Search Results

Search found 16383 results on 656 pages for 'bi applications'.

Page 581/656 | < Previous Page | 577 578 579 580 581 582 583 584 585 586 587 588  | Next Page >

• Ability to draw and record a signature as part of a form - iphone

  - by mustic

  Apolgies in advance for any errors.. new to this and am not a developer/programmer.. just have some basic unix experience. I have searched the web and struggled to find a solution to my problem when I stumbled onto this website which maybe suggested that there is a solution to my question. For work i use a windows mobile device because we have to get customers to sign and form after a customer visit. the signature being very important. On the windows device i use the notes application and am able to record details and obtain/record (using draw) a customer signature. the form is then emailed back to HQ. The format being used is a *.pwi I have downloaded and paid for several applications for my iphone which is my preferred device and cant quite find anything that does both. the critical bit here is to be able to take a signature on the phone, save the doc in a format such as .txt, .doc or .pdf where i can control the file name then be able to email back to HQ. Am i asking too much? I hope that makes sense.. Any help would be much appreciated many thanks in advance

  Read the article

• Why Java language does not offer a way to declare getters and setters of a given "field" through ann

  - by zim2001

  I actually happily design and develop JEE Applications for quite 9 years, but I realized recently that as time goes by, I feel more and more fed up of dragging all these ugly bean classes with their bunch of getters and setters. Considering a basic bean like this : public class MyBean { // needs getter AND setter private int myField1; // needs only a getter, no setter private int myField2; // needs only a setter, no getter private int myField3; /** * Get the field1 * @return the field1 */ public int getField1() { return myField1; } /** * Set the field1 * @param value the value */ public void setField1(int value) { myField1 = value; } /** * Get the field2 * @return the field2 */ public int getField2() { return myField2; } /** * Set the field3 * @param value the value */ public void setField3(int value) { myField3 = value; } } I'm dreaming of something like this : public class MyBean { @inout(public,public) private int myField1; @out(public) private int myField2; @in(public) private int myField3; } No more stupid javadoc, just tell the important thing... It would still be possible to mix annotation and written down getters or setters, to cover cases when it should do non-trivial sets and gets. In other words, annotation would auto-generate the getter / setter code piece except when a literate one is provided. Moreover, I'm also dreaming of replacing things like that : MyBean b = new MyBean(); int v = b.getField1(); b.setField3(v+1); by such : MyBean b = new MyBean(); int v = b.field1; b.field3 = v+1; In fact, writing "b.field1" on the right side of an expression would be semantically identical to write "b.getField1()", I mean as if it has been replaced by some kind of a preprocessor. It's just an idea but I'm wondering if I'm alone on that topic, and also if it has major flaws. I'm aware that this question doesn't exactly meet the SO credo (we prefer questions that can be answered, not just discussed) so I flag it community wiki...

  Read the article

• Automatically generating Regex from set of strings residing in DB C#

  - by Muhammad Adeel Zahid

  Hello Everyone i have about 100,000 strings in database and i want to if there is a way to automatically generate regex pattern from these strings. all of them are alphabetic strings and use set of alphabets from English letters. (X,W,V) is not used for example. is there any function or library that can help me achieve this target in C#. Example Strings are KHTK RAZ given these two strings my target is to generate a regex that allows patterns like (k, kh, kht,khtk, r, ra, raz ) case insensitive of course. i have downloaded and used some C# applications that help in generating regex but that is not useful in my scenario because i want a process in which i sequentially read strings from db and add rules to regex so this regex could be reused later in the application or saved on the disk. i m new to regex patterns and don't know if the thing i m asking is even possible or not. if it is not possible please suggest me some alternate approach. Any help and suggestions are highly appreciated. regards Adeel Zahid

  Read the article

• From VB6 to .net via COM and Remoting...What a mess!

