Search Results

Search found 45324 results on 1813 pages for 'open source'.

Page 576/1813 | < Previous Page | 572 573 574 575 576 577 578 579 580 581 582 583  | Next Page >

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Can you review my Perl rewrite of Cucumber?

    - by Evgeny
    There is a team working on acceptance testing X11 GUI application in our company, and they created a monstrous acceptance testing framework that drives the GUI as well as running scenarios. The framework is written using Perl 5, and scenario files look more like very complex Perl programs (thousands of lines long with procedural-programming style) than acceptance tests. I recently learned Ruby's Cucumber, and generally have been using Ruby for quite a lot of time. But unfortunately I can't just shove Ruby to replace Perl because the people who are writing all of this don't know Ruby and it's quite certain that they wont want "this" kind of interruption. So to bring Ruby's Cucumber a bit closer to their work, I rewrote it using Perl 5. Unfortunately I am really not a Perl programmer, and would love to get a code review and to hear suggestions from people who both know Perl and Cucumber. Hi Perl/Cucumber StackOverflow users - please help me create this "open source" attempt to re-create Cucumber for Perl! I would love to hear your comments and will accept any acceptable help. The minimal source code is here: http://github.com/kesor/p5-cucumber Thank you for your attention. For those not familiar with cucumber - please take just one small moment to take a look at this one small little page: http://wiki.github.com/aslakhellesoy/cucumber

    Read the article

  • WPF resource merged to Application.Resources but not resolved at runtime

    - by arconaut
    I have a brush that is part of a ResourceDictionary that is merged to Application.Resources. But for some reason it's not resolved at runtime when a style is being applied to one of the controls. However, if I call Application.Current.FindResource("BrushName") from the Immediate Window at the time when exception is thrown, the resource is found. Am I missing something? Isn't WPF supposed to try to look for the resource in the app's resources? UPDATE The application is quite big, so I can't post all actual code but here's the way the resources are merged and used: Brushes.xaml <ResourceDictionary ...> <SolidColorBrush x:Key="BrushName" Color="#12345678" /> <\ResourceDictionary> SomeStyles.xaml <ResourceDictionary ...> <Style x:Key="SomeStyle"> <Setter Property="SomeProperty" Value="{StaticResource BrushName}" /> </Style> </ResourceDictionary> App.xaml <Application ...> <Application.Resources> <ResourceDictionary> <ResourceDictionary.MergedDictionaries> <ResourceDictionary Source="Brushes.xaml" /> <ResourceDictionary Source="SomeStyles.xaml" /> </ResourceDictionary.MergedDictionaries> </ResourceDictionary> </Application.Resources> </Application ...> And then some control might use the style using the resource like this: ... Style={StaticResource SomeStyle} ...

    Read the article

  • My SqlComand on SSIS - DataFlow OLE DB Command seems not works

    - by Angel Escobedo
    Hello Im using OLE DB Source for get rows from a dBase IV file and it works, then I split the data and perform a group by with aggregate component. So I obtain a row with two columns with "null" value : CompanyID | CompanyName | SubTotal | Tax | TotalRevenue Null Null 145487 27642.53 173129.53 this success because all rows have been grouped with out taking care about the firsts columns and just Summing the valuable columns, so I need to change that null for default values as CompanyID = "100000000" and CompanyName = "Others". I try use SqlCommand on a OLE DB Command Component : SELECT "10000000" AS RUCCLI , "Otros - Varios" AS RAZCLI FROM RGVCAFAC <property id="1505" name="SqlCommand" dataType="System.String" state="default" isArray="false" description="The SQL command to be executed." typeConverter="" UITypeEditor="Microsoft.DataTransformationServices.Controls.ModalMultilineStringEditor, Microsoft.DataTransformationServices.Controls, Version=10.0.0.0, Culture=neutral, PublicKeyToken=89845dcd8080cc91" containsID="false" expressionType="Notify">SELECT "10000000" AS RUCCLI , "Otros - Varios" AS RAZCLI FROM RGVCAFAC</property> but nothings happens, why? and finally the task finish when the data is inserted on a SQL Server Table. Im using the same connection manager on extracting data and transform. (View Code) <DTS:Property DTS:Name="ConnectionString">Data Source=C:\CONTA\Resocen\Agosto\;Provider=Microsoft.Jet.OLEDB.4.0;Persist Security Info=False;Extended Properties=dBASE IV;</DTS:Property></DTS:ConnectionManager></DTS:ObjectData></DTS:ConnectionManager> all work is on memory, Im not using cache manager connections

    Read the article

  • displaying images in a list box so the image resizes based on parent container

    - by MikeU
    I have an expander with a list box in it that displays image thumbnails. I want the images to be sized according to the size of the listbox and the list box to be sized based on the width of the expander. When I expand the expander I want the list box and the images to resize also. Does anyone know how I can accomplish this? <Expander Style="{DynamicResource ExpanderStyle}" Name="pictureExpander" IsExpanded="True" ExpandDirection="Left" Collapsed="pictureExpander_Collapsed" Expanded="pictureExpander_Expanded" Grid.Column="4"> <ListBox Name="photoList" ItemsSource="{Binding Source={StaticResource PhotoBin}}" IsSynchronizedWithCurrentItem="True" HorizontalAlignment="Stretch" ScrollViewer.CanContentScroll="False"> <ListBox.ItemContainerStyle> <Style TargetType="{x:Type ListBoxItem}"> <Style.Resources> <SolidColorBrush x:Key="{x:Static SystemColors.HighlightBrushKey}" Color="Yellow" /> </Style.Resources> <Style.Triggers> <Trigger Property="IsSelected" Value="True"> <Setter Property="BorderBrush" Value="Black"/> <Setter Property="BorderThickness" Value="5"/> </Trigger> </Style.Triggers> </Style> </ListBox.ItemContainerStyle> <ListBox.ItemTemplate> <DataTemplate> <Image Source="{Binding FileLocation}" Margin="0,5" HorizontalAlignment="Stretch" MouseLeftButtonDown="DragImage" /> </DataTemplate> </ListBox.ItemTemplate> </ListBox> </Expander>

    Read the article

  • AjaxControlToolkit TabContainer with weird rendering behavior

    - by sohum
    I've built a web application that contains a page that uses the AjaxControlToolkit's TabContainer/TabPanel objects. I've developed a custom stylesheet, as well. I'm developing using Visual Studio 2010. The following is the behavior of my application: VS2010 Development Server (localhost:XXXXX): Works as expected with the custom stylesheet. Local IIS: The TabContainer rendered but the stylesheet wasn't applied. I fixed this by doing a CTRL+F5. It seems that IIS caches stylesheets pretty aggressively. Remote Server: The TabContainer and TabPanel are completely hidden. Looking at the HTML, all of them have their visibility set to hidden. The way I got my files onto my remote server were as follows (I haven't yet set up WebDAV or remote publishing because the server is a Windows 7 box and as far as I am aware does not support FrontPage Extensions): The entire solution is under source code control (SVN). Checked in all pending changes (including projects, aspx files, css, AjaxControlToolkit binaries) Synced on the server. Rebuilt everything on server. Deployed to local IIS on server (which is externally accessible). Both on the local IIS on the server and the development server on the server, the TabContainers are completely hidden. Looking at the SVN status on the server project, only the "AjaxControlToolkit.dll" is under source-code control. All the locale-specific DLLs are not on the server. Could this be a potential issue? I'm not sure what's going on and would appreciate any help. Thanks!

    Read the article

  • gdb+osx: no output when using printf/CFShow

    - by yairchu
    I attached to a program with gdb in OSX and I want to use CFShow in the gdb console etc. However, nothing shows up. printf shows nothing as well: (gdb) call (int) printf("Hello\n") $10 = 6 (gdb) call (int) printf("Hello World!\n") $11 = 13 Apple suggests the following tip for when attaching with gdb, to make the output appear in the gdb console: (gdb) call (void) close(1) (gdb) call (void) close(2) (gdb) shell tty /dev/ttyp1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $1 = 1 (gdb) call (int) open("/dev/ttyp1", 2, 0) $2 = 2 In xcode's gdb console tty gives "not a tty", so I tried it in gdb in a terminal. There tty does work but after redirecting stdout there's still no output. Also no output if I direct stdout to a file.. :/ Any salvation?

    Read the article

  • C# and F# lambda expressions code generation

    - by ControlFlow
    Let's look at the code, generated by F# for simple function: let map_add valueToAdd xs = xs |> Seq.map (fun x -> x + valueToAdd) The generated code for lambda expression (instance of F# functional value) will looks like this: [Serializable] internal class map_add@3 : FSharpFunc<int, int> { public int valueToAdd; internal map_add@3(int valueToAdd) { this.valueToAdd = valueToAdd; } public override int Invoke(int x) { return (x + this.valueToAdd); } } And look at nearly the same C# code: using System.Collections.Generic; using System.Linq; static class Program { static IEnumerable<int> SelectAdd(IEnumerable<int> source, int valueToAdd) { return source.Select(x => x + valueToAdd); } } And the generated code for the C# lambda expression: [CompilerGenerated] private sealed class <>c__DisplayClass1 { public int valueToAdd; public int <SelectAdd>b__0(int x) { return (x + this.valueToAdd); } } So I have some questions: Why does F#-generated class is not marked as sealed? Why does F#-generated class contains public fields since F# doesn't allows mutable closures? Why does F# generated class has the constructor? It may be perfectly initialized with the public fields... Why does C#-generated class is not marked as [Serializable]? Also classes generated for F# sequence expressions are also became [Serializable] and classes for C# iterators are not.

    Read the article

  • 'Hot code replace' not working -- Eclipse doesn't change any code on JBoss

    - by Bernhard V
    Hello, fellow visitors! I'm currently experiencing a problem with 'hot code replace' not working on Eclipse Galileo and JBoss 4.2.3. Among other applications I'm running an exploded Java WAR on my local JBoss. The project from which it is build is managed by Maven. I build the project using the Maven goal war:exploded and then I copy that directory to JBoss with an ANT script. When I'm now running the application and set a breakpoint anywhere in the code, Eclipse properly halts at that line in the debug mode. But when I'm making a change to the source file and save it, Eclipse doesn't apply this change to the JBoss. For example, when I make a normal code line into a comment, the debugger still steps over this comment as if it was regular Java code. Or when I remove a line, the debugger seems to get out of sync with the file and starts stepping over parenthesis. But I'm not getting any 'hot code replace error'-messages either. It seems to me that Eclipse applies the changes to the source files, but doesn't apply it to the JBoss. Are there any special preferences that have to be turned on in order to make hot code replace work? Or are there any mistakes in how I build and deploy the application to the JBoss? I'd appreciate your help very much. Thank you. Bernhard V

    Read the article

  • Opinions on Unladen Swallow?

    - by vartec
    What are your opinions and expectations on Google's Unladen Swallow? From their project plan: We want to make Python faster, but we also want to make it easy for large, well-established applications to switch to Unladen Swallow. Produce a version of Python at least 5x faster than CPython. Python application performance should be stable. Maintain source-level compatibility with CPython applications. Maintain source-level compatibility with CPython extension modules. We do not want to maintain a Python implementation forever; we view our work as a branch, not a fork. And even sweeter: In addition, we intend to remove the GIL and fix the state of multithreading in Python. We believe this is possible through the implementation of a more sophisticated GC It almost looks too good to be true, like the best of PyPy and Stackless combined. More info: Jesse Noller: "Pycon: Unladen-Swallow" ArsTechnica: "Google searches for holy grail of Python performance" Update: as DNS pointed out, there was related question: http://stackoverflow.com/questions/695370/what-is-llvm-and-how-is-replacing-python-vm-with-llvm-increasing-speeds-5x

    Read the article

  • Calling a .NET web service (WSE 3.0, WS-Security) from JAXWS-RI

    - by elduff
    I'm writing a JAXWS-RI client that must call a .NET Web Service that is using WS-Security. The service's WSDL does not contain any WS-Security info, but I have an example soap message from the service's authors and know that I must include wsse:Security headers, including X:509 tokens. I've been researching, and I've seen example of folks calling this type of web service from Axis and CXF (in conjunction with Rampart and/or WSS4J), but nothing about using plain JAXWS-RI itself. However, I'm (unfortunately) constrained to using JAXWS-RI by my gov't client. Does anyone have any examples/documentation of doing this from JAXWS-RI? I need to ultimately generate a SOAP header that looks something like the one below - this is a sample soap:header from a .NET client written by the service's authors. (Note: I've put the 'VALUE_HERE' string in places where I need to provide my own values) <soapenv:Envelope xmlns:iri="http://EOIR/IRIES" xmlns:soapenv="http://schemas.xmlsoap.org/soap/envelope/" xmlns:xenc="http://www.w3.org/2001/04/xmlenc#"> <soapenv:Header xmlns:wsa="http://www.w3.org/2005/08/addressing"> <wsse:Security xmlns:wsse="http://docs.oasis-open.org/wss/2004/01/oasis-200401- wss-wssecurity-secext-1.0.xsd"> <xenc:EncryptedKey Id="VALUE_HERE"> <xenc:EncryptionMethod Algorithm="http://www.w3.org/2001/04/xmlenc#rsa-oaep-mgf1p"/> <ds:KeyInfo xmlns:ds="http://www.w3.org/2000/09/xmldsig#"> <wsse:SecurityTokenReference> <wsse:KeyIdentifier EncodingType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-soap-message-security-1.0#Base64Binary" ValueType="http://docs.oasis-open.org/wss/2004/01/oasis-200401-wss-x509-token-profile-1.0#X509v3"> VALUE_HERE </wsse:KeyIdentifier> </wsse:SecurityTokenReference> </ds:KeyInfo> <xenc:CipherData> <xenc:CipherValue>VALUE_HERE</xenc:CipherValue> </xenc:CipherData> <xenc:ReferenceList> <xenc:DataReference URI="#EncDataId-8"/> </xenc:ReferenceList> </xenc:EncryptedKey> </wsse:Security>

    Read the article

  • Internet Explorer 7 Bugs - incorrect display OR dead links

    - by ClarkeyBoy
    Hi, I recently launched a website I have been developing over the past year - http://Live.heritageartpapers.co.uk/. My dad, who owns the company, had a phone call today saying it doesnt display properly in IE7. Bug #1: The header and footer are both in a div, whereas the content is in a table between the two divs. Reportedly the content (table) sometimes (not always, according to IETester) displays below the footer, but the footer still displays where it is supposed to (ie there is a massive gap where the content should fit). Bug #2: When the content does display in the correct place, all the links on the page are dead - click on them and nothing happens. As you can see if you view it in Firefox (the version I am using is 3.6), the links in the left hand menu turn orange on mouseover. However they do not even do this in IE7. Note that they do turn orange and do work if the content is displayed below the footer. I cant see why its happening - according to IETester, the IE7 interpreted source code has all the tags capitalised and many quotes removed (for example for the id attribute on most, if not all, tags) but I doubt this could cause the above bugs, could it? My question is whether anyone has ever seen any of these problems before, and/or has a solution to any of these problems?? I currently do not have the application open, but will post any relevant code in a few minutes. Alternatively just use view source. Many thanks in advance. Regards, Richard Clarke

    Read the article

  • Currency exchange rates for paypal

    - by Jacco
    Does anyone know a way to get the currency exchange rates for paypal? We have custom shopping cart and use Paypal (Website Payments Standard) to handle payments. Our 'home' currency is Euro, but we would like to present our customers the option to pay in different currencies (USD, CAD, AUD and GBP). PayPal offers the option to:     a) automatically convert our Euro quoted prices to, for example, USD upon checkout     b) checkout in USD directly With option a): We get paid in Euro, the customer pays for the currency exchange (good). The customer does not know what he/she is going to be charged in USD until checkout. (bad) With option b) The customer pays in USD, then the currency is converted into EUR and we pay the the currency exchange. The customer never has to worry about the different currencies (excellent) We do not know the exchange rate PayPal is going to use so we cannot quote the correct prices to our customer (showstopper) So my question is:   Does anybody know a way to get the PayPal exchange rates? or   Does anybody know how to make a good estimate? Update: PayPal updates it's exchange rate 2 times a day. (at least, that is what they state). They use the Interbank Exchange Rate provided by ??? and add a 2.5% spread above this rate to determine their retail foreign exchange rates. Unforunately, there the Interbank Exchange Rates vary from source to source and from minute to minute. We have been monitoring the PayPal exchange rates and cross referenced them with the Official reference rates provides by the European Central Bank. the results vary widely, somewhere from 1 to 6 ! percent...

    Read the article

  • Indy IdSMTP and attachments in Thunderbird

    - by Lobuno
    Hello! Using the latest snapshot of Indy tiburon on D2010. A very simple project like: var stream: TFileStream; (s is TidSMTP and m is TidMessage) begin s.Connect; Stream := TFileStream.Create('c:\Test.zip', fmOpenRead or fmShareExclusive); try with TIdAttachmentMemory.Create(m.MessageParts, Stream) do begin ContentType := 'application/x-zip-compressed'; Name := ExtractFilePath('C:\'); //' FileName := 'Test.zip'; end; finally FreeAndNil(Stream); end; s.Send(m); s.Disconnect(); end; Everything works Ok in Outlook, The bat!, OE, yahoo, etc... but in Thunderbird the attachment is not shown. Looking at the source of the message in Thunderbird, the attachment is there. The only difference I can find between messages send by indy and other clients is that Indy messages have this order: Content-Type: multipart/mixed; boundary="Z\=_7oeC98yIhktvxiwiDTVyhv9R9gwkwT1" MIME-Version: 1.0 while any other clients have the order: MIME-Version: 1.0 Content-Type: multipart/mixed; boundary="Z\=_7oeC98yIhktvxiwiDTVyhv9R9gwkwT1" Don't know if THAT is the source of the problem, but if so: is this a bug on Thunderbird or is this a problem with indy which "malforms" the headers of the messages? Is this order a problem? Does that matter anyway?

