Search Results

Search found 28590 results on 1144 pages for 'albo best'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 588/1144 | < Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >

  • Is Borland C++ v3 for DOS available anywhere now?

    - by Galwegian
    Hi, I'm looking for a copy of either Borland C++ v3 or Turbo C++ which can run on DOS, but my searches are turning up a blank. I vaguely remember a free Turbo version available, but can't track it down. Are there free/pay versions of these still available? Is http://www.embarcadero.com my best hope? Thanks for any info...

    Read the article

  • How do I use a string as a keyword argument?

    - by Issac Kelly
    Specifically, I'm trying to use a string to arbitrairly filter the ORM. I've tried exec and eval solutions, but I'm running into walls. The code below doesn't work, but it's the best way I know how to explain where I'm trying to go from gblocks.models import Image f = 'image__endswith="jpg"' # Would be scripted in another area, but passed as text <user input> d = Image.objects.filter(f) #for the non-django pythonistas: d = Image.objects.filter(image__endswith="jpg") # would be the non-dynamic equivalent.

    Read the article

  • Passing login details between pages in jQuery Mobile?

    - by manraj82
    I am a newbie to jQuery Mobile and trying to come with the best and scure way of passing login details between pages in jQuery Mobile.I did a quick search and found some solutions, Solution 1 :Since its the same dom data can be accessed using plain old variables. Solution 2 :Use HTML5 sessionStorage I have not found anymore solutions yet.If some one has successfully implemented this,could you please advise how I should go about doing this? Thank You

    Read the article

  • PHP ingore case sensitivity when comparing array values

    - by dan.codes
    I have to modify some code in a application I am working on that is using the array_diff($array1,$array2) method. The problem I am having is it is case sensitive and I need to have it return the correct value if the array values match even if the case is different. I don't want to change the case to lowercase because I need the value returned to keep its case. I'm a little confused as the best method to do this.

    Read the article

  • SQLite and Portuguese-br characters

    - by ForeignerBR
    I'm developing an app that requires the storage of Portuguese characters. I was wondering if I need to do any configuration to prepare my SQLite db to store those considered special characters. When I query a db table that contains those characters I get a '?' (without quotes) in their place. best regards, mp

    Read the article

  • Distinguish between single and double click events in Qt

    - by Jesse
    I have a QAbstractItemView that needs to react to single and double click events. The actions are different depending on whether it was single clicked or double clicked. The problem that is occurring is that the single click event is received prior to the double click event. Is there a recommended way/best practice for distinguishing between the two? I don't want to perform the single click action when the user has actually double clicked. I am using Qt 4.6

    Read the article

  • Inter process communication C# <--> C++ for game debugging engine.

    - by Andy
    I am working on a debugger project for a game's scripting engine. I'm hoping to write the debugger's GUI in C#. The actual debugging engine, however, is embedded in the game itself and is written in a mixture of C, C++, and assembly patches. What's the best way to handle communication between the debugger GUI and the debugging engine? The two will be running in separate processes. Thanks! Andy

    Read the article

  • Letting users try your web app before sign-up: sessions or temp db?

    - by Mat
    I've seen a few instances now where web applications are letting try them out without you having to sign-up (though to save you need to of course). example: try at http://minutedock.com/ I'm wondering about doing this for my own web app and the fundamental question is whether to store their info into sessions or into a temp user table? The temp user table would allow logging and potentially be less of a hit on the server, correct? Is there a best practice here?

    Read the article

  • Should HTML be encoded before being persisted?

    - by Sir Psycho
    Should HTML be encoded before being stored in say, a database? Or is it normal practice to encode on its way out to the browser? Should all my text based field lengths be quadrupled in the database to allow for extra storage? Looking for best practice rather than a solid yes or no :-)

    Read the article

  • Run python in a separate process

    - by Bialecki
    I'm looking for a quick bash script or program that will allow me to kick off a python script in a separate process. What's the best way to do this? I know this is incredibly simple, just curious if there's a preferred way to do it.

    Read the article

  • Eclipse project artefacts in Maven repository

    - by Georgios Gousios
    I want to use some of the libraries produced by the Eclipse project through Maven. I 've had a look at the main Maven repo and while it looks like that there are a few projects already imported, their versions are old and some important ones are missing (e.g. cdt). Is there any Eclipse project official Maven repository? If not, what would be the best option to use current versions of libraries such as the JDT compiler in a maven-enabled project?