  - by Robert

  I have some legacy vb6 applications that need to talk to my .Net engine application. The engine provides an interface that can be connected to via .net Remoting. Now I have a stub class library that wraps all of the types that the interface exposes. The purpose of this stub is to translate my .net types into COM-friendly types. When I run this class library as a console application, it is able to connect to the engine, call various methods, and successfully return the wrapped types. The next step in the chain is to allow my VB6 application to call this COM enabled stub. This works fine for my main engine-entry type (IModelFetcher which is wrapped as COM_ModelFetcher). However, when I try and get any of the model fetcher's model types (IClientModel, wrapped as COM_IClientModel, IUserModel, wrapped as COM_IUserModel, e.t.c.), I get the following exception: [Exception - type: System.InvalidCastException 'Return argument has an invalid type.'] in mscorlib at System.Runtime.Remoting.Proxies.RealProxy.ValidateReturnArg(Object arg, Type paramType) at System.Runtime.Remoting.Proxies.RealProxy.PropagateOutParameters(IMessage msg, Object[] outArgs, Object returnValue) at System.Runtime.Remoting.Proxies.RealProxy.HandleReturnMessage(IMessage reqMsg, IMessage retMsg) at System.Runtime.Remoting.Proxies.RealProxy.PrivateInvoke(MessageData& msgData, Int32 type) at AWT.Common.AWTEngineInterface.IModelFetcher.get_ClientModel() at AWT.Common.AWTEngineCOMInterface.COM_ModelFetcher.GetClientModel() The first thing I did when I saw this was to handle the 'AppDomain.CurrentDomain.AssemblyResolve' event, and this allowed me to load the required assemblies. However, I'm still getting this exception now. My AssemblyResolve event handler is loading three assemblies correctly, and I can confirm that it does not get called prior to this exception. Can someone help me untie myself from this mess of interprocess communication?!

  Read the article

• How to build n-layered web architecture with PHP?

  - by Alex

  I have a description and design of a website and I need to redesign it to allow for new requirements. The website's purpose is the offering of government's contracts and bidding opportunities for different businesses.I'm dealing with the 3-tier architecture PHP website comprising of the user-interface tier(client's web browser),business logic layer(Apache web server with PHP engine in it and a couple of applications running within a web server as well) and a database layer(local mysql database). Now,i need to redesign it to su???rt distributed n-tier architecture and specify how I would go about it.After long hours of research i came to this solution: business logic should be separated into presentation and purely business logic tier to allow for n-layer architecture(user-interface,presentation tier,b.logic and data tier).I have decided to use ??? just for the presentation(since the original existing website is in PHP) and use it within apache web server.In the business logic i want to use J2?? implementation technology instead of implementing it in PHP(i.e using Zend app.server and smarty template) cz J2EE can provide much more essential container services which are essential for business logic,its robustness,maintainability and different critical business operations which will be carried out by the g?v?rnment's website.So,particularly,i want to use J??ss app.server with ?J? business objects in it which would provide all the b.logic in java and would interact with the database and so forth.In order to connect PHP on a web server with java on app.server i'm gonna use PHP/Java bridge API (or maybe Quercus or SOAP is better?).Finally,i have my data tier with mysql which will communicate with b.logic via JD??.Payment system application in ???.server is gonna use S??? to talk with credit card company. From your professional point of view,does it sound like a good way of redesigning the original website to allow for n-tier architecture considering the specifics of the website and the criticality of its operations?(payment system is included in it)or u would personally prefer to use PHP business objects for business logic as well instead of J2EE?If you have any wiser recommendation or some alternative,please let me know what is right or wrong in my current solution. H??? to hear your professional advice very s??n (I'm new to the area of web development) Thanks in advance

  Read the article

• Memory mapped files and "soft" page faults. Unavoidable?

  - by Robert Oschler

  I have two applications (processes) running under Windows XP that share data via a memory mapped file. Despite all my efforts to eliminate per iteration memory allocations, I still get about 10 soft page faults per data transfer. I've tried every flag there is in CreateFileMapping() and CreateFileView() and it still happens. I'm beginning to wonder if it's just the way memory mapped files work. If anyone there knows the O/S implementation details behind memory mapped files I would appreciate comments on the following theory: If two processes share a memory mapped file and one process writes to it while another reads it, then the O/S marks the pages written to as invalid. When the other process goes to read the memory areas that now belong to invalidated pages, this causes a soft page fault (by design) and the O/S knows to reload the invalidated page. Also, the number of soft page faults is therefore directly proportional to the size of the data write. My experiments seem to bear out the above theory. When I share data I write one contiguous block of data. In other words, the entire shared memory area is overwritten each time. If I make the block bigger the number of soft page faults goes up correspondingly. So, if my theory is true, there is nothing I can do to eliminate the soft page faults short of not using memory mapped files because that is how they work (using soft page faults to maintain page consistency). What is ironic is that I chose to use a memory mapped file instead of a TCP socket connection because I thought it would be more efficient. Note, if the soft page faults are harmless please note that. I've heard that at some point if the number is excessive, the system's performance can be marred. If soft page faults intrinsically are not significantly harmful then if anyone has any guidelines as to what number per second is "excessive" I'd like to hear that. Thanks.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• What exactly is the difference between the Dreamhost IDE and Netbeans?

  - by mikemick

  I just started using Netbeans about a week ago, and really like it thus far. Now I'm seeing something about Dreamhost IDE which I guess is a program that is built using the Netbeans platform. I use Dreamhost as the hosting company for many of my projects. What is the benefit of using Dreamhost IDE over Netbeans? Documentation on the software is non-existent from what I can tell (not even a mention in the Dreamhost wiki). All I was able to find was a short description of what it was on a Sourceforge download page, and I found a short silent video on YouTube demoing it. So I guess I'm asking, what features is it bringing to the table, and what is the difference between it and Netbeans? The description on the Sourceforge page is as follows (typos retained)... DreamHost IDE is php and ruby integrated development environment built on NetBeans IDE and provides easy deploy of your applications to the DreamHost services. Also provides you an easy eay hew to setup these services. Maybe the answer is in the description, and I just don't comprehend it?

  Read the article

• check status application pool iis7 with csharp (access-denied)

  - by jack

  I need to monitor the status of an application in the applications pool of IIS 7 from an other machine on the same domain. My monitoring application must be in C# and running as a Windows service. On my server, I create a user with administration rights and I execute the command aspnet_regiis -ga machine\username wich worked succesfully. My problem is when I try to access the application pool i still get COMExcepttion "Access denied". What did i do wrong or wich step did i miss? I used code from http://patelshailesh.com/index.php/create-a-website-application-pool-programmatically-using-csharp as example. int status = 0; string ipAddress = "10.20.2.13"; string username = "username"; string password = "password"; try { DirectoryEntry de = new DirectoryEntry(string.Format("IIS://{0}/W3SVC/AppPools/MyAppPoolName", ipAddress), username, password); //the exception is thron here. status = (int)de.InvokeGet("AppPoolState"); switch (status) { case 2: //Runnig break; case 4: //Stopped break; default: break; } } catch (Exception ex) { }

  Read the article

• Good resources for building web-app in Tapestry

  - by Rich

  Hi, I'm currently researching into Tapestry for my company and trying to decide if I think we can port our pre-existing proprietary web applications to something better. Currently we are running Tomcat and using JSP for our front end backed by our own framework that eventually uses JDBC to connect to an Oracle database. I've gone through the Tapestry tutorial, which was really neat and got me interested, but now I'm faced with what seems to be a common issue of documentation. There are a lot of things I'd need to be sure that I could accomplish with Tapestry before I'd be ready to commit fully to it. Does anyone have any good resources, be it a book or web article or anything else, that go into more detail beyond what the Tapestry tutorial explains? I am also considering integrating with Hibernate, and have read a little bit about Spring too. I'm still having a hard time understanding how Spring would be more useful than cumbersome in tandem with Tapestry,as they seem to have a lot of overlapping features. An example I read seemed to use Spring to interface with Hibernate, and then Tapestry to Spring, but I was under the impression Tapestry integrates to the same degree with Hibernate. The resource I'm speaking of is http://wiki.apache.org/tapestry/Tapstry5First_project_with_Tapestry5,_Spring_and_Hibernate . I was interested because I hadn't found information anywhere else on how to maintain user levels and sessions through a Tapestry application before, but wasn't exactly impressed by the need to use Spring in the example.

  Read the article

• Django deployment - can't import app.urls

  - by hora

  I just moved a django project to a deployment server from my dev server, and I'm having some issues deploying it. My apache config is as follows: <Location "/"> Order allow,deny Allow from all SetHandler python-program PythonHandler django.core.handlers.modpython SetEnv DJANGO_SETTINGS_MODULE project.settings PythonDebug On PythonPath "['/home/django/'] + sys.path" </Location> Django does work, since it renders the Django debug views, but I get the following error: ImportError at / No module named app.urls And here is all the information Django gives me: Request Method: GET Request URL: http://myserver.com/ Django Version: 1.1.1 Python Version: 2.6.5 Installed Applications: ['django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'django.contrib.admin', 'django.contrib.admindocs', 'project.app'] Installed Middleware: ('django.middleware.common.CommonMiddleware', 'django.contrib.sessions.middleware.SessionMiddleware', 'django.contrib.auth.middleware.AuthenticationMiddleware') Traceback: File "/usr/lib64/python2.6/site-packages/django/core/handlers/base.py" in get_response 83. request.path_info) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 218. sub_match = pattern.resolve(new_path) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in resolve 216. for pattern in self.url_patterns: File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_url_patterns 245. patterns = getattr(self.urlconf_module, "urlpatterns", self.urlconf_module) File "/usr/lib64/python2.6/site-packages/django/core/urlresolvers.py" in _get_urlconf_module 240. self._urlconf_module = import_module(self.urlconf_name) File "/usr/lib64/python2.6/site-packages/django/utils/importlib.py" in import_module 35. __import__(name) Exception Type: ImportError at / Exception Value: No module named app.urls Any ideas as to why I get an import error?

  Read the article

• decimal.TryParse() drops leading "1"

  - by Martin Harris

  Short and sweet version: On one machine out of around a hundred test machines decimal.TryParse() is converting "1.01" to 0.01 Okay, this is going to sound crazy but bare with me... We have a client applications that communicates with a webservice through JSON, and that service returns a decimal value as a string so we store it as a string in our model object: [DataMember(Name = "value")] public string Value { get; set; } When we display that value on screen it is formatted to a specific number of decimal places. So the process we use is string - decimal then decimal - string. The application is currently undergoing final testing and is running on more than 100 machines, where this all works fine. However on one machine if the decimal value has a leading '1' then it is replaced by a zero. I added simple logging to the code so it looks like this: Log("Original string value: {0}", value); decimal val; if (decimal.TryParse(value, out val)) { Log("Parsed decimal value: {0}", val); string output = val.ToString(format, CultureInfo.InvariantCulture.NumberFormat); Log("Formatted string value: {0}", output); return output; } On my machine - any every other client machine - the logfile output is: Original string value: 1.010000 Parsed decimal value: 1.010000 Formatted string value: 1.01 On the defective machine the output is: Original string value: 1.010000 Parsed decimal value: 0.010000 Formatted string value: 0.01 So it would appear that the decimal.TryParse method is at fault. Things we've tried: Uninstalling and reinstalling the client application Uninstalling and reinstalling .net 3.5 sp1 Comparing the defective machine's regional settings for numbers (using English (United Kingdom)) to those of a working machine - no differences. Has anyone seen anything like this or has any suggestions? I'm quickly running out of ideas... While I was typing this some more info came in: Passing a string value of "10000" to Convert.ToInt32() returns 0, so that also seems to drop the leading 1.

  Read the article

• Linux System Programming

  - by AJ

  I wanted to get into systems programming for linux and wanted to know how to approach that and where to begin. I come from a web development background (Python, PHP) but I also know some C and C++. Essentially, I would like to know: Which language(s) to learn and pursue (I think mainly C and C++)? How/Where to learn those languages specific to Systems Programming? Books, websites, blogs, tutorials etc. Any other good places where I can start this from basics? Any good libraries to begin with? What environment setup (or approx.) do I need? Assuming linux has to be there but I have a linux box which I rarely log into using GUI (always use SSH). Is GUI a lot more helpful or VI editor is enough? (Please let me know if this part of the question should go to serverfault.com) PS: Just to clarify, by systems programming I mean things like writing device drivers, System tools, write native applications which are not present on Linux platform but are on others, play with linux kernel etc.

