Search Results

Search found 37183 results on 1488 pages for 'string conversion'.

Page 592/1488 | < Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >

  • List input and output audio devices in Applet

    - by Jhonny Everson
    I am running a signed applet that needs to provide the ability for the user to select the input and output audio devices ( similar to what skype provides). I borrowed the following code from other thread: import javax.sound.sampled.*; public class SoundAudit { public static void main(String[] args) { try { System.out.println("OS: "+System.getProperty("os.name")+" "+ System.getProperty("os.version")+"/"+ System.getProperty("os.arch")+"\nJava: "+ System.getProperty("java.version")+" ("+ System.getProperty("java.vendor")+")\n"); for (Mixer.Info thisMixerInfo : AudioSystem.getMixerInfo()) { System.out.println("Mixer: "+thisMixerInfo.getDescription()+ " ["+thisMixerInfo.getName()+"]"); Mixer thisMixer = AudioSystem.getMixer(thisMixerInfo); for (Line.Info thisLineInfo:thisMixer.getSourceLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Source Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}} for (Line.Info thisLineInfo:thisMixer.getTargetLineInfo()) { if (thisLineInfo.getLineClass().getName().equals( "javax.sound.sampled.Port")) { Line thisLine = thisMixer.getLine(thisLineInfo); thisLine.open(); System.out.println(" Target Port: " +thisLineInfo.toString()); for (Control thisControl : thisLine.getControls()) { System.out.println(AnalyzeControl(thisControl));} thisLine.close();}}} } catch (Exception e) {e.printStackTrace();}} public static String AnalyzeControl(Control thisControl) { String type = thisControl.getType().toString(); if (thisControl instanceof BooleanControl) { return " Control: "+type+" (boolean)"; } if (thisControl instanceof CompoundControl) { System.out.println(" Control: "+type+ " (compound - values below)"); String toReturn = ""; for (Control children: ((CompoundControl)thisControl).getMemberControls()) { toReturn+=" "+AnalyzeControl(children)+"\n";} return toReturn.substring(0, toReturn.length()-1);} if (thisControl instanceof EnumControl) { return " Control:"+type+" (enum: "+thisControl.toString()+")";} if (thisControl instanceof FloatControl) { return " Control: "+type+" (float: from "+ ((FloatControl) thisControl).getMinimum()+" to "+ ((FloatControl) thisControl).getMaximum()+")";} return " Control: unknown type";} } But what I get: Mixer: Software mixer and synthesizer [Java Sound Audio Engine] Mixer: No details available [Microphone (Pink Front)] I was expecting the get the real list of my devices (My preferences panels shows 3 output devices and 1 Microphone). I am running on Mac OS X 10.6.7. Is there other way to get that info from Java?

    Read the article

  • How do I require that an element has either one set of attributes or another in an XSD schema?

    - by Eli Courtwright
    I'm working with an XML document where a tag must either have one set of attributes or another. For example, it needs to either look like <tag foo="hello" bar="kitty" /> or <tag spam="goodbye" eggs="world" /> e.g. <root> <tag foo="hello" bar="kitty" /> <tag spam="goodbye" eggs="world" /> </root> So I have an XSD schema where I use the xs:choice element to choose between two different attribute groups: <xsi:schema xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema" attributeFormDefault="unqualified" elementFormDefault="qualified"> <xs:element name="root"> <xs:complexType> <xs:sequence> <xs:element maxOccurs="unbounded" name="tag"> <xs:choice> <xs:complexType> <xs:attribute name="foo" type="xs:string" use="required" /> <xs:attribute name="bar" type="xs:string" use="required" /> </xs:complexType> <xs:complexType> <xs:attribute name="spam" type="xs:string" use="required" /> <xs:attribute name="eggs" type="xs:string" use="required" /> </xs:complexType> </xs:choice> </xs:element> </xs:sequence> </xs:complexType> </xs:element> </xsi:schema> However, when using lxml to attempt to load this schema, I get the following error: >>> from lxml import etree >>> etree.XMLSchema( etree.parse("schema_choice.xsd") ) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "xmlschema.pxi", line 85, in lxml.etree.XMLSchema.__init__ (src/lxml/lxml.etree.c:118685) lxml.etree.XMLSchemaParseError: Element '{http://www.w3.org/2001/XMLSchema}element': The content is not valid. Expected is (annotation?, ((simpleType | complexType)?, (unique | key | keyref)*))., line 7 Since the error is with the placement of my xs:choice element, I've tried putting it in different places, but no matter what I try, I can't seem to use it to define a tag to have either one set of attributes (foo and bar) or another (spam and eggs). Is this even possible? And if so, then what is the correct syntax?

    Read the article

  • Indexing Service: getting empty columns on custom properties

    - by itchi
    I'm following this example: http://www.codinghorror.com/blog/2005/12/getting-started-with-indexing-service.html However, the conversion to dataset shows empty columns for my custom properties. If I use path or filename for the columns I get data back. I have set the properties to be cached, have tried both levels, and have rescanned full. I've tried this example on my desktop (windows vista 32bit) and on a Windows 2008 R2 server with the same results.

    Read the article

  • Error while creating tests in Visual Studio

    - by Benjol
    When I try to generate a unit test for the following method (in a public static class) private static string[] GetFields(string line, char sep) { char[] totrim = { '"', ' ' }; return line.Split(sep).Select(col => col.Trim(totrim)).ToArray(); } The Tests output says: While trying to generate your tests, the following errors occurred: This method or property cannot be called within an event handler. It works if I make the function public - I've tried running Publicize.exe manually, it doesn't complain, but doesn't make any difference either.

    Read the article

  • Regex in Python

    - by newToProgramming
    SO, I am trying create a simple regex that matches the following string: ..."chrX:33267175-33267784 610bp TGATGTTTGGCGAGGAACTC GCAGAGTTTGAAGAGCTCGG\nTGATGTTTGGCGAGGAACTCtactattgttacacttaggaaaataatcta\natccaaaggctttgcatctgtacagaagagcgagtagatactgaaagaga\ntttgcagatccactgttttttaggcaggaagaatgctcgttaaatgcaaa\ncgctgctctggctcatgtgtttgctccgaggtataggttttgttcgactg\nacgtatcagatagtcagagtggttaccacaccgacgttgtagcagctgca\ntaataaatgactgaaagaatcatgttaggcatgcccacctaacctaactt\ngaatcatgcgaaaggggagctgttggaattcaaatagactttctggttcc\ncagcagtcggcagtaatagaatgctttcaggaagatgacagaatcaggag\naaagatgctgttttgcactatcttgatttgttacagcagccaacttattg\ngcatgatggagtgacaggaaaaacagctggcatggaaggtaggattatta\naagctattacatcattacaaatacaattagaagctggccatgacaaagca\ntatgtttgaacaagcagctgttggtagctggggtttgttgCCGAGCTCTT\nCAAACTCTGC\n"... I have created the following regex: <PRE>[.|[\n]]*</PRE>' yet it won't match the string above. Does anyone have a solution to this conundrum and perhaps a reasoning as toward why this doesn't work.

    Read the article

  • regex split problem

    - by sunil-mand99
    I have javascript string variable with var sttr="We prefer questions that can be answered --------------------- not just discussed --------------------- Provide details ---------------------------- Write clearly and simply --------------------------answer all the question" please suggest how to split the string into array of sentences on the basis of dashes(-----) using regex result should be array[0]=We prefer questions that can be answered array[1]=not just discussed array[2]=Provide details array[3]=rite clearly and simply array[4]=answer all the question Note: dash(-----) range after each sentence is between 10 to 50

    Read the article

  • Grails - Self Join

    - by WaZ
    Hi, When I write the following class, I get the following compilation error: could not resolve property How can I achive the following: class Employee{ String Name String Email Employee Manager static hasMany = [desginations:Designation] static constraints = { Name(unique:true) Email(unique:true) } Thanks, Much appreciated.

