Search Results

Search found 28760 results on 1151 pages for 'search folder'.

Page 579/1151 | < Previous Page | 575 576 577 578 579 580 581 582 583 584 585 586  | Next Page >

  • MS SQL - Multi-Column substring matching

    - by hamlin11
    One of my clients is hooked on multi-column substring matching. I understand that Contains and FreeText search for words (and at least in the case of Contains, word prefixes). However, based upon my understanding of this MSDN book, neither of these nor their variants are capable of searching substrings. I have used LIKE rather extensively (Select * from A where A.B Like '%substr%') Sample table A: ID | Col1 | Col2 | Col3 | ------------------------------------- 1 | oklahoma | colorado | Utah | 2 | arkansas | colorado | oklahoma | 3 | florida | michigan | florida | ------------------------------------- The following code will give us row 1 and row 2: select * from A where Col1 like '%klah%' or Col2 like '%klah%' or Col3 like '%klah%' This is rather ugly, probably slow, and I just don't like it very much. Probably because the implementations that I'm dealing with have 10+ columns that need searched. The following may be a slight improvement as code readability goes, but as far as performance, we're still in the same ball park. select * from A where (Col1 + ' ' + Col2 + ' ' + Col3) like '%klah%' I have thought about simply adding insert, update, and delete triggers that simply add the concatenated version of the above columns into a separate table that shadows this table. Sample Shadow_Table: ID | searchtext | --------------------------------- 1 | oklahoma colorado Utah | 2 | arkansas colorado oklahoma | 3 | florida michigan florida | --------------------------------- This would allow us to perform the following query to search for '%klah%' select * from Shadow_Table where searchtext like '%klah%' I really don't like having to remember that this shadow table exists and that I'm supposed to use it when I am performing multi-column substring matching, but it probably yields pretty quick reads at the expense of write and storage space. My gut feeling tells me there there is an existing solution built into SQL Server 2008. However, I don't seem to be able to find anything other than research papers on the subject. Any help would be appreciated.

    Read the article

  • How to putExtra() in Searchable Dictionary Example

    - by sirlunchalot
    Hi, based on the Searchable Dictionary sample I tried to put extra data to a different activity. public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); Spinner distance = (Spinner) findViewById(R.id.distanceSpinner); ArrayAdapter<CharSequence> adapterDistance = ArrayAdapter.createFromResource( this, R.array.distance, android.R.layout.simple_spinner_item); adapterDistance.setDropDownViewResource(android.R.layout.simple_spinner_dropdown_item); distance.setAdapter(adapterDistance); Intent intent = getIntent(); if (Intent.ACTION_VIEW.equals(intent.getAction())) { // handles a click on a search suggestion; launches activity to show word mapIntent = new Intent(this, Map.class); mapIntent.setData(intent.getData()); mapIntent.putExtra("Distance", distance.getSelectedItemPosition()); startActivity(mapIntent); finish(); } } In my Map Class Distance is always zero because distance.getSelectedItemPostion() gets the initialized value. How can I putExtra data with a click on a search suggestion? Thanks

    Read the article

  • Using function arguments to dynamically generate a query

    - by Varun
    I am working on an issue management system, developed in PHP/MySQL. It requires search functionality, where the user will mention the search parameters and based on these parameters the system will return the result set. To solve this I am trying to write a function and all the user selected parameters are passed as arguments. Based on the arguments I will dynamically generate the query. Sample Query: select * from tickets inner join ticket_assigned_to on tickets.id=ticket_assigned_to.ticket_id where tickets.project_id= in ('') and tickets.status in ('') and ticket_assigned_to.user_id in ('') and tickets.reporter_user_id='' and tickets.operator_user_id in ('') and tickets.due_date between '' and '' and tickets.ts_created between '' and ''; I also need to handle cases where the arguments can be ORed or ANDed in the query. For example: select * from tickets inner join ticket_assigned_to on tickets.id=ticket_assigned_to.ticket_id where tickets.project_id= in ('') and tickets.status in ('') or tickets.due_date = '' or tickets.ts_created between '' and ''; I am also planning to use the same function at other places in the project also. Like to display all the tickets of a user or all tickets created between given dates and so on... How to handle this situation? Should I go with a single function which handles all this or numerous small functions? Need guidance here.

    Read the article

  • Is there a best practice for concatenating MP3 Files, adjusting sample rates to match, while preserving original files?