  Read the article

• iPhone Landscape FAQ and Solutions

  - by Johannes Rudolph

  There has been a lot of confusion and a set of corresponding set of questions here on SO how iPhone applications with proper handling for Landscape/Portrait mode autorotation can be implemented. It is especially difficult to implement such an application when starting in landscape mode is desired. The most common observed effect are scrambled layouts and areas of the screen where touches are no longer recognized. A simple search for questions tagged iphone and landscape reveals these issues, which occur under certain scenarios: Landscape only iPhone app with multiple nibs: App started in Landscape mode, view from first nib is rendered fine, everything view loaded from a different nib is not displayed correctly. Iphone Landscape mode switching to Portraite mode on loading new controller: Self explanatory iPhone: In landscape-only, after first addSubview, UITableViewController doesn’t rotate properly: Same issue as above. iPhone Landscape-Only Utility-Template Application: Layout errors, controller does not seem to recognize the view should be rotated but displays a clipped portrait view in landscape mode, causing half of the screen to stay blank. presentModalViewController in landscape after portrait viewController: Modal views are not correctly rendered either. A set of different solutions have been presented, some of them including completely custom animation via CoreGraphics, while others build on the observation that the first view controller loaded from the main nib is always displayed correct. I have spent a significant amount of time investigating this issue and finally found a solution that is not only a partial solution but should work under all these circumstances. It is my intend with this CW post to provide sort of a FAQ for others having issues with UIViewControllers in Landscape mode. Please provide feedback and help improve the quality of this Post by incorporating any related observations. Feel free to edit and post other/better answers if you know of any.

  Read the article

• Non RBAC User Roles and Permissions System: checking the user's City

  - by micha12

  We are currently designing a User Roles and Permissions System in our web application (ASP.NET), and it seems that we have several cases that do no fit within the classical Role-Based Access Control (RBAC). I will post several questions, each devoted to a particular case, this being the first post. We have the following case: not to allow a user view a certain page if the user lives in a particular city. This is a simple case that is coded in the following way: if (User.City == “Moscow”) // Allow the user to view the page. else // Do not allow the user to view this page. Though this case is very simple and straightforward, it has nothing to do with the RBAC. On StackOverflow, someone called this an Attribute-based Access Control. Under the classical RBAC, it seems that this case should be designed like this: introduce a permission “City where the person lives”, this permission will have a property City. Then create a role, add a permission of type “City = Moscow” to it and the assign the role to the user. Looks extremely cumbersome. The question is whether it is acceptable to introduce such non-RBAC approaches to our permissions system – does that break the design or not? This might seem a primitive question, but we found that most applications use pure RBAC, and we started to think that we might be doing something wrong. Thank you.

  Read the article

• Common JNDI resources in Tomcat

  - by Lehane

  Hi, I’m running a couple of servlet applications in Tomcat (5.5). All of the servlets use a common factory resource that is shared out using JNDI. At the moment, I can get everything working by including the factory resource as a GlobalNamingResource in the /conf/server.xml file, and then having each servlet’s META-INF/context.xml file include a ResourceLink to the resource. Snippets from the XML files are included below. NOTE: I’m not that familiar with tomcat, so I’m not saying that this is a good configuration!!! However, I now want to be able install these servlets into multiple tomcat instances automatically using an RPM. The RPM will firstly copy the WARs to the webapps directory, and the jars for the factory into the common/lib directory (which is fine). But it will also need to make sure that the factory resource is included as a resource for all of the servlets. What is the best way add the resource globally? I’m not too keen on writing a script that goes into the server.xml file and adds in the resource that way. Is there any way for me to add in multiple server.xml files so that I can write a new server-app.xml file and it will concatenate my settings to server.xml? Or, better still to add this JNDI resource to all the servlets without using server.xml at all? p.s. Restarting the server will not be an issue, so I don’t mind if the changes don’t get picked up automatically. Thanks Snippet from server.xml <!-- Global JNDI resources --> <GlobalNamingResources> <Resource name="bean/MyFactory" auth="Container" type="com.somewhere.Connection" factory="com.somewhere.MyFactory"/> </GlobalNamingResources> The entire servlet’s META-INF/context.xml file <?xml version="1.0" encoding="UTF-8"?> <Context> <ResourceLink global="bean/MyFactory" name="bean/MyFactory" type="com.somewhere.MyFactory"/> </Context>

