Search Results

Search found 27655 results on 1107 pages for 'visual python'.

Page 577/1107 | < Previous Page | 573 574 575 576 577 578 579 580 581 582 583 584  | Next Page >

  • In SqlAlchemy, how to ignore m2m relationship attributes when merge?

    - by ablmf
    There is a m2m relation in my models, User and Role. I want to merge a role, but i DO NOT want this merge has any effect on user and role relation-ship. Unfortunately, for some complicate reason, role.users if not empty. I tried to set role.users = None, but SA complains None is not a list. At this moment, I use sqlalchemy.orm.attributes.del_attribute, but I don't know if it's provided for this purpose.

    Read the article

  • How different protocols interact with eachother in Twisted

    - by stsupermouse
    The scenario I want two different protocols interact with each other is as below: A and B is two different protocols. First A will interact with the server and retrieve some values. Only after A finishes retrieving the values , B will start to interact with the server. Now my problem is that is there an elegant way to initial B when A retrieves the values. Currently I just initial B in A's data process function. But i don't think that this is an elegant way. What I mean an elegant way is that the initialization of B is done by a flow controller or something like that, but not another protocol. Is there an elegant way? such using defered or any other things. I'm just new to twisted, not knowing very much about defered.... Thank you very much!

    Read the article

  • Django - foreignkey problem

    - by realshadow
    Hey, Imagine you have this model: class Category(models.Model): node_id = models.IntegerField(primary_key = True) type_id = models.IntegerField(max_length = 20) parent_id = models.IntegerField(max_length = 20) sort_order = models.IntegerField(max_length = 20) name = models.CharField(max_length = 45) lft = models.IntegerField(max_length = 20) rgt = models.IntegerField(max_length = 20) depth = models.IntegerField(max_length = 20) added_on = models.DateTimeField(auto_now = True) updated_on = models.DateTimeField(auto_now = True) status = models.IntegerField(max_length = 20) node = models.ForeignKey(Category_info, verbose_name = 'Category_info', to_field = 'node_id' The important part is the foreignkey. When I try: Category.objects.filter(type_id = type_g.type_id, parent_id = offset, status = 1) I get an error that get returned more than category, which is fine, because it is supposed to return more than one. But I want to filter the results trough another field, which would be type id (from the second Model) Here it is: class Category_info(models.Model): objtree_label_id = models.AutoField(primary_key = True) node_id = models.IntegerField(unique = True) language_id = models.IntegerField() label = models.CharField(max_length = 255) type_id = models.IntegerField() The type_id can be any number from 1 - 5. I am desparately trying to get only one result where the type_id would be number 1. Here is what I want in sql: SELECT n.*, l.* FROM objtree_nodes n JOIN objtree_labels l ON (n.node_id = l.node_id) WHERE n.type_id = 15 AND n.parent_id = 50 AND l.type_id = 1 Any help is GREATLY appreciated. Regards

    Read the article

  • Self Authenticating Links in Django

    - by awolf
    In my web app I would like to be able to email self-authenticating links to users. These links will contain a unique token (uuid). When they click the link the token being present in the query string will be enough to authenticate them and they won't have to enter their username and password. What's the best way to do this?

    Read the article

  • Get wrong PATH_INFO after rewriting in lighttpd

    - by Satoru.Logic
    In my lighttpd config file, I have a rewrite rule like this: $HTTP["host"] == "sub.example.com" { url.rewrite = ( "^/(.*)" => "/sub/$1" ) } So when a user visits http://sub.example.com, she's actually visiting http://example.com/sub. The problem is that the PATH_INFO seems wrong, URL: http://sub.example.com/extra PATH_INFO: expected: /extra what I get: /sub/extra Now whenever I call request.get_path(), it returns something like http://sub.example.com/sub/extra, which is not what I want. Of course, I can just override the get_path method of the request class, but I wonder if there is a simpler way like changing the lighttpd config?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • What's the straightforward way to implement one to many editing in list_editable in django admin?

    - by Nate Pinchot
    Given the following models: class Store(models.Model): name = models.CharField(max_length=150) class ItemGroup(models.Model): group = models.CharField(max_length=100) code = models.CharField(max_length=20) class ItemType(models.Model): store = models.ForeignKey(Store, on_delete=models.CASCADE, related_name="item_types") item_group = models.ForeignKey(ItemGroup) type = models.CharField(max_length=100) Inline's handle adding multiple item_types to a Store nicely when viewing a single Store. The content admin team would like to be able to edit stores and their types in bulk. Is there a simple way to implement Store.item_types in list_editable which also allows adding new records, similar to horizontal_filter? If not, is there a straightforward guide that shows how to implement a custom list_editable template? I've been Googling but haven't been able to come up with anything. Also, if there is a simpler or better way to set up these models that would make this easier to implement, feel free to comment.

    Read the article

  • Tying PyQt4 QAction triggered() to local class callable doesn't seem to work. How to debug this?

    - by Jon Watte
    I create this object when I want to create a QAction. I then add this QAction to a menu: class ActionObject(object): def __init__(self, owner, command): action = QtGui.QAction(command.name, owner) self.action = action self.command = command action.setShortcut(command.shortcut) action.setStatusTip(command.name) QtCore.QObject.connect(action, QtCore.SIGNAL('triggered()'), self.triggered) def triggered(self): print("got triggered " + self.command.id + " " + repr(checked)) Unfortunately, when the menu item is selected, the 'triggered' function is not called. QtCore.QObject.connect() returns True. Nothing is printed on the console to indicate that anything is wrong, and no exception is thrown. How can I debug this? (or, what am I doing wrong?)

    Read the article

  • Django save method

    - by Marijus
    So I have a model with a FileField for excel spreadsheet. What I need to do this add another column in this spreadsheet, in each row let user pick from a drop-down list then save it and display it in html. All the picking and uploading will happen through the admin interface. So I have figured out way how to display a spreadsheet in html, however I have no idea how to write this save method. I could really use some hints and tips..

    Read the article

  • Making only one task run at a time in celerybeat

    - by Noufal Ibrahim
    I have a task which I execute once a minute using celerybeat. It works fine. Sometimes though, the task takes a few seconds more than a minute to run because of which two instances of the task run. This leads to some race conditions that mess things up. I can (and probably should) fix my task to work properly but I wanted to know if celery has any builtin ways to ensure this. My cursory Google searches and RTFMs yielded no results.

    Read the article

  • Distance between numpy arrays, columnwise

    - by Jaapsneep
    I have 2 arrays in 2D, where the column vectors are feature vectors. One array is of size F x A, the other of F x B, where A << B. As an example, for A = 2 and F = 3 (B can be anything): arr1 = np.array( [[1, 4], [2, 5], [3, 6]] ) arr2 = np.array( [[1, 4, 7, 10, ..], [2, 5, 8, 11, ..], [3, 6, 9, 12, ..]] ) I want to calculate the distance between arr1 and a fragment of arr2 that is of equal size (in this case, 3x2), for each possible fragment of arr2. The column vectors are independent of each other, so I believe I should calculate the distance between each column vector in arr1 and a collection of column vectors ranging from i to i + A from arr2 and take the sum of these distances (not sure though). Does numpy offer an efficient way of doing this, or will I have to take slices from the second array and, using another loop, calculate the distance between each column vector in arr1 and the corresponding column vector in the slice?

    Read the article

  • Find next lower item in a sorted list

    - by Sebastian
    Hey guys, let's say I have a sorted list of Floats. Now I'd like to get the index of the next lower item of a given value. The usual for-loop aprroach has a complexity of O(n). Since the list is sorted there must be a way to get the index with O(log n). My O(n) approach: index=0 for i,value in enumerate(mylist): if value>compareValue: index=i-1 Is there a datatype for solving that problem in O(log n)? best regards Sebastian

    Read the article

  • Check if something is a list

    - by 8EM
    What is the easiest way to check if something is a list? A method doSomething has the parameters a and b. In the method, it will loop through the list a and do something. I'd like a way to make sure a is a list, before looping through - thus avoiding an error or the unfortunate circumstance of passing in a string then getting back each letter. This question must have been asked before - however my googles failed me. Cheers.

    Read the article

  • How can i determine the version of the Windows SDK installed on my computer?

    - by NuclearCheese781
    Hello everyone :) I've very recently decided to teach myself c++ and win32 programming after learning vb.net, and i've got a very simple question: How can I determine what version of the Windows SDK is installed on my computer? I'm asking so I can install the latest version if it isn't installed allready, before i start playing around with c++. I'm using Microsoft Visual Studio 2008 SP1 as my IDE. (I spent 10 minutes using Google to search for an answer, but I couldn't find one) If anyone could help me, it would be very much appreciated. Matt.

    Read the article

  • starting 64 Bit Windows Application Development

    - by user173438
    I intend to start writing a 64 Bit Scientific Computing Application (signal processing) for Windows using Microsoft Visual Studio 2008. What should I have ready as far as a development platform is concerned? How would it be different from 32 Bit development? What could be the porting issues for a 32 Bit version that I already have (ok - this might too early to ask.. even before I start compiling)? As you might have guessed, I am looking for general directions. All pointers would be much appreciated! :) Thanks in advance..

    Read the article

  • Increasing figure size in Matplotlib

    - by Anirudh
    I am trying to plot a graph from a distance matrix. The code words fine and gives me a image in 800 * 600 pixels. The image being too small, All the nodes are packed together. I want increase the size of the image. so I added the following line to my code - figure(num=None, figsize=(10, 10), dpi=80, facecolor='w', edgecolor='k') After this all I get is a blank 1000 * 1000 image file. My overall code - import networkx as nx import pickle import matplotlib.pyplot as plt print "Reading from pickle." p_file = open('pickles/names') Names = pickle.load(p_file) p_file.close() p_file = open('pickles/distance') Dist = pickle.load(p_file) p_file.close() G = nx.Graph() print "Inserting Nodes." for n in Names: G.add_node(n) print "Inserting Edges." for i in range(601): for j in range(601): G.add_edge(Names[i],Names[j],weight=Dist[i][j]) print "Drawing Graph." nx.draw(G) print "Saving Figure." #plt.figure(num=None, figsize=(10, 10)) plt.savefig('new.png') print "Success!"

    Read the article

  • How to improve efficiency in loops?

    - by Jacob Worldly
    I have the following code, which translates the input string into morse code. My code runs through every letter in the string and then through every character in the alphabet. This is very inefficient, because what if I was reading from a very large file, instead of a small alphabet string. Is there any way that I could improve my code, Maybe using the module re, to match my string with the morse code characters? morse_alphabet = ".- -... -.-. -.. . ..-. --. .... .. .--- -.- .-.. -- -. --- .--. --.- .-. ... - ..- ...- .-- -..- -.-- --.." ALPHABET = "abcdefghijklmnopqrstuvwxyz" morse_letters = morse_alphabet.split(" ") result = [] count_character = 0 def t(code): for character in code: count_letter = 0 for letter in ALPHABET: lower_character = code[count_character].lower() lower_letter = letter.lower() if lower_character == lower_letter: result.append(morse_letters[count_letter]) count_letter += 1 count_character += 1 return result

    Read the article

< Previous Page | 573 574 575 576 577 578 579 580 581 582 583 584  | Next Page >