    Read the article

  • Binding an ASP.NET GridView Control to a string array

    - by Michael Kniskern
    I am trying to bind an ASP.NET GridView control to an string array and I get the following item: A field or property with the name 'Item' was not found on the selected data source. What is correct value I should use for DataField property of the asp:BoundField column in my GridView control. Here is my source code: ASPX page <asp:GridView ID="MyGridView" runat="server" AutoGenerateColumns="false"> <Columns> <asp:BoundField DataField="Item" /> <asp:CommandField ButtonType="Link" ShowSelectButton="true" SelectText="Click Me!" /> </Columns> </asp:GridView> Code Behind: string[] MyArray = new string[1]; MyArray[0] = "My Value"; MyGridView.DataSource = MyArray; MyGridView.DataBind(); UPDATE I need to have the AutoGenerateColumns attribute set to false because I need to generate additional asp:CommandField columns. I have updated my code sample to reflect this scenarion

    Read the article

  • help with grouping and sorting for TreeView in xaml

    - by danhotb
    I am having problems getting my head around grouping and sorting in xaml and hope someone can get me straightened out! I have creaed an xml file from a tree of files and folders (just like windows explorer) that can be serveral levels deep. I have bound a TreeView control to an xml datasource and it works great! It sorts everything alphabetically but ... I would like it to sort all folders first then all files, rather than folders listed with files, as it does now. the xml : if you load this to a treeviw it will display the two files before the folder because they are first in alpha-order. here is my code: <!-- This will contain the XML-data. --> <XmlDataProvider x:Key="xmlDP" XPath="*"> <x:XData> <Select_Project /> </x:XData> </XmlDataProvider> <!-- This HierarchicalDataTemplate will visualize all XML-nodes --> <HierarchicalDataTemplate DataType="project" ItemsSource ="{Binding}"> <TextBlock Text="{Binding XPath=@name}" /> </HierarchicalDataTemplate> <HierarchicalDataTemplate DataType="folder" ItemsSource ="{Binding}"> <TextBlock Text="{Binding XPath=@name}" /> </HierarchicalDataTemplate> <HierarchicalDataTemplate DataType="file" ItemsSource ="{Binding}"> <TextBlock Text="{Binding XPath=@name}" /> </HierarchicalDataTemplate> <CollectionViewSource x:Key="projectView" Source="{StaticResource xmlDP}"> <CollectionViewSource.SortDescriptions> <!-- ADD SORT DESCRIPTION HERE --> </CollectionViewSource.SortDescriptions> </CollectionViewSource> <TreeView Margin="11,79.992,18,19.089" Name="tvProject" BorderThickness="1" FontSize="12" FontFamily="Verdana"> <TreeViewItem ItemsSource="{Binding Source={StaticResource xmlDP}, XPath=*}" Header="Project"/> </TreeView>

    Read the article

  • Why is LOGON_USER Server Variable is blank on New Windows / New Tab?

    - by Alex Papadimoulis
    We are noticing some very strange behavior on an installation of a .NET2-based webapp on Server 2008. Our app uses "old school" Integrated Windows Authentication and simply reads the LOGIN_USER server variable from the request collection. There's a good reason for this, but that's somewhat irrelevant to the question, since the underlying WindowsAuthentication code from ASP.NET does the same thing. Anyway... When you enter the URL in the browser, it loads up just fine and displays the username (from LOGIN_USER) no problem. When you click on a link within the web app, it loads the page just fine and authenticates without any problems. When you "hard refresh" (Ctrl-F5) it also works just fine. However, when you click "open in a new window" or "open in a new tab", the LOGON_USER variable is blank Any ideas? Am I missing some IIS7 setting somewhere? Tested clients are Windows 7 with IE8 or Windows XP with IE6.