  Read the article

• DDD and Client/Server apps

  - by Christophe Herreman

  I was wondering if any of you had successfully implemented DDD in a Client/Server app and would like to share some experiences. We are currently working on a smart client in Flex and a backend in Java. On the server we have a service layer exposed to the client that offers CRUD operations amongst some other service methods. I understand that in DDD these services should be repositories and services should be used to handle use cases that do not fit inside a repository. Right now, we mimic these services on the client behind an interface and inject implementations (Webservices, RMI, etc) via an IoC container. So some questions arise: should the server expose repositories to the client or do we need to have some sort of a facade (that is able to handle security for instance) should the client implement repositories (and DDD in general?) knowing that in the client, most of the logic is view related and real business logic lives on the server. All communication with the server happens asynchronously and we have a single threaded programming model on the client. how about mapping client to server objects and vice versa? We tried DTO's but reverted back to exposing the state of our objects and mapping directly to them. I know this is considered bad practice, but it saves us an incredible amount of time) In general I think a new generation of applications is coming with the growth of Flex, Silverlight, JavaFX and I'm curious how DDD fits into this.

  Read the article

• Vanilla WPF application hangs on one customer's machine

  - by Heinzi

  At a customer, one of our WPF applications started to hang. When trying to reproduce the problem with a minimal working example, I discovered that even the most basic (non-trivial) WPF application will hang on that machine. Example A: Create a new C# WPF project in Visual Studio 2008. Change nothing, compile it and run it on the customer's machine. It will run. Example B: Take Example A, and add a TextBlock to the main form Window1: <Window ...> <Grid> <TextBlock>Test</TextBlock> </Grid> </Window> Compile the application and run it on the customer's machine. It will hang: The title bar and the window border is visible, the inside is transparent and the window does not react to anything (cannot be moved or closed). The application must be shut down using the task manager. Obviously, this customer's WPF is broken. Is this a known issue, i.e., has anyone encountered it before and already knows how to solve it (e.g. reinstall .net 3.5 SP1, etc.)? The development machine is W7SP1, the customer's machine is XP (probably SP3, didn't check).

  Read the article

• JVM/CLR Source-compatible Language Options

  - by Nathan Voxland

  I have an open source Java database migration tool (http://www.liquibase.org) which I am considering porting to .Net. The majority of the tool (at least from a complexity side) is around logic like "if you are adding a primary key and the database is Oracle use this SQL. If database is MySQL use this SQL. If the primary key is named and the database is Postgres use this SQL". I could fork the Java codebase and covert it (manually and/or automatically), but as updates and bug fixes to the above logic come in I do not want to have to apply it to both versions. What I would like to do is move all that logic into a form that can be compiled and used by both Java and .Net versions naively. The code I am looking to convert does not contain any advanced library usage (JDBC, System.out, etc) that would vary significantly from Java to .Net, so I don't think that will be an issue (at worst it can be designed around). So what I am looking for is: A language in which I can code common parts of my app in and compile it into classes usable by the "standard" languages on the target platform Does not add any runtime requirements to the system Nothing so strange that it scares away potential contributors I know Python and Ruby both have implementations on for the JVM and CLR. How well do they fit my requirements? Has anyone been successful (or unsuccesful) using this technique for cross-platform applications? Are there any gotcha's I need to worry about?

  Read the article

• Isolated storage misunderstand

  - by Costa

  Hi this is a discussion between me and me to understand isolated storage issue. can you help me to convince me about isolated storage!! This is a code written in windows form app (reader) that read the isolated storage of another win form app (writer) which is signed. where is the security if the reader can read the writer's file, I thought only signed code can access the file! If all .Net applications born equal and have all permissions to access Isolated storage, where is the security then? If I can install and run Exe from isolated storage, why I don't install a virus and run it, I am trusted to access this area. but the virus or what ever will not be trusted to access the rest of file system, it only can access the memory, and this is dangerous enough. I cannot see any difference between using app data folder to save the state and using isolated storage except a long nasty path!! I want to try give low trust to Reader code and retest, but they said "Isolated storage is actually created for giving low trusted application the right to save its state". Reader code: private void button1_Click(object sender, EventArgs e) { String path = @"C:\Documents and Settings\All Users\Application Data\IsolatedStorage\efv5cmbz.ewt\2ehuny0c.qvv\StrongName.5v3airc2lkv0onfrhsm2h3uiio35oarw\AssemFiles\toto12\ABC.txt"; StreamReader reader = new StreamReader(path); var test = reader.ReadLine(); reader.Close(); } Writer: private void button1_Click(object sender, EventArgs e) { IsolatedStorageFile isolatedFile = IsolatedStorageFile.GetMachineStoreForAssembly(); isolatedFile.CreateDirectory("toto12"); IsolatedStorageFileStream isolatedStorage = new IsolatedStorageFileStream(@"toto12\ABC.txt", System.IO.FileMode.Create, isolatedFile); StreamWriter writer = new StreamWriter(isolatedStorage); writer.WriteLine("Ana 2akol we ashrab kai a3eesh wa akbora"); writer.Close(); writer.Dispose(); }

  Read the article

• rails best practices where to place unobtrusive javascript

  - by nathanvda

  Hi there, my rails applications (all 2.3.5) use a total mix of inline javascript, rjs, prototype and jquery. Let's call it learning or growing pains. Lately i have been more and more infatuated with unobtrusive javascript. It makes your html clean, in the same way css cleaned it up. But most examples i have seen are small examples, and they put all javascript(jquery) inside application.js Now i have a pretty big application, and i am thinking up ways to structure my js. I like somehow that my script is still close to the view, so i am thinking something like orders.html.erb orders.js where orders.js contains the unobtrusive javascript specific to that view. But maybe that's just me being too conservative :) I have read some posts by Yehuda Katz about this very problem here and here, where he tackles this problem. It will go through your js-files and only load those relevant to your view. But alas i can't find a current implementation. So my questions: how do you best structure your unobtrusive javascript; manage your code, how do you make sure that it is obvious from the html what something is supposed to do. I guess good class names go a long way :) how do you arrange your files, load them all in? just a few? do you use content_for :script or javascript_include_tag in your view to load the relevant scripts. Or ... ? do you write very generic functions (like a delete), with parameters (add extra attributes?), or do you write very specific functions (DRY?). I know in Rails 3 there is a standard set, and everything is unobtrusive there. But how to start in Rails 2.3.5? In short: what are the best practices for doing unobtrusive javascript in rails? :)

  Read the article

• crawl websites out of java web application without using bin/nutch

  - by Marcel

  hi :) i am trying to using nutch (1.1) without bin/nutch from my (java) mojarra 2.0.2 webapp... i am searching at google for examples, but there are no examples how i can realize this :/ ... i get an exception and the job fails :/ (i think of cause something with hadoop)... here is my code: public void run() throws Exception { final String[] args = new String[] { String.format("%s%s%s%s", JSFUtils.getWebAppRoot(), "nutch", File.separator, DIRECTORY_URLS), "-dir", String.format("%s%s%s%s", JSFUtils.getWebAppRoot(), "nutch", File.separator, DIRECTORY_CRAWL), "-threads", this.preferences.get("threads"), "-depth", this.preferences.get("depth"), "-topN", this.preferences.get("topN"), "-solr", this.preferences.get("solr") }; Crawl.main(args); } and a part of the logging: 10/05/17 10:42:54 INFO jvm.JvmMetrics: Initializing JVM Metrics with processName=JobTracker, sessionId= 10/05/17 10:42:54 WARN mapred.JobClient: Use GenericOptionsParser for parsing the arguments. Applications should implement Tool for the same. 10/05/17 10:42:54 INFO mapred.FileInputFormat: Total input paths to process : 1 10/05/17 10:42:54 INFO mapred.JobClient: Running job: job_local_0001 10/05/17 10:42:54 INFO mapred.FileInputFormat: Total input paths to process : 1 10/05/17 10:42:55 INFO mapred.MapTask: numReduceTasks: 1 10/05/17 10:42:55 INFO mapred.MapTask: io.sort.mb = 100 java.io.IOException: Job failed! at org.apache.hadoop.mapred.JobClient.runJob(JobClient.java:1232) at org.apache.nutch.crawl.Injector.inject(Injector.java:211) at org.apache.nutch.crawl.Crawl.main(Crawl.java:124) at lan.localhost.process.NutchCrawling.run(NutchCrawling.java:108) at lan.localhost.main.Index.indexing(Index.java:71) at lan.localhost.bean.FeedingBean.actionStart(FeedingBean.java:25) .... can someone help me or tell me how i can crawling from a java application? i have increased the Xms to 256m and Xmx to 768m, but nothing changed... best regards marcel

