Search Results

Search found 27655 results on 1107 pages for 'visual python'.

Page 577/1107 | < Previous Page | 573 574 575 576 577 578 579 580 581 582 583 584  | Next Page >

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Self Authenticating Links in Django

    - by awolf
    In my web app I would like to be able to email self-authenticating links to users. These links will contain a unique token (uuid). When they click the link the token being present in the query string will be enough to authenticate them and they won't have to enter their username and password. What's the best way to do this?

    Read the article

  • starting 64 Bit Windows Application Development

    - by user173438
    I intend to start writing a 64 Bit Scientific Computing Application (signal processing) for Windows using Microsoft Visual Studio 2008. What should I have ready as far as a development platform is concerned? How would it be different from 32 Bit development? What could be the porting issues for a 32 Bit version that I already have (ok - this might too early to ask.. even before I start compiling)? As you might have guessed, I am looking for general directions. All pointers would be much appreciated! :) Thanks in advance..

    Read the article

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • How can i determine the version of the Windows SDK installed on my computer?

    - by NuclearCheese781
    Hello everyone :) I've very recently decided to teach myself c++ and win32 programming after learning vb.net, and i've got a very simple question: How can I determine what version of the Windows SDK is installed on my computer? I'm asking so I can install the latest version if it isn't installed allready, before i start playing around with c++. I'm using Microsoft Visual Studio 2008 SP1 as my IDE. (I spent 10 minutes using Google to search for an answer, but I couldn't find one) If anyone could help me, it would be very much appreciated. Matt.

    Read the article

  • How different protocols interact with eachother in Twisted

    - by stsupermouse
    The scenario I want two different protocols interact with each other is as below: A and B is two different protocols. First A will interact with the server and retrieve some values. Only after A finishes retrieving the values , B will start to interact with the server. Now my problem is that is there an elegant way to initial B when A retrieves the values. Currently I just initial B in A's data process function. But i don't think that this is an elegant way. What I mean an elegant way is that the initialization of B is done by a flow controller or something like that, but not another protocol. Is there an elegant way? such using defered or any other things. I'm just new to twisted, not knowing very much about defered.... Thank you very much!

    Read the article

  • What's the straightforward way to implement one to many editing in list_editable in django admin?

    - by Nate Pinchot
    Given the following models: class Store(models.Model): name = models.CharField(max_length=150) class ItemGroup(models.Model): group = models.CharField(max_length=100) code = models.CharField(max_length=20) class ItemType(models.Model): store = models.ForeignKey(Store, on_delete=models.CASCADE, related_name="item_types") item_group = models.ForeignKey(ItemGroup) type = models.CharField(max_length=100) Inline's handle adding multiple item_types to a Store nicely when viewing a single Store. The content admin team would like to be able to edit stores and their types in bulk. Is there a simple way to implement Store.item_types in list_editable which also allows adding new records, similar to horizontal_filter? If not, is there a straightforward guide that shows how to implement a custom list_editable template? I've been Googling but haven't been able to come up with anything. Also, if there is a simpler or better way to set up these models that would make this easier to implement, feel free to comment.

    Read the article

  • Django save method

    - by Marijus
    So I have a model with a FileField for excel spreadsheet. What I need to do this add another column in this spreadsheet, in each row let user pick from a drop-down list then save it and display it in html. All the picking and uploading will happen through the admin interface. So I have figured out way how to display a spreadsheet in html, however I have no idea how to write this save method. I could really use some hints and tips..

    Read the article

  • Get wrong PATH_INFO after rewriting in lighttpd

    - by Satoru.Logic
    In my lighttpd config file, I have a rewrite rule like this: $HTTP["host"] == "sub.example.com" { url.rewrite = ( "^/(.*)" => "/sub/$1" ) } So when a user visits http://sub.example.com, she's actually visiting http://example.com/sub. The problem is that the PATH_INFO seems wrong, URL: http://sub.example.com/extra PATH_INFO: expected: /extra what I get: /sub/extra Now whenever I call request.get_path(), it returns something like http://sub.example.com/sub/extra, which is not what I want. Of course, I can just override the get_path method of the request class, but I wonder if there is a simpler way like changing the lighttpd config?

    Read the article

  • Tying PyQt4 QAction triggered() to local class callable doesn't seem to work. How to debug this?

    - by Jon Watte
    I create this object when I want to create a QAction. I then add this QAction to a menu: class ActionObject(object): def __init__(self, owner, command): action = QtGui.QAction(command.name, owner) self.action = action self.command = command action.setShortcut(command.shortcut) action.setStatusTip(command.name) QtCore.QObject.connect(action, QtCore.SIGNAL('triggered()'), self.triggered) def triggered(self): print("got triggered " + self.command.id + " " + repr(checked)) Unfortunately, when the menu item is selected, the 'triggered' function is not called. QtCore.QObject.connect() returns True. Nothing is printed on the console to indicate that anything is wrong, and no exception is thrown. How can I debug this? (or, what am I doing wrong?)

    Read the article

  • MUD (game) design concept question about timed events.

    - by mudder
    I'm trying my hand at building a MUD (multiplayer interactive-fiction game) I'm in the design/conceptualizing phase and I've run into a problem that I can't come up with a solution for. I'm hoping some more experienced programmers will have some advice. Here's the problem as best I can explain it. When the player decides to perform an action he sends a command to the server. the server then processes the command, determines whether or not the action can be performed, and either does it or responds with a reason as to why it could not be done. One reason that an action might fail is that the player is busy doing something else. For instance, if a player is mid-fight and has just swung a massive broadsword, it might take 3 seconds before he can repeat this action. If the player attempts to swing again to soon, the game will respond indicating that he must wait x seconds before doing that. Now, this I can probably design without much trouble. The problem I'm having is how I can replicate this behavior from AI creatures. All of the events that are being performed by the server ON ITS OWN, aka not as an immediate reaction to something a player has done, will have to be time sensitive. Some evil monster has cast a spell on you but must wait 30 seconds before doing it again... I think I'll probably be adding all these events to some kind of event queue, but how can I make that event queue time sensitive?

    Read the article

  • what would be a frozen dict ?

    - by dugres
    A frozen set is a frozenset. A frozen list could be a tuple. What would be a frozen dict ? An immutable, hashable dict. I guess it could be something like collections.namedtuple, but namedtuple is more like a frozenkeys dict (an half-frozen dict). No ?

    Read the article

  • Can you change/redirect a django form's function by passing in your own function?

    - by Derek
    I'm dealing with django-paypal and want to change the button src images. So I went the the conf.py file in the source and edited the src destination. However, I really want to leave the source alone, and I noticed that the class PayPalPaymentsForm(forms.Form): has def get_image(self): return { (True, self.SUBSCRIBE): SUBSCRIPTION_SANDBOX_IMAGE, (True, self.BUY): SANDBOX_IMAGE, (True, self.DONATE): DONATION_SANDBOX_IMAGE, (False, self.SUBSCRIBE): SUBSCRIPTION_IMAGE, (False, self.BUY): IMAGE, (False, self.DONATE): DONATION_IMAGE, }[TEST, self.button_type] which handles all the image src destinations. Since changing this def in the source is worse than changing conf, I was wondering if there was a way to pass in customized defs you make like passing in initial arguments in forms? This way no source code is changed, and I can customize the get_image def as much as I need. passing in def something like this? def get_image(self): .... .... paypal = { 'amount': 10, 'item_name': 'test1', 'item_number': 'test1_slug', # PayPal wants a unique invoice ID 'invoice': str(uuid.uuid4()), } form = PayPalPaymentsForm(initial=paypal, get_image) Thanks!

    Read the article

  • Find next lower item in a sorted list

    - by Sebastian
    Hey guys, let's say I have a sorted list of Floats. Now I'd like to get the index of the next lower item of a given value. The usual for-loop aprroach has a complexity of O(n). Since the list is sorted there must be a way to get the index with O(log n). My O(n) approach: index=0 for i,value in enumerate(mylist): if value>compareValue: index=i-1 Is there a datatype for solving that problem in O(log n)? best regards Sebastian

    Read the article

  • PyGTK: Trouble with size of ScrolledWindow

    - by canavanin
    Hi everyone! I am using PyGTK and the gtk.Assistant. On one page I have placed a treeview (one column, just strings) in a gtk.ScrolledWindow (I wanted the vertical scrollbar, since the list contains about 35 items). Everything is working fine; the only thing that bugs me is that I have not been able to figure out from the documentation how to set the size of the scrolled window. Currently only three items are displayed at a time; I would like to set this number to 10 or so. Below is the code. As you can see I have tried using a gtk.Adjustment to influence the scrolled window's size, but as - once more - I have been incompetent at retrieving the required info from the documentation, I don't actually know what values should be put into there. self.page7 = gtk.VBox() # The gtk.Adjustment: page_size = gtk.Adjustment(lower=10, page_size=100) # just used some arbitrary numbers here >_< scrolled_win = gtk.ScrolledWindow(page_size) scrolled_win.set_policy(gtk.POLICY_AUTOMATIC, gtk.POLICY_AUTOMATIC) # only display scroll bars when required self.character_traits_treeview = gtk.TreeView() self.character_traits_treestore = gtk.TreeStore(str) self.character_traits_treeview.set_model(self.character_traits_treestore) tc = gtk.TreeViewColumn("Character traits") self.character_traits_treeview.append_column(tc) cr = gtk.CellRendererText() tc.pack_start(cr, True) tc.add_attribute(cr, "text", 0) self.character_trait_selection = self.character_traits_treeview.get_selection() self.character_trait_selection.connect('changed', self.check_number_of_character_trait_selections) self.character_trait_selection.set_mode(gtk.SELECTION_MULTIPLE) self.make_character_traits_treestore() # adding the treeview to the scrolled window: scrolled_win.add(self.character_traits_treeview) self.page7.pack_start(scrolled_win, False, False, 0) self.assistant.append_page(self.page7) self.assistant.set_page_title(self.page7, "Step 7: Select 2-3 character traits") self.assistant.set_page_type(self.page7, gtk.ASSISTANT_PAGE_CONTENT) self.assistant.set_page_complete(self.page7, False) def check_number_of_character_trait_selections(self, blah): # ... def make_character_traits_treestore(self): # ... I know I should RTFM, but as I can't make head or tail of it, and as further searching, too, has been to no avail, I'm just hoping that someone on here can give me a hint. Thanks a lot in advance! PS: Here are the links to: the gtk.ScrolledWindow documentation the gtk.Adjustment documentation

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • pandas read rotated csv files

    - by EricCoding
    Is there any function in pandas that can directly read a rotated csv file? To be specific, the header information in the first col instead of the first row. For example: A 1 2 B 3 5 C 6 7 and I would like the final DataFrame this way A B C 1 3 5 2 5 7 Of corse we can get around this problem using some data wangling techniques like transpose and slicing. I am wondering there should be a quick way in API but I could not find it.

    Read the article

< Previous Page | 573 574 575 576 577 578 579 580 581 582 583 584  | Next Page >