    Read the article

  • How to Determine The Module a Particular Exception Class is Defined In

    - by doug
    Note: i edited my Q (in the title) so that it better reflects what i actually want to know. In the original title and in the text of my Q, i referred to the source of the thrown exception; what i meant, and what i should have referred to, as pointed out in one of the high-strung but otherwise helpful response below, is the module that the exception class is defined in. This is evidenced by the fact that, again, as pointed out in one of the answers below the answer to the original Q is that the exceptions were thrown from calls to cursor.execute and cursor.next, respectively--which of course, isn't the information you need to write the try/except block. For instance (the Q has nothing specifically to do with SQLite or the PySQLite module): from pysqlite2 import dbapi2 as SQ try: cursor.execute('CREATE TABLE pname (id INTEGER PRIMARY KEY, name VARCHARS(50)') except SQ.OperationalError: print("{0}, {1}".format("table already exists", "... 'CREATE' ignored")) # cursor.execute('SELECT * FROM pname') while 1: try: print(cursor.next()) except StopIteration: break # i let both snippets error out to see the exception thrown, then coded the try/finally blocks--but that didn't tell me anything about which module the exception class is defined. In my example, there's only a single imported module, but where there are many more, i am interested to know how an experienced pythonista identifies the exception source (search-the-docs-till-i-happen-to-find-it is my current method). [And yes i am aware there's a nearly identical question on SO--but for C# rather than python, plus if you read the author's edited version, you'll see he's got a different problem in mind.]

    Read the article

  • Did I find a bug in WriteableBitmap when using string literals

    - by liserdarts
    For performance reasons I'm converting a large list of images into a single image. This code does exactly what I want. Private Function FlattenControl(Control As UIElement) As Image Control.Measure(New Size(1000, 1000)) Control.Arrange(New Rect(0, 0, 1000, 1000)) Dim ImgSource As New Imaging.WriteableBitmap(1000, 1000) ImgSource.Render(Control, New TranslateTransform) ImgSource.Invalidate Dim Img As New Image Img.Source = ImgSource Return Img End Function I can add all the images into a canvas pass the canvas to this function and I get back one image. My code to load all the images looks like this. Public Function BuildTextures(Layer As GLEED2D.Layer) As FrameworkElement Dim Container As New Canvas For Each Item In Layer.Items If TypeOf Item Is GLEED2D.TextureItem Then Dim Texture = CType(Item, GLEED2D.TextureItem) Dim Url As New Uri(Texture.texture_filename, UriKind.Relative) Dim Img As New Image Img.Source = New Imaging.BitmapImage(Url) Container.Children.Add(Img) End If Next Return FlattenControl(Container) End Function The GLEED2D.Layer and GLEED2D.TextureItem classes are from the free level editor GLEED2D (http://www.gleed2d.de/). The texture_filename on every TextureItem is "Images/tree_clipart_pine_tree.png" This works just fine, but it's just a proof of concept. What I really need to do (among other things) is have the path to the image hard coded. If I replace Texture.texture_filename in the code above with the string literal "Images/tree_clipart_pine_tree.png" the images do not appear in the final merged image. I can add a breakpoint and see that the WriteableBitmap has all of it's pixels as 0 after the call to Invalidate. I have no idea how this could cause any sort of difference, but it gets stranger. If I remove the call to FlattenControl and just return the Canvas instead, the images are visible. It's only when I use the string literal with the WriableBitmap that the images do not appear. I promise you that the value in the texture_filename property is exactly "Images/tree_clipart_pine_tree.png". I'm using Silverlight 3 and I've also reproduced this in Silverlight 4. Any ideas?

    Read the article

  • Serial Mac OS X constantly freezes/locks/dissappears for USB to Arduino

    - by Niraj D
    I have a problem with my C++ code running in Xcode with both the AMSerial library as well as the generic C (ioctl, termios). After a fresh restart, my application works well but after I "kill" the program the Serial (I think) is not released. I have checked my open files under /dev and have killed the connection to serial USB from there, but my C++ still can't open the USB port. I have narrowed this down to being a low level Mac OS X issue, regarding blocking the port indefinitely, regardless of closing it using the aforementioned libraries. Just for context, I'm trying to send numbers through my USB port, serially to an Arduino Duemilanove at 9600 baud. Running Serial Monitor in Arduino is perfectly fine, however, running through a C++ application it freezes up my computer, occasionally, my mouse/keyboard freeze up: requiring a hard reset. How can this problem be fixed? It seems like Mac OS X is not USB friendly!