  Read the article

• Enterprise Eclipse Provisioning - Or - How to share your standard Eclipse setup with other developer

  - by nikhil

  We use Eclipse as the IDE for developing all sorts of Java/J2EE applications in our 150 people odd IT department. One of the common problems we have been seeing is that developers download and install different versions of Eclipse and plugins based on their personal likes and dislikes. We have been trying to bring some consistency to this and have standardized on the version and the plugins that developers should be using. So the problem now is how do we distribute this installation to the team. We have zipped the directories and shared it through a shared drive. But I am looking for a better solution using some kind of provisioning tool for Eclipse using which people can install the IDE or get updates. Has anyone faced this problem? What are your solutions to this? How do you ensure a standard Eclipse environment across developers? I found Yoxos as a potential solution to this. Does anyone have any experience with it? Can p2 be used to do this?

  Read the article

• How can I effectively test against the Windows API?

  - by Billy ONeal

  I'm still having issues justifying TDD to myself. As I have mentioned in other questions, 90% of the code I write does absolutely nothing but Call some Windows API functions and Print out the data returned from said functions. The time spent coming up with the fake data that the code needs to process under TDD is incredible -- I literally spend 5 times as much time coming up with the example data as I would spend just writing application code. Part of this problem is that often I'm programming against APIs with which I have little experience, which forces me to write small applications that show me how the real API behaves so that I can write effective fakes/mocks on top of that API. Writing implementation first is the opposite of TDD, but in this case it is unavoidable: I do not know how the real API behaves, so how on earth am I going to be able to create a fake implementation of the API without playing with it? I have read several books on the subject, including Kent Beck's Test Driven Development, By Example, and Michael Feathers' Working Effectively with Legacy Code, which seem to be gospel for TDD fanatics. Feathers' book comes close in the way it describes breaking out dependencies, but even then, the examples provided have one thing in common: The program under test obtains input from other parts of the program under test. My programs do not follow that pattern. Instead, the only input to the program itself is the system upon which it runs. How can one effectively employ TDD on such a project?

  Read the article

• Linux Lightweight Distro and X Windows for Development

  - by Fernando Barrocal

  Heyall... I want to build a lightweight linux configuration to use for development. The first idea is to use it inside a Virtual Machine under Windows, or old Laptops with 1Gb RAM top. Maybe even a distributable environment for developers. So the whole idea is to use a LAMP server, Java Application Server (Tomcat or Jetty) and X Windows (any Window manager, from FVWM to Enlightment), Eclipse, maybe jEdit and of course Firefox. Edit: I am changing this post to compile a possible list of distros and window managers that can be used to configure a real lightweight development environment. I am using as base personal experiences on this matter. Info about the distros can be easily found in their sites. So please, focus on personal use of those systems Distros Ubuntu / Xubuntu Pros: Personal Experience in old systems or low RAM environment - @Schroeder, @SCdF Several sugestions based on personal knowledge - @Kyle, @Peter Hoffmann Gentoo Pros: Not targeted to Desktop Users - @paan Don't come with a huge ammount of applications - @paan Slackware Pros: Suggested as best performance in a wise install/configuration - @Ryan Damn Small Linux Pros: Main focus is the lightweight factor - 50MB LiveCD - @Ryan Debian Pros: Very versatile, can be configured for both heavy and lightweight computers - @Ryan APT as package manager - @Kyle Based on compatibility and usability - @Kyle -- Fell Free to add Prós and Cons on this, so we can compile a good Reference. -- X Windows suggestion keep coming about XFCE. If others are to add here, open a session for it Like the distro one :)

  Read the article

< Previous Page | 577 578 579 580 581 582 583 584 585 586 587 588  | Next Page >