    Read the article

  • Regex - find only replace occurences not touching some of them

    - by vittore
    Not very good at regex though and maybe that's a stupid question, I'm given string like "bla @a bla @a1 bla " I'm also pairs like {"a", "a2"} , {"a1", "a13"}, and am to replace @a to @a2 for first pair, and @a1 to @a13 for second one. The problem is when i use string.replace and look for @a , it also replaces @a1 but it should not. Help me with regex replace, please. Cheers

    Read the article

  • Endian check in C

    - by webgenius
    Got this code snippet from some website: int num = 1; if(*(char *)&num == 1) { printf("\nLittle-Endian\n"); } else { printf("Big-Endian\n"); } Can anyone explain this step-by-step? &num - Adress of a (char *)&num - Type-cast address of a into a string *(char *)&num - Points to the first character of the string Am I missing anything here?

    Read the article

  • Find items is SSRS by Id

    - by chief7
    How do you find items in SSRS by ID? I tried to use the id returned by another find result, a new guid to string and small random string all of which return the same error: The ID field has a value that is not valid. --- Microsoft.ReportingServices.Diagnostics.Utilities.InvalidElementException: The ID field has a value that is not valid. Here is the code: var request = new FindItemsRequest { Conditions = new[] { new SearchCondition { Name = "ID", Value = "test"} }, Folder = "/" }; return _ssrsService .FindItems(request) .Items I'm using SSRS 2005.

    Read the article

  • Can I make Axis2 generate a WSDL with 'unwrapped' types?

    - by Bedwyr Humphreys
    I'm trying to consume a hello world AXIS2 SOAP web service using a PHP client. The Java class is written in Netbeans and the AXIS2 aar file is generated using the Netbeans AXIS2 plugin. You've all seen it before but here's the java class: public class SOAPHello { public String sayHello(String username) { return "Hello, "+username; } } The wsdl genereated by AXIS2 seems to wrap all the parameters so that when I consume the service i have to use a crazy PHP script like this: $client = new SoapClient("http://myhost:8080/axis2/services/SOAPHello?wsdl"); $parameters["username"] = "Dave"; $response = $client->sayHello($parameters)->return; echo $response."!"; When all I really want to do is echo $client->sayHello("Dave")."!"; My question is two-fold: why is this happening? and what can I do to stop it? :) Here's are the types, message and porttype sections of the generated wsdl: <wsdl:types> <xs:schema attributeFormDefault="qualified" elementFormDefault="qualified" targetNamespace="http://soap.axis2.myhost.co.uk"> <xs:element name="sayHello"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="username" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> <xs:element name="sayHelloResponse"> <xs:complexType> <xs:sequence> <xs:element minOccurs="0" name="return" nillable="true" type="xs:string"/> </xs:sequence> </xs:complexType> </xs:element> </xs:schema> </wsdl:types> <wsdl:message name="sayHelloRequest"> <wsdl:part name="parameters" element="ns:sayHello"/> </wsdl:message> <wsdl:message name="sayHelloResponse"> <wsdl:part name="parameters" element="ns:sayHelloResponse"/> </wsdl:message> <wsdl:portType name="SOAPHelloPortType"> <wsdl:operation name="sayHello"> <wsdl:input message="ns:sayHelloRequest" wsaw:Action="urn:sayHello"/> <wsdl:output message="ns:sayHelloResponse" wsaw:Action="urn:sayHelloResponse"/> </wsdl:operation> </wsdl:portType>

    Read the article

  • Filter a form using a command button on another form

    - by Shaun
    I have a form with a cmdbutton that at the moment opens another form and shows all records for several types of PartitionStyles