    - by Scott
    Hello overflow community! Does anyone know if there is a "best practice" to concatenate mp3 files to create new files, while preserving the original files? I am working on a CentOS Linux machine, in command line. I will eventually call the command line from a PHP script. I have been doing research and I have come up with a process that I think could work. It combines general advice from different forums, blogs, and sources like this one. So here I go: Create a temporary folder Loop through files to create a new, converted copy, of file into a "raw" format (which one, I don't know. I didn't know "raw" files existed before too long ago. I could use some suggestions on this) Store the path to the temporary files, in the temporary folder, and then loop through the files to concatenate them and then put the new merged file the final "processed directory" Delete the contents of the temporary file with the temporary raw files inside. Convert the final file from "raw" to mp3 and enjoy the finished result I'm thinking that this course of action might be best because I can't necessarily control the quality of the original "source" mp3s. The only other option I could think of would be to create a script that would perform a similar process upon files being added to the system leaving only the files with the "proper" format and removing the original "erroneous" file. Hopefully you can see that I have put some thought into this and that I'm trying to leverage the collective knowledge of this community to choose the best direction. Perhaps there is a better path that I could take? By concatenate, I mean to join together in sequence to create a new audio file from the "concatenated files."

    Read the article

  • Javascript: How to test JSONP on localhost

    - by hqt
    Here is the way I test JSONP: I run XAMPP, and in folder htdocs I create a javascript folder . I create json1.json file contain some data to process. After that, I run this html file locally, and it will call a function in "other machine" (in this case is localhost) Here is my code : <head> <script> function updateSales(sales) { alert('test jsonp'); // real code here } </script> </head> <body> <h1>JSONP Example</h1> <script src="http://localhost:85/javascript/json1.json?callback=updateSales"></script> </body> But when I run, nothing happen. But if change to other real json on the internet, it will work. It means change line : <script src="http://localhost:85/javascript/json1.json?callback=updateSales"></script> to line: <script src="http://gumball.wickedlysmart.com/?callback=updateSales"></script> It will work smoothly. So, I don't know how to test JSONP by using localhost, please help me. Thanks :)

    Read the article

  • ASP.NET - Accessing copied content

    - by James Kolpack
    I have a class library project which contains some content files configured with the "Copy if newer" copy build action. This results in the files being copied to a folder under ...\bin\ for every project in the solution. In this same solution, I've got a ASP.NET web project (which is MVC, by the way). In the library I have a static constructor load the files into data structures accessible by the web project. Previously I've been including the content as an embedded resource. I now need to be able to replace them without recompiling. I want to access the data in three different contexts: Unit testing the library assembly Debugging the web application Hosting the site in IIS For unit testing, Environment.CurrentDirectory points to a path containing the copied content. When debugging however, it points to C:\Program Files\Microsoft Visual Studio 9.0\Common7\IDE. I've also looked at Assembly.GetExecutingAssembly().Location which points to C:\Windows\Microsoft.NET\Framework\v2.0.50727\Temporary ASP.NET Files\root\c44f9da4\9238ccc\assembly\dl3\eb4c23b4\9bd39460_f7d4ca01\. What I need is to the physical location of the webroot \bin folder, but since I'm in a static constructor in the library project, I don't have access to a Request.PhysicalApplicationPath. Is there some other environment variable or structure where I can always find my "Copy if newer" files?

    Read the article

  • ReWriteRule is redirecting rather rewriting

    - by James Doc
    At the moment I have two machines that I do web development on; an iMac for work at the office and a MacBook for when I have to work on the move. They both running OS X 10.6 have the same version of PHP, Apache, etc running on them. Both computers have the same files of the website, including the .htaccess file (see below). On the MacBook the URLs are rewritten nicely, masking the URL they are pointing to (eg site/page/page-name), however on the iMac they simply redirect to the page (eg site/index.php?method=page&value=page-name) which is making switching back and forth between machines a bit of a pain! I'm sure it must be a config setting somewhere, but I can't for the life of me find it. Has anyone got a remedy? Many thanks. I'm fairly convinced there is a much nice way of writing this htaccess file without loosing access several key folders as well! Options +FollowSymlinks RewriteEngine on RewriteBase /In%20Progress/Vila%20Maninga/ RewriteRule ^page/([a-z|0-9_&;=-]+) index.php?method=page&value=$1 [NC] RewriteRule ^tag/([a-z|0-9_]+) index.php?method=tag&value=$1 [NC] RewriteRule ^search/([a-z|0-9_"]+) index.php?method=search&value=$1 [NC] RewriteRule ^modpage/([con0-9-]+) index.php?method=modpage&value=$1 [NC] RewriteRule ^login index.php?method=login [NC] RewriteRule ^logout index.php?method=logout [NC] RewriteRule ^useraccounts index.php?method=useraccounts [NC]

    Read the article

  • Forwarding keypresses in GTK

    - by dguaraglia
    I'm writing a bit of code for a Gedit plugin. I'm using Python and the interface (obviously) is GTK. So, the issue I'm having is quite simple: I have a search box (a gtk.Entry) and right below I have a results box (a gtk.TreeView). Right after you type something in the search box you are presented a bunch of results, and I would like the user to be able to press the Up/Down keys to select one, Enter to choose it, and be done. Thing is, I can't seem to find a way to forward the Up/Down keypress to the TreeView. Currently I have this piece of code: def __onSearchKeyPress(self, widget, event): """ Forward up and down keys to the tree. """ if event.keyval in [gtk.keysyms.Up, gtk.keysyms.Down]: print "pressed up or down" e = gtk.gdk.Event(gtk.gdk.KEY_PRESS) e.keyval = event.keyval e.window = self.browser.window e.send_event = True self.browser.emit("key-press-event", e) return True I can clearly see I'm receiving the right kind of event, but the event I'm sending gets ignored by the TreeView. Any ideas? Thanks in advance people.

    Read the article

  • Different approaches for finding users within Active Directory

    - by EvilDr
    I'm a newbie to AD programming, but after a couple of weeks of research have found the following three ways to search for users in Active Directory using the account name as the search parameter: Option 1 - FindByIdentity Dim ctx As New PrincipalContext(ContextType.Domain, Environment.MachineName) Dim u As UserPrincipal = UserPrincipal.FindByIdentity(ctx, IdentityType.SamAccountName, "MYDOMAIN\Administrator") If u Is Nothing Then Trace.Warn("No user found.") Else Trace.Warn("Name=" & u.Name) Trace.Warn("DisplayName=" & u.DisplayName) Trace.Warn("DistinguishedName=" & u.DistinguishedName) Trace.Warn("EmployeeId=" & u.EmployeeId) Trace.Warn("EmailAddress=" & u.EmailAddress) End If Option 2 - DirectorySearcher Dim connPath As String = "LDAP://" & Environment.MachineName Dim de As New DirectoryEntry(connPath) Dim ds As New DirectorySearcher(de) ds.Filter = String.Format("(&(objectClass=user)(anr={0}))", Split(User.Identity.Name, "\")(1)) ds.PropertiesToLoad.Add("name") ds.PropertiesToLoad.Add("displayName") ds.PropertiesToLoad.Add("distinguishedName") ds.PropertiesToLoad.Add("employeeId") ds.PropertiesToLoad.Add("mail") Dim src As SearchResult = ds.FindOne() If src Is Nothing Then Trace.Warn("No user found.") Else For Each propertyKey As String In src.Properties.PropertyNames Dim valueCollection As ResultPropertyValueCollection = src.Properties(propertyKey) For Each propertyValue As Object In valueCollection Trace.Warn(propertyKey & "=" & propertyValue.ToString) Next Next End If Option 3 - PrincipalSearcher Dim ctx2 As New PrincipalContext(ContextType.Domain, Environment.MachineName) Dim sp As New UserPrincipal(ctx2) sp.SamAccountName = "MYDOMAIN\Administrator" Dim s As New PrincipalSearcher s.QueryFilter = sp Dim p2 As UserPrincipal = s.FindOne() If p2 Is Nothing Then Trace.Warn("No user found.") Else Trace.Warn(p2.Name) Trace.Warn(p2.DisplayName) Trace.Warn(p2.DistinguishedName) Trace.Warn(p2.EmployeeId) Trace.Warn(p2.EmailAddress) End If All three of these methods return the same results, but I was wondering if any particular method is better or worse than the others? Option 1 or 3 seem to be the best as they provide strongly-typed property names, but I might be wrong? My overall objective is to find a single user within AD based on the user principal value passed via the web browser when using Windows Authentication on a site (e.g. "MYDOMAIN\MyUserAccountName")

    Read the article

  • Need help tuning a SQL statement

    - by jeffself
    I've got a table that has two fields (custno and custno2) that need to be searched from a query. I didn't design this table, so don't scream at me. :-) I need to find all records where either the custno or custno2 matches the value returned from a query on the same table based on a titleno. In other words, the user types in 1234 for the titleno. My query searches the table to find the custno associated with the titleno. It also looks for the custno2 for that titleno. Then it needs to do a search on the same table for all other records that have either the custno or custno2 returned in the previous search in the custno or custno2 fields for those other records. Here is what I've come up with: SELECT BILLYR, BILLNO, TITLENO, VINID, TAXPAID, DUEDATE, DATEPIF, PROPDESC FROM TRCDBA.BILLSPAID WHERE CUSTNO IN (select custno from trcdba.billspaid where titleno = '1234' union select custno2 from trcdba.billspaid where titleno = '1234' and custno2 != '') OR CUSTNO2 IN (select custno from trcdba.billspaid where titleno = '1234' union select custno2 from trcdba.billspaid where titleno = '1234' and custno2 != '') The query takes about 5-10 seconds to return data. Can it be rewritten to work faster?

    Read the article

  • Problem with generic list and extension method(C#3.0)

    - by Newbie
    I have an issue. I am making an extension class for a Collection and it is generic.. like public static class ListExtensions { public static ICollection<T> Search<T>(this ICollection<T> collection, string stringToSearch) { ICollection<T> t1=null; foreach (T t in collection) { Type k = t.GetType(); PropertyInfo pi = k.GetProperty("Name"); if (pi.GetValue(t,null).Equals(stringToSearch)) { t1.Add(t); } } return t1; } } But I cannot add items to t1 as it is declared null. Error: object reference not set to an instance of the object. I am calling the method like List<TestClass> listTC = new List<TestClass>(); listTC.Add(new TestClass { Name = "Ishu", Age = 21 }); listTC.Add(new TestClass { Name = "Vivek", Age = 40 }); listTC.Add(new TestClass { Name = "some one else", Age = 12 }); listTC.Search("Ishu"); And the test class is public class TestClass { public string Name { get; set; } public int Age { get; set; } } Using : (C#3.0) & Framework - 3.5 Thanks

    Read the article

  • How to create copying items from property values?

    - by Nam Gi VU
    Let's say I have a list of sub paths such as <PropertyGroup> <subPaths>$(path1)\**\*; $(path2)\**\*; $(path3)\file3.txt; </subPaths> </PropertyGroup> I want to copy these files from folder A to folder B (surely we already have all the sub folders/files in A). What I try was: <Target Name="Replace" DependsOnTargets="Replace_Init; Replace_Copy1Path"> </Target> <Target Name="Replace_Init"> <PropertyGroup> <subPaths>$(path1)\**\*; $(path2)\**\*; $(path3)\file3.txt; </subPaths> </PropertyGroup> <ItemGroup> <subPathItems Include="$(subPathFiles.Split(';'))" /> </ItemGroup> </Target> <Target Name="Replace_Copy1Path" Outputs="%(subPathItems.Identity)"> <PropertyGroup> <src>$(folderA)\%(subPathItems.Identity)</src> <dest>$(folderB)\%(subPathItems.Identity)</dest> </PropertyGroup> <Copy SourceFiles="$(src)" DestinationFiles="$(dest)" /> </Target> But the Copy task didn't work. It doesn't translate the *** to files. What did I do wrong? Please help!

    Read the article

  • File.Move, why do i get a FileNotFoundException? The file exist...

    - by acidzombie24
    Its extremely weird since the program is iterating the file! outfolder and infolder are both in H:/ my external HD using windows 7. The idea is to move all folders that only contain files with the extention db and svn-base. When i try to move the folder i get an exception. VS2010 tells me it cant find the folder specified in dir. This code is iterating through dir so how can it not find it! this is weird. string []theExt = new string[] { "db", "svn-base" }; foreach (var dir in Directory.GetDirectories(infolder)) { bool hit = false; if (Directory.GetDirectories(dir).Count() > 0) continue; foreach (var f in Directory.GetFiles(dir)) { var ext = Path.GetExtension(f).Substring(1); if(theExt.Contains(ext) == false) { hit = true; break; } } if (!hit) { var dst = outfolder + "\\" + Path.GetFileName(dir); File.Move(dir, outfolder); //FileNotFoundException: Could not find file dir. } } }