    Read the article

  • Which is clearer form: if(!value) or if(flag == value) ?

    - by CodexArcanum
    I understand this is a subjective question, so I apologize if it needs to be closed, but I feel like it comes up often enough for me to wonder if there is a general preference for one form over the other. Obviously, the best answer is "refactor the code so you don't need to test for falsehood" but sometimes there's no easy way to do so and the "else" branch is simply to continue processing. So when you must have an "if not false" construct, which is the preferred standard: The not operator if(!value) Or the test for false if(value == false)

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • Is it possible to resize text to fit a fixed size div?

    - by int3
    This seems like a pretty natural use case to me, though I haven't been able to find anything on it: Say I have a fixed-width div that is dynamically populated with some number. What's the best way to ensure that numbers with more digits take smaller font sizes such that they fit nicely into that fixed width? Is there some CSS property for this, or do I have to resort to Javascript hackage?

    Read the article

  • PHP echo query result in Class??

    - by Jerry
    Hi all I have a question about PHP Class. I am trying to get the result from Mysql via PHP. I would like to know if the best practice is to display the result inside the Class or store the result and handle it in html. For example, display result inside the Class class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); } while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ //display the result..ex: echo $row['winner']; } mysql_close($scheduleQuery); //no returns } } Or return the query result as a variable and handle in php class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); // create an array } $ret = array(); while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ $ret[]=$row; } mysql_close($scheduleQuery); return $ret; // and handle the return value in php } } Two things here: I found that returned variable in php is a little bit complex to play with since it is two dimension array. I am not sure what the best practice is and would like to ask you experts opinions. Every time I create a new method, I have to recreate the $connection variable: see below $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } It seems like redundant to me. Can I only do it once instead of calling it anytime I need a query? I am new to php class. hope you guys can help me. thanks.

    Read the article

  • Play audio file on hover

    - by powtac
    What is the best solution to play an audio file on mouse over via JavaScript? And stop it when the mouse leaves the link. jQuery is available. <a href="/test.mp3" class="play">play</a>

    Read the article

  • I simple search controller that stores search history, should I use resource routing or non-resource?

    - by vfilby
    I am learning rails and am toying with a simple web-app that integrates with flickr to search photos based on user given criteria and store the query in a search history table. I am seeking the best or 'rails' way of handling this. Should I setup a controller and non-resource routes that handle the search and store the data in a custom table; or should I create a resource for queries with a resource route and an additional path for search?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Rearrange items in ListBox

    - by superexsl
    Hey, I have a ListBox with a number of ListBoxItem objects. What is the best way to allow users to rearrange the items by dragging and dropping? Do I have to use StackPanels instead? Thanks for any suggestions

    Read the article

  • Sanitising user input using Python

    - by Steve
    What's the best way to sanitise user input for a Python-based web application? Is there a single function to remove HTML characters and any other necessary characters combinations to ensure that an XSS or SQL injection attack isn't possible?

    Read the article

  • Undo/Redo using Memento: Stack, Queue or just LinkedList?

    - by serhio
    What is the best having when implementing Memento pattern (for Undo/Redo) in witch collection to Keep Mementos? Basically, I need this(c = change, u = undo, r = redo): 0 *c -1 0 *c -2 -1 0 *c -3 -2 -1 0 <u -2 -1 0 1 *c -3 -2 -1 0 Variants: LinkedList - possible in principle, maybe not optimized. Queue - not adapted for this task, IMO. Stack - not adapted for undo AND redo; Double Stack - maybe optimal, but can't control the undo maximum size.

    Read the article

  • Redis - which PHP module to use?

    - by Patrick
    If i check redis php supported language (http://code.google.com/p/redis/wiki/SupportedLanguages), there's 4 PHP ones: Redis PHP Bindings,phpredis,Predis,Redisent. Question is, which is the best and good to use? Thanks!

    Read the article

  • How to localize ASP .Net MVC application?

    - by pirho
    What would be best practice to localize your ASP .Net MVC application ? I would like to cover two situations: one application deployment in IIS which would handle multiple languages one language / application deployment. In first situation should you go with somekind of view based thing like, ~/View/EN, ~/View/FI, ~/View/SWE or something different ? What about second case, just application based config via Web.config and point these different languages to different urls ?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >