": false, "coordinates": null, "in_reply_to_user_id": null, "source": "<a href=\"http://apiwiki.twitter.com/\" rel=\"nofollow\">API</a>", "geo": null, "created_at": "Fri Jun 18 15:12:06 +0000 2010", "place": null, "user": { "profile_text_color": "333333", "screen_name": "HostingViral", "time_zone": "Pacific Time (US & Canada)", "url": "http://bit.ly/1Way7P", "profile_link_color": "228235", "profile_background_image_url": "http://s.twimg.com/a/1276654401/images/themes/theme14/bg.gif", "description": "Full time Internet Marketer - Helping other reach their Goals\r\nhttp://wavemarker.com", "statuses_count": 1944, "profile_sidebar_fill_color": "c7b7c7", "profile_background_tile": true, "contributors_enabled": false, "lang": "en", "notifications": null, "created_at": "Wed Dec 30 07:50:52 +0000 2009", "profile_sidebar_border_color": "120412", "following": null, "geo_enabled": false, "followers_count": 2485, "protected": false, "friends_count": 2495, "location": "Working at Home", "name": "Johnathan Thomas", "verified": false, "profile_background_color": "131516", "profile_image_url": "http://a1.twimg.com/profile_images/600114776/nessykalvo421_normal.jpg", "id": 100439873, "utc_offset": -28800, "favourites_count": 0 }, "in_reply_to_screen_name": null, "id": 16477056501, "contributors": null, "truncated": false } *This is the raw string (above it beautified) * {"in_reply_to_status_id":null,"text":"Home-plate umpire Crawford gets stung http://tinyurl.com/27ujc86","favorited":false,"coordinates":null,"in_reply_to_user_id":null,"source":"<a href=\"http://apiwiki.twitter.com/\" rel=\"nofollow\">API</a>","geo":null,"created_at":"Fri Jun 18 15:12:06 +0000 2010","place":null,"user":{"profile_text_color":"333333","screen_name":"HostingViral","time_zone":"Pacific Time (US & Canada)","url":"http://bit.ly/1Way7P","profile_link_color":"228235","profile_background_image_url":"http://s.twimg.com/a/1276654401/images/themes/theme14/bg.gif","description":"Full time Internet Marketer - Helping other reach their Goals\r\nhttp://wavemarker.com","statuses_count":1944,"profile_sidebar_fill_color":"c7b7c7","profile_background_tile":true,"contributors_enabled":false,"lang":"en","notifications":null,"created_at":"Wed Dec 30 07:50:52 +0000 2009","profile_sidebar_border_color":"120412","following":null,"geo_enabled":false,"followers_count":2485,"protected":false,"friends_count":2495,"location":"Working at Home","name":"Johnathan Thomas","verified":false,"profile_background_color":"131516","profile_image_url":"http://a1.twimg.com/profile_images/600114776/nessykalvo421_normal.jpg","id":100439873,"utc_offset":-28800,"favourites_count":0},"in_reply_to_screen_name":null,"id":16477056501,"contributors":null,"truncated":false} I've tried multiple JSON parsers from json.org though I've tried 4 now and can't find one which can parse above json. Kind regards, Pollux

    Read the article

  • dynamically create class in scala, should I use interpreter?

    - by Phil
    Hi, I want to create a class at run-time in Scala. For now, just consider a simple case where I want to make the equivalent of a java bean with some attributes, I only know these attributes at run time. How can I create the scala class? I am willing to create from scala source file if there is a way to compile it and load it at run time, I may want to as I sometimes have some complex function I want to add to the class. How can I do it? I worry that the scala interpreter which I read about is sandboxing the interpreted code that it loads so that it won't be available to the general application hosting the interpreter? If this is the case, then I wouldn't be able to use the dynamically loaded scala class. Anyway, the question is, how can I dynamically create a scala class at run time and use it in my application, best case is to load it from a scala source file at run time, something like interpreterSource("file.scala") and its loaded into my current runtime, second best case is some creation by calling methods ie. createClass(...) to create it at runtime. Thanks, Phil

    Read the article

  • Can you review my Perl rewrite of Cucumber?

    - by Evgeny
    There is a team working on acceptance testing X11 GUI application in our company, and they created a monstrous acceptance testing framework that drives the GUI as well as running scenarios. The framework is written using Perl 5, and scenario files look more like very complex Perl programs (thousands of lines long with procedural-programming style) than acceptance tests. I recently learned Ruby's Cucumber, and generally have been using Ruby for quite a lot of time. But unfortunately I can't just shove Ruby to replace Perl because the people who are writing all of this don't know Ruby and it's quite certain that they wont want "this" kind of interruption. So to bring Ruby's Cucumber a bit closer to their work, I rewrote it using Perl 5. Unfortunately I am really not a Perl programmer, and would love to get a code review and to hear suggestions from people who both know Perl and Cucumber. Hi Perl/Cucumber StackOverflow users - please help me create this "open source" attempt to re-create Cucumber for Perl! I would love to hear your comments and will accept any acceptable help. The minimal source code is here: http://github.com/kesor/p5-cucumber Thank you for your attention. For those not familiar with cucumber - please take just one small moment to take a look at this one small little page: http://wiki.github.com/aslakhellesoy/cucumber

    Read the article

  • How to check if a generic type definition inherits from another generic type definition

    - by Anne
    I'm trying to check whether an open generic type definition implements some open generic interface. Look at the sample below: public interface IService<T> { } public class ServiceImpl<T> : IService<T> { } private static bool OpenGenericTypeImplementsOpenGenericInterface( Type derivedType, Type interfaceType) { return derivedType.GetInterfaces().Contains(interfaceType); } [TestMethod] public void Verify() { Type openGenericImplementation = typeof(ServiceImpl<>); Type expectedInterfaceType = typeof(IService<>); bool implDoesImplementInterface = OpenGenericTypeImplementsOpenGenericInterface( openGenericImplementation, expectedInterfaceType); // This assert fails. Why? Assert.IsTrue(implDoesImplementInterface); } I found out that the returned type from the Type.GetInterfaces() method does not match the type returned from typeof(IService<>). I can't figure out why that is and how to correctly validate whether some generic type definition inherits or implements some other generic type definition. What's going on here and how do I solve fix this problem?

    Read the article

  • help with grouping and sorting for TreeView in xaml

    - by danhotb
    I am having problems getting my head around grouping and sorting in xaml and hope someone can get me straightened out! I have creaed an xml file from a tree of files and folders (just like windows explorer) that can be serveral levels deep. I have bound a TreeView control to an xml datasource and it works great! It sorts everything alphabetically but ... I would like it to sort all folders first then all files, rather than folders listed with files, as it does now. the xml : if you load this to a treeviw it will display the two files before the folder because they are first in alpha-order. here is my code: <!-- This will contain the XML-data. --> <XmlDataProvider x:Key="xmlDP" XPath="*"> <x:XData> <Select_Project /> </x:XData> </XmlDataProvider> <!-- This HierarchicalDataTemplate will visualize all XML-nodes --> <HierarchicalDataTemplate DataType="project" ItemsSource ="{Binding}"> <TextBlock Text="{Binding XPath=@name}" /> </HierarchicalDataTemplate> <HierarchicalDataTemplate DataType="folder" ItemsSource ="{Binding}"> <TextBlock Text="{Binding XPath=@name}" /> </HierarchicalDataTemplate> <HierarchicalDataTemplate DataType="file" ItemsSource ="{Binding}"> <TextBlock Text="{Binding XPath=@name}" /> </HierarchicalDataTemplate> <CollectionViewSource x:Key="projectView" Source="{StaticResource xmlDP}"> <CollectionViewSource.SortDescriptions> <!-- ADD SORT DESCRIPTION HERE --> </CollectionViewSource.SortDescriptions> </CollectionViewSource> <TreeView Margin="11,79.992,18,19.089" Name="tvProject" BorderThickness="1" FontSize="12" FontFamily="Verdana"> <TreeViewItem ItemsSource="{Binding Source={StaticResource xmlDP}, XPath=*}" Header="Project"/> </TreeView>

    Read the article

  • Bazaar + CruiseControl.Net

    - by Chris Gill
    I want to setup CruiseControl.Net at my company. We currently have several .net solutions stored in a Bazaar repository and I want to use MSBuild to build each solution. This didn't seem too controversial, but I can't see an easy way of binding CruiseControl.Net to Bazaar. There seems to have been a plugin to do this at http://www.sorn.net/projects/bazaar-ccnet but this link no longer works and I cant seem to find the plugin anywhere else I was going to use the External source control type, but bazaar seems to bork at the GETMODS parameter being passed to it My current thought now is to create a separate project to pull modifications from bazaar using an Exec task, then create another project to run a FileSystem source control check on that directory. I'm moderately sure I can get this to work, but it seems a bit hacky. I don't mind writing a new Bazaar plugin for CruiseControl.Net but I cant find where to start with this. My questions are do you run these two in combination, if so how do you do it? If you don't run these together, do you have any recommendations on a good approach? Is there any documentation or good starting point that I could use to write a bazaar plugin? Am I an idiot for trying to use CruiseControl.Net? Should I be using something else?

    Read the article

  • nested for loop

    - by Gary
    Hello, Just learning Python and trying to do a nested for loop. What I'd like to do in the end is place a bunch of email addresses in a file and have this script find the info, like the sending IP of mail ID. For now i'm testing it on my /var/log/auth.log file Here is my code so far: #!/usr/bin/python # this section puts emails from file(SpamEmail) in to a array(array) in_file = open("testFile", "r") array = in_file.readlines() in_file.close() # this section opens and reads the target file, in this case 'auth.log' log = open("/var/log/auth.log", "r") auth = log.readlines() for email in array: print "Searching for " +email, for line in auth: if line.find(email) > -1: about = line.split() print about[0], print Inside 'testfile' I have the word 'disconnect' cause I know it's in the auth.log file. It just doesn't find the word 'disconnect'. In the line of "if line.find(email) -1:" i can replace email and put "disconnect" the scripts finds it fine. Any idea? Thanks in advance. Gary

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • Internet Explorer 7 Bugs - incorrect display OR dead links

    - by ClarkeyBoy
    Hi, I recently launched a website I have been developing over the past year - http://Live.heritageartpapers.co.uk/. My dad, who owns the company, had a phone call today saying it doesnt display properly in IE7. Bug #1: The header and footer are both in a div, whereas the content is in a table between the two divs. Reportedly the content (table) sometimes (not always, according to IETester) displays below the footer, but the footer still displays where it is supposed to (ie there is a massive gap where the content should fit). Bug #2: When the content does display in the correct place, all the links on the page are dead - click on them and nothing happens. As you can see if you view it in Firefox (the version I am using is 3.6), the links in the left hand menu turn orange on mouseover. However they do not even do this in IE7. Note that they do turn orange and do work if the content is displayed below the footer. I cant see why its happening - according to IETester, the IE7 interpreted source code has all the tags capitalised and many quotes removed (for example for the id attribute on most, if not all, tags) but I doubt this could cause the above bugs, could it? My question is whether anyone has ever seen any of these problems before, and/or has a solution to any of these problems?? I currently do not have the application open, but will post any relevant code in a few minutes. Alternatively just use view source. Many thanks in advance. Regards, Richard Clarke

    Read the article

  • Python for a hobbyist programmer ( a few questions)

    - by Matt
    I'm a hobbyist programmer (only in TI-Basic before now), and after much, much, much debating with myself, I've decided to learn Python. I don't have a ton of free time to teach myself a hundred languages and all programming I do will be for personal use or for distributing to people who need them, so I decided that I needed one good, strong language to be good at. My questions: Is python powerful enough to handle most things that a typical programmer might do in his off-time? I have in mind things like complex stat generators based on user input for tabletop games, making small games, automate install processes, and build interactive websites, but probably a hundred things along those lines Does python handle networking tasks fairly well? Can python source be obscufated (mispelled I think), or is it going to be open-source by nature? The reason I ask this is because if I make something cool and distribute it, I don't want some idiot script kiddie to edit his own name in and say he wrote it And how popular is python, compared to other languages. Ideally, my language would be good and useful with help found online without extreme difficulty, but not so common that every idiot with computer knows python. I like the idea of knowing a slightly obscure language. Thanks a ton for any help you can provide.

    Read the article

  • NETWORK_ERROR: XMLHttpRequest Exception 101

    - by pawan Mangal
    I am getting this Error NETWORK_ERROR: XMLHttpRequest Exception 101 when trying to get XML content from one site. Here is my code var xmlhttp; if(window.XMLHttpRequest) { xmlhttp = new XMLHttpRequest(); } if (xmlhttp==null) { alert ("Your browser does not support XMLHTTP!"); return; } xmlhttp.onReadyStateChange=function() { if(xmlhttp.readyState==4) { var value =xmlhttp.responseXML; alert(value); } } xmlhttp.open("GET",url,false); xmlhttp.send(); //alert(xmlhttp.responseXML); } xmlhttp.open("GET",url,false); xmlhttp.send(null); Does any one have a solution?

    Read the article

< Previous Page | 572 573 574 575 576 577 578 579 580 581 582 583  | Next Page >