    Read the article

  • Subversion commands not being run by Ubuntu rc.local

    - by talentedmrjones
    Here is my rc.local for an autoscaling amazon ec2 instance based on ubuntu: (Note that user names, domains, and paths have been changed for security purposes) logger "Begin rc.local startup script:" logger "svn checkout" sudo -u nonRootUser /usr/bin/svn co svn+ssh://[email protected]/path/to/repo /var/www/html | logger logger "chown writeable folder" chown www-data /var/www/html/writeableFolder logger "restart apache" /etc/init.d/apache2 restart | logger exit 0 And here is the output of sudo tail -n 40 /var/log/syslog Mar 10 22:05:20 ubuntu logger: Begin rc.local startup script: Mar 10 22:05:20 ubuntu logger: svn checkout Mar 10 22:05:20 ubuntu logger: chown writeable folder Of course its not getting to apache2 restart because it error'd on the chown. I did find however that if I do a checkout beforehand, and set the rc.local svn command to an svn update, that it still does not run the svn command but does output apache2 restart successfully. These same svn commands work perfectly when I run them manually, tho it's strange that within rc.local they do not produce any output whatsoever to logger yet apache2 restart does. I've also tried running the svn co and svn update both with sudo -u and without. How do I get the svn command to run? Either a full checkout or an update. At this point either would be better than nothing!

    Read the article

  • Android: Adding data to Intent fails to load Activity

    - by DroidIn.net
    I have a widget that supposed to call an Activity of the main app when the user clicks on widget body. My setup works for a single widget instance but for a second instance of the same widget the PendingIntent gets reused and as result the vital information that I'm sending as extra gets overwritten for the 1st instance. So I figured that I should pass widget ID as Intent data however as soon as I add Intent#setData I would see in the log that 2 separate Intents are appropriately fired but the Activity fails to pick it up so basically Activity will not come up and nothing happens (no error or warning ether) Here's how the activity is setup in the Manifest: <activity android:name=".SearchResultsView" android:label="@string/search_results" <intent-filter> <action android:name="bostone.android.search.RESULTS" /> <category android:name="android.intent.category.DEFAULT" /> </intent-filter> </activity> And here's code that is setup for handling the click Intent di = new Intent("bostone.android.search.RESULTS"); di.setFlags(Intent.FLAG_ACTIVITY_NEW_TASK); // if line below is commented out - the Activity will start di.setData(ContentUris.withAppendedId(Uri.EMPTY, widgetId)); di.putExtra("URL", url); views.setOnClickPendingIntent(R.id.widgetContent, PendingIntent.getActivity(this, 0, di, 0)); The main app and the widget are packaged as 2 separate APK each in its own package and Manifest

    Read the article

  • Combining two .png images into one image using .NET

    - by Omega
    I have two (actually many) .png images in my application. Both have transparent areas here and there. I want, in my application, to take both images, combine them, and display the result in a picture box. Later I want to save the result through a button. So far I managed to find the two images and combine them, but it seems the transparency thing won't work. I mean, if you put one image over another, only the top image is visible as the result because, apparently, the image's background is a plain white box. Which is not. Here is a bit of my code: Dim Result As New Bitmap(96, 128) Dim g As Graphics = Graphics.FromImage(Result) Dim Name As String For Each Name In BasesCheckList.CheckedItems Dim Layer As New Bitmap(resourcesPath & "Bases\" & Name) For x = 0 To Layer.Width - 1 For y = 0 To Layer.Height - 1 Result.SetPixel(x, y, Layer.GetPixel(x, y)) Next Next Layer = Nothing Next resourcesPath is the path to my resources folder. Bases is a folder in it. And Name is the image's name. Thank you.

    Read the article

  • What should I do with an over-bloated select-box/drop-down

    - by Tristan Havelick
    All web developers run into this problem when the amount of data in their project grows, and I have yet to see a definitive, intuitive best practice for solving it. When you start a project, you often create forms with tags to help pick related objects for one-to-many relationships. For instance, I might have a system with Neighbors and each Neighbor belongs to a Neighborhood. In version 1 of the application I create an edit user form that has a drop down for selecting users, that simply lists the 5 possible neighborhoods in my geographically limited application. In the beginning, this works great. So long as I have maybe 100 records or less, my select box will load quickly, and be fairly easy to use. However, lets say my application takes off and goes national. Instead of 5 neighborhoods I have 10,000. Suddenly my little drop-down takes forever to load, and once it loads, its hard to find your neighborhood in the massive alphabetically sorted list. Now, in this particular situation, having hierarchical data, and letting users drill down using several dynamically generated drop downs would probably work okay. However, what is the best solution when the objects/records being selected are not hierarchical in nature? In the past, of done this with a popup with a search box, and a list, but this seems clunky and dated. In today's web 2.0 world, what is a good way to find one object amongst many for ones forms? I've considered using an Ajaxifed search box, but this seems to work best for free text, and falls apart a little when the data to be saved is just a reference to another object or record. Feel free to cite specific libraries with generic solutions to this problem, or simply share what you have done in your projects in a more general way

    Read the article

  • File.Replace throwing IOException

    - by WebDevHobo
    I have an app that can make modify images. In some cases, this makes the filesize smaller, in some cases bigger. The program doesn't have an option to "not replace the file if result has a bigger filesize". So I wrote a little C# app to try and solve this. Instead of overwriting the files, I make the app write the result to a folder under the current one and name that folder Test. The C# app I wrote compares grabs the contents of both folders and puts the full path to the file(s) in two List objects. I then compare and replace. The replacing isn't working however. I get the following IOException: Unable to remove the file to be replaced The location is on an external hard-drive, on which I have full rights. Now, I know I can just do File.Delete and File.Move in that order, but this exception has gotten me interested in why this particular setup wont work. Here's the source code: http://pastebin.com/4Vq82Umu And yes, the file specified as last argument of the Replace function does exist.

    Read the article

  • How to maintain form state after Post-Redirect-Get in ASP.net?

    - by Ian Boyd
    Imagine a page with a form input: Search Criteria: crackers                   From: [email protected]           To: [email protected]       Subject: How to maintain form state with PRG? Message: Imagine a page with form input:                         Send After the user clicks Send, the server will instruct to client to Redirect, as part of the Post-Redirect-Get pattern. POST /mail/u/compose HTTP/1.1 303 See Other Location: http://stackoverflow.com/mail/u/compose And the client will issue a GET of the new page. The problem is that some elements of the existing form are lost: Search Criteria:                    It gets worse when there are a few drop-downs, and checkboxes. How can i maintain form state in using Post-Redirect-Get in ASP.net, given that the viewstate is then non-existent. Bonus Reading ASP.NET: How to redirect, prefilling form data?

    Read the article

  • Tomcat does not pick up the class file - the JSP file is not displayed

    - by blueSky
    I have a Java code which is a controller for a jsp page, called: HomeController.java. Code is as follows: @Controller public class HomeController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/mypage") public String home() { System.out.println("HomeController: Passing through..."); return "home"; } } There is nothing especial in the jsp page: home.jsp. If I go to this url: http://localhost:8080/adcopyqueue/mypage I can view mypage and everything works fine. Also in the tomcat Dos page I can see the comment: HomeController: Passing through... As expected. Now under the same directory that I have HomeController.java, I've created another file called: LoginController.java. Following is the code: @Controller public class LoginController { protected final transient Log log = LogFactory.getLog(getClass()); @RequestMapping(value = "/loginpage") public String login() { System.out.println("LoginController: Passing through..."); return "login"; } } And under the same place which I have home.jsp, I've created login.jsp. Also under tomcat folders, LoginController.class exists under the same folder that HomeController.class exists and login.jsp exists under the same folder which home.jsp exists. But when I go to this url: http://localhost:8080/adcopyqueue/loginpage Nothing is displayed! I think tomcat does not pick up LoginController.class b/c on the tomcat Dos window, I do NOT see this comment: LoginController: Passing through... Instead I see following which I do not know what do they mean? [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:34) got manifest [ INFO] [http-8080-1 01:43:45] (AppInfo.java:populateAppInfo:36) manifest entrie s 8 The structure and the code for HomeController.java and LoginController.java plus the jsp files match. I have no idea why tomcat sees one of the files and not the other? Clean build did not help. Does anybody have any idea? Any help is greatly appraciated.

    Read the article

  • Typical SVN repo structure seems to be sub-optimal for continuous integration...

    - by Dave
    I've set up our SVN repository like the Subversion book suggests, and this is also how my previous companies have done it. It looks something like this: /trunk /branches /tags /extlibs /docs where the first three are pretty obvious, and extlibs is for 3rd party assemblies that we wouldn't typically recompile ourselves. All of this works great for the daily development stuff. Now I've installed TeamCity and have builds, unit tests, code coverage, and code analysis running. Everything is great, except for the fact that this code structure results in too much code getting downloaded. So here's the catch 22, in my opinion: it's silly to download all of aforementioned folders from the SVN repo when I only need /trunk and /extlibs. But I can only specify one repo folder to download in the TeamCity VCS settings. So then the other possibility is to put the /extlibs folder into /trunk, but in order to compile branches, /extlibs would have to go into all of those as well (since I usually branch the trunk, and not individual subfolders... and this would seem infinitely more evil since /extlibs could actually be larger than /trunk and /branches, with all of the binaries stored there... Do you guys have any suggestions for me? Thanks!

    Read the article

  • Giving writing permissions for IIS user at Windows 2003 Server

    - by Steve
    I am running a website over Windows 2003 Server and IIS6 and I am having problems to write or delete files in some temporary folder obtaining this kind of warmings: Warning: unlink(C:\Inetpub\wwwroot\cakephp\app\tmp\cache\persistent\myapp_cake_core_cake_): Permission denied in C:\Inetpub\wwwroot\cakephp\lib\Cake\Cache\Engine\FileEngine.php on line 254 I went to the tmp directory and at the properties I gave the IIS User the following permissions: Read & Execute List folder Contents Read And it still showing the same warnings. When I am on the properties window, if I click on Advanced the IIS username appears twice. One with Allow type and read & execute permissions and the other with Deny type and Special permissions. My question is: Should I give this user not only the Read & Execute permissions but also this ones?: Create Attributes Create Files/ Write Data Create Folders/ Append Data Delete Subfolders and Files Delete They are available to select if I Click on the edit button over the username. Wouldn't I be opening a security hole if I do this? Otherwise, how can I do to read and delete the files my website uses? Thanks.

    Read the article

  • How to create view in RoR if skipped during controller generation

    - by swapnesh
    When I run this: rails generate controller hello index it no doubt generates hello controller, but accidentally when I run another command like this: rails generate controller world it creates the world controller successfully, but missed the Route "world/index" like as "hello/index". For this mistake I need to use destroy controller and then generate it once more, is thr some kind of mid way command that I can generate if forgotten something rather than destroying and creating every time. This command rails generate controller contact-us index creates a route as contact_us/index or contact_us after changing routes.rb under config folder. How could I create a more SEO friendly URL in RoR? Like localhost:3000/contact-us? I am working on some very basic rules to follow RoR..like 3 static pages (Home, About us, Contact Us) Just simple html content to understand more, will certainly add more features to it as well. localhost:3000/home localhost:3000/About_us localhost:3000/contact_us I created this via creating home, About_us, contact_us controller command and then changed html in views. Since I am on an initial phase, I read somewhere for static pages we can create this in our public like what we have error pages there in the folder or the approach im using is correct?

    Read the article

  • Statistical analysis on large data set to be published on the web

    - by dassouki
    I have a non-computer related data logger, that collects data from the field. This data is stored as text files, and I manually lump the files together and organize them. The current format is through a csv file per year per logger. Each file is around 4,000,000 lines x 7 loggers x 5 years = a lot of data. some of the data is organized as bins item_type, item_class, item_dimension_class, and other data is more unique, such as item_weight, item_color, date_collected, and so on ... Currently, I do statistical analysis on the data using a python/numpy/matplotlib program I wrote. It works fine, but the problem is, I'm the only one who can use it, since it and the data live on my computer. I'd like to publish the data on the web using a postgres db; however, I need to find or implement a statistical tool that'll take a large postgres table, and return statistical results within an adequate time frame. I'm not familiar with python for the web; however, I'm proficient with PHP on the web side, and python on the offline side. users should be allowed to create their own histograms, data analysis. For example, a user can search for all items that are blue shipped between week x and week y, while another user can search for sort the weight distribution of all items by hour for all year long. I was thinking of creating and indexing my own statistical tools, or automate the process somehow to emulate most queries. This seemed inefficient. I'm looking forward to hearing your ideas Thanks

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 575 576 577 578 579 580 581 582 583 584 585 586  | Next Page >