    Read the article

  • C++ JSON parser

    - by pollux
    Dear reader, I'm working on a twitter client which uses the twitter streaming json api. Twitter advices JSON as XML version is deprecated. I'm looking for a good JSON parser which can parse the json data below. I'm receiving this JSON which I want to be able to read/parse using a JSON parser. { "in_reply_to_status_id": null, "text": "Home-plate umpire Crawford gets stung http://tinyurl.com/27ujc86", "favorited": false, "coordinates": null, "in_reply_to_user_id": null, "source": "<a href=\"http://apiwiki.twitter.com/\" rel=\"nofollow\">API</a>", "geo": null, "created_at": "Fri Jun 18 15:12:06 +0000 2010", "place": null, "user": { "profile_text_color": "333333", "screen_name": "HostingViral", "time_zone": "Pacific Time (US & Canada)", "url": "http://bit.ly/1Way7P", "profile_link_color": "228235", "profile_background_image_url": "http://s.twimg.com/a/1276654401/images/themes/theme14/bg.gif", "description": "Full time Internet Marketer - Helping other reach their Goals\r\nhttp://wavemarker.com", "statuses_count": 1944, "profile_sidebar_fill_color": "c7b7c7", "profile_background_tile": true, "contributors_enabled": false, "lang": "en", "notifications": null, "created_at": "Wed Dec 30 07:50:52 +0000 2009", "profile_sidebar_border_color": "120412", "following": null, "geo_enabled": false, "followers_count": 2485, "protected": false, "friends_count": 2495, "location": "Working at Home", "name": "Johnathan Thomas", "verified": false, "profile_background_color": "131516", "profile_image_url": "http://a1.twimg.com/profile_images/600114776/nessykalvo421_normal.jpg", "id": 100439873, "utc_offset": -28800, "favourites_count": 0 }, "in_reply_to_screen_name": null, "id": 16477056501, "contributors": null, "truncated": false } *This is the raw string (above it beautified) * {"in_reply_to_status_id":null,"text":"Home-plate umpire Crawford gets stung http://tinyurl.com/27ujc86","favorited":false,"coordinates":null,"in_reply_to_user_id":null,"source":"<a href=\"http://apiwiki.twitter.com/\" rel=\"nofollow\">API</a>","geo":null,"created_at":"Fri Jun 18 15:12:06 +0000 2010","place":null,"user":{"profile_text_color":"333333","screen_name":"HostingViral","time_zone":"Pacific Time (US & Canada)","url":"http://bit.ly/1Way7P","profile_link_color":"228235","profile_background_image_url":"http://s.twimg.com/a/1276654401/images/themes/theme14/bg.gif","description":"Full time Internet Marketer - Helping other reach their Goals\r\nhttp://wavemarker.com","statuses_count":1944,"profile_sidebar_fill_color":"c7b7c7","profile_background_tile":true,"contributors_enabled":false,"lang":"en","notifications":null,"created_at":"Wed Dec 30 07:50:52 +0000 2009","profile_sidebar_border_color":"120412","following":null,"geo_enabled":false,"followers_count":2485,"protected":false,"friends_count":2495,"location":"Working at Home","name":"Johnathan Thomas","verified":false,"profile_background_color":"131516","profile_image_url":"http://a1.twimg.com/profile_images/600114776/nessykalvo421_normal.jpg","id":100439873,"utc_offset":-28800,"favourites_count":0},"in_reply_to_screen_name":null,"id":16477056501,"contributors":null,"truncated":false} I've tried multiple JSON parsers from json.org though I've tried 4 now and can't find one which can parse above json. Kind regards, Pollux

    Read the article

  • Import Excel 2007 into SQL 2000 using Classic ASP and ADO

    - by jeff
    I have the following code from a legacy app which currently reads from an excel 2003 spreadsheet on a server, but I need this to run from my machine which uses excel 2007. When I debug on my machine ADO does not seem to be reading the spreadsheet. I have checked all file paths etc. and location of spreadsheet that is all fine. I've heard that you cannot use the jet db engine for excel 2007 anymore? Can someone confirm this? What do I need to do to get this to work? Please help! set obj_conn = Server.CreateObject("ADODB.Connection") obj_conn.Open "Provider=Microsoft.Jet.OLEDB.4.0;" & _ "Data Source=" & Application("str_folder") & "CNS43.xls;" & _ "Extended Properties=""Excel 8.0;""" set obj_rs_cns43 = Server.CreateObject("ADODB.RecordSet") obj_rs_cns43.ActiveConnection = obj_conn obj_rs_cns43.CursorType = 3 obj_rs_cns43.LockType = 2 obj_rs_cns43.Source = "SELECT * FROM [CNS43$]" obj_rs_cns43.Open

    Read the article

  • which ASP.NET hosting site allows listening on different ports than 80 and uses .NET 4?

    - by ijjo
    I'm trying to take advantage of HTML 5 web sockets in .NET and the easiest way appears to be something like what this guy does. I've already tested this myself and it works great, but there are a few problems if I try to deploy this to my hosting site (discountasp.net). Basically, I am not allowed to open up a port on 8080 and listen on it. I then tried to figure out a way to listen on port 80 with IIS as well, but using the HTTPListener, I run into sercurity issues as well. This doesn't seem like it will help since I can't mess with this stuff on the hosting site server either. So to make my life easier, I think I need to find a hosting site that simply allows me to open up a socket on port 8080 and listen on it. Anyone know of one? Or does anyone know of a workaround (besides sniffing all the traffic on port 80)?

    Read the article

  • Informix, NHibernate, TransactionScope interaction difficulties

    - by John Prideaux
    I have a small program that is trying to wrap an NHibernate insert into an Informix database in a TransactionScope object using the Informix .NET Provider. I am getting the error specified below. The code without the TransactionScope object works -- including when the insert is wrapped in an NHibernate session transaction. Any ideas on what the problem is? BTW, without the EnterpriseServicesInterop, the Informix .NET Provider will not participate in a TransactionScope transaction (verified without NHibernate involved). Code Snippet: public static void TestTScope() { Employee johnp = new Employee { name = "John Prideaux" }; using (TransactionScope tscope = new TransactionScope( TransactionScopeOption.Required, new TransactionOptions() { Timeout = new TimeSpan(0, 1, 0), IsolationLevel = IsolationLevel.ReadCommitted }, EnterpriseServicesInteropOption.Full)) { using (ISession session = OpenSession()) { session.Save(johnp); Console.WriteLine("Saved John to the database"); } } Console.WriteLine("Transaction should be rolled back"); } static ISession OpenSession() { if (factory == null) { Configuration c = new Configuration(); c.AddAssembly(Assembly.GetCallingAssembly()); factory = c.BuildSessionFactory(); } return factory.OpenSession(); } static ISessionFactory factory; Stack Trace: NHibernate.ADOException was unhandled Message="Could not close IBM.Data.Informix.IfxConnection connection" Source="NHibernate" StackTrace: at NHibernate.Connection.ConnectionProvider.CloseConnection(IDbConnection conn) at NHibernate.Connection.DriverConnectionProvider.CloseConnection(IDbConnection conn) at NHibernate.Tool.hbm2ddl.SuppliedConnectionProviderConnectionHelper.Release() at NHibernate.Tool.hbm2ddl.SchemaMetadataUpdater.GetReservedWords(Dialect dialect, IConnectionHelper connectionHelper) at NHibernate.Tool.hbm2ddl.SchemaMetadataUpdater.Update(ISessionFactory sessionFactory) at NHibernate.Impl.SessionFactoryImpl..ctor(Configuration cfg, IMapping mapping, Settings settings, EventListeners listeners) at NHibernate.Cfg.Configuration.BuildSessionFactory() at HelloNHibernate.Employee.OpenSession() in D:\Development\ScratchProject\HelloNHibernate\Employee.cs:line 73 at HelloNHibernate.Employee.TestTScope() in D:\Development\ScratchProject\HelloNHibernate\Employee.cs:line 53 at HelloNHibernate.Program.Main(String[] args) in D:\Development\ScratchProject\HelloNHibernate\Program.cs:line 19 at System.AppDomain._nExecuteAssembly(Assembly assembly, String[] args) at System.AppDomain.ExecuteAssembly(String assemblyFile, Evidence assemblySecurity, String[] args) at Microsoft.VisualStudio.HostingProcess.HostProc.RunUsersAssembly() at System.Threading.ThreadHelper.ThreadStart_Context(Object state) at System.Threading.ExecutionContext.Run(ExecutionContext executionContext, ContextCallback callback, Object state) at System.Threading.ThreadHelper.ThreadStart() InnerException: IBM.Data.Informix.IfxException Message="ERROR - no error information available" Source="IBM.Data.Informix" ErrorCode=-2147467259 StackTrace: at IBM.Data.Informix.IfxConnection.HandleError(IntPtr hHandle, SQL_HANDLE hType, RETCODE retcode) at IBM.Data.Informix.IfxConnection.DisposeClose() at IBM.Data.Informix.IfxConnection.Close() at NHibernate.Connection.ConnectionProvider.CloseConnection(IDbConnection conn) InnerException:

    Read the article

  • Installing fonts

    - by Lazar
    I have "white nights" trying to install Hebrew/Arabic fonts on my level 7 (API 2.1) aka Nexus emulator. I can't understand why Google guys will want to waist my skills do something helpful for the community using Hebrew/Arabic fonts. After rw mount/remount I can do it for level 3 devices, but for Nexus - nada! Why? What can be done? Real devices guys already broke this peace of hardware, but I am sitting and looking wide eyes open like a sheep. Please make me happy and give the chance to install the fonts. That's what must be done for some of us: We need system image saved on exit for tomorrow to continue the work Open emulator to work in peace cp command included with the SDK. Thanks for any help

    Read the article

< Previous Page | 572 573 574 575 576 577 578 579 580 581 582 583  | Next Page >