Search Results

Search found 28593 results on 1144 pages for 'best pratices'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 588/1144 | < Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >

  • OpenGL: Implementing transformation matrix stack

    - by Jakub M.
    In a newer OpenGL there is no matrix stack. I am working on a simple display engine, and I am going to implement the transformation stack. What is a common strategy here? Should I build a push/pop stack, and use it with a tree representing my model? I suppose this is the "old" approach, that was deprecated in the newer OpenGL versions. Maybe then it is not the best solution (it was removed for some reason)

    Read the article

  • Programmatically add an application to Windows Firewall

    - by RichieACC
    I have an application that is installed and updated via ClickOnce. The application downloads files via FTP, and therefore needs to be added as an exception to the windows firewall. Because of the way that ClickOnce works, the path to the EXE changes with every update, so the exception needs to change also. What would be the best way to have the changes made to the firewall so that it's invisible to the end user? (The application is written in C#)

    Read the article

  • Play audio file on hover

    - by powtac
    What is the best solution to play an audio file on mouse over via JavaScript? And stop it when the mouse leaves the link. jQuery is available. <a href="/test.mp3" class="play">play</a>

    Read the article

  • Get just the hour of day from DateTime using either 12 or 24 hour format as defined by the current c

    - by InvisibleBacon
    .Net has the built in ToShortDateString() function for DateTime that uses the CultureInfo.CurrentCulture.DateTimeFormat.ShortTimePattern format. It returns something like this for en-US: "5:00 pm". For a 24 hour culture such as de-DE it would return "17:00". What I want is a way to just return just the hour (So "5 pm" and "17" in the cases above) that works with every culture. What's the best/cleanest way to do this? Thanks!

    Read the article

  • Is it possible to resize text to fit a fixed size div?

    - by int3
    This seems like a pretty natural use case to me, though I haven't been able to find anything on it: Say I have a fixed-width div that is dynamically populated with some number. What's the best way to ensure that numbers with more digits take smaller font sizes such that they fit nicely into that fixed width? Is there some CSS property for this, or do I have to resort to Javascript hackage?

    Read the article

  • Should HTML be encoded before being persisted?

    - by Sir Psycho
    Should HTML be encoded before being stored in say, a database? Or is it normal practice to encode on its way out to the browser? Should all my text based field lengths be quadrupled in the database to allow for extra storage? Looking for best practice rather than a solid yes or no :-)

    Read the article

  • PHP ingore case sensitivity when comparing array values

    - by dan.codes
    I have to modify some code in a application I am working on that is using the array_diff($array1,$array2) method. The problem I am having is it is case sensitive and I need to have it return the correct value if the array values match even if the case is different. I don't want to change the case to lowercase because I need the value returned to keep its case. I'm a little confused as the best method to do this.

    Read the article

  • Which is clearer form: if(!value) or if(flag == value) ?

    - by CodexArcanum
    I understand this is a subjective question, so I apologize if it needs to be closed, but I feel like it comes up often enough for me to wonder if there is a general preference for one form over the other. Obviously, the best answer is "refactor the code so you don't need to test for falsehood" but sometimes there's no easy way to do so and the "else" branch is simply to continue processing. So when you must have an "if not false" construct, which is the preferred standard: The not operator if(!value) Or the test for false if(value == false)

    Read the article

  • Eclipse project artefacts in Maven repository

    - by Georgios Gousios
    I want to use some of the libraries produced by the Eclipse project through Maven. I 've had a look at the main Maven repo and while it looks like that there are a few projects already imported, their versions are old and some important ones are missing (e.g. cdt). Is there any Eclipse project official Maven repository? If not, what would be the best option to use current versions of libraries such as the JDT compiler in a maven-enabled project?

    Read the article

  • Run python in a separate process

    - by Bialecki
    I'm looking for a quick bash script or program that will allow me to kick off a python script in a separate process. What's the best way to do this? I know this is incredibly simple, just curious if there's a preferred way to do it.

    Read the article

  • WCF MSMQ consumer thread count

    - by Andy White
    What's the best way to configure the maximum number of threads that can pull messages from an MSMQ queue, using a netMsmqBinding in WCF? For example, say I have an MSMQ service for which I only want to have 2 (or 10, or whatever number of) worker threads pulling messages off at a time.

    Read the article

  • Passing login details between pages in jQuery Mobile?

    - by manraj82
    I am a newbie to jQuery Mobile and trying to come with the best and scure way of passing login details between pages in jQuery Mobile.I did a quick search and found some solutions, Solution 1 :Since its the same dom data can be accessed using plain old variables. Solution 2 :Use HTML5 sessionStorage I have not found anymore solutions yet.If some one has successfully implemented this,could you please advise how I should go about doing this? Thank You

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • PHP echo query result in Class??

    - by Jerry
    Hi all I have a question about PHP Class. I am trying to get the result from Mysql via PHP. I would like to know if the best practice is to display the result inside the Class or store the result and handle it in html. For example, display result inside the Class class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); } while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ //display the result..ex: echo $row['winner']; } mysql_close($scheduleQuery); //no returns } } Or return the query result as a variable and handle in php class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); // create an array } $ret = array(); while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ $ret[]=$row; } mysql_close($scheduleQuery); return $ret; // and handle the return value in php } } Two things here: I found that returned variable in php is a little bit complex to play with since it is two dimension array. I am not sure what the best practice is and would like to ask you experts opinions. Every time I create a new method, I have to recreate the $connection variable: see below $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } It seems like redundant to me. Can I only do it once instead of calling it anytime I need a query? I am new to php class. hope you guys can help me. thanks.

    Read the article

  • Letting users try your web app before sign-up: sessions or temp db?

    - by Mat
    I've seen a few instances now where web applications are letting try them out without you having to sign-up (though to save you need to of course). example: try at http://minutedock.com/ I'm wondering about doing this for my own web app and the fundamental question is whether to store their info into sessions or into a temp user table? The temp user table would allow logging and potentially be less of a hit on the server, correct? Is there a best practice here?

    Read the article

  • Warning: pointer of type 'void *' used in subtraction

    - by idealistikz
    Although it runs correctly, the following results in the aforementioned compiler warning: return ((item - (my->items))/(my->itemSize)); 'item' is a 'void *'; 'my-items' is a 'void *'; 'my-itemSize' is an 'int' Casting 'item' and 'my-items' as an 'int *' caused the program to run improperly. What is the best way to remove the warning?

    Read the article

  • I simple search controller that stores search history, should I use resource routing or non-resource?

    - by vfilby
    I am learning rails and am toying with a simple web-app that integrates with flickr to search photos based on user given criteria and store the query in a search history table. I am seeking the best or 'rails' way of handling this. Should I setup a controller and non-resource routes that handle the search and store the data in a custom table; or should I create a resource for queries with a resource route and an additional path for search?

    Read the article

  • Archiving sharepoint site instade of deleting

    - by Sachin
    Hi All, I have a sharepoint site. This site large nubmer of site and sub site sollection in it. There are few that are created and are not in use. Now my questuion is how can I findout these old sites and before going deleting I have to first archive it. Can any one tell me what is the best possible approach to do it?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • wpf Image resources and visual studio 2010 resource editor

    - by Berryl
    Hello My motivation for this question is really just to specify an image to be used in a user control via a dependency property for ImageSource. I'm hitting some pain points involving the management, access, and unit testing for this. Is the resource editor a good tool to use to maintain images for the application? What is the best way to translate the Bitmap from the editor to an ImageSource? How can I grab the resource Filename from the editor? Cheers, Berryl

    Read the article

  • Is there a method to include CSS background images in print?

    - by jitendra
    Is there a method to include CSS background images in print? If i use image replace techniques for (which is considered as a best practice) Logo then logo doesn't come in print. and many places in site CSS background is saving bandwidth and my time both. but client is asking to include many things in print also. What should i do?

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 584 585 586 587 588 589 590 591 592 593 594 595  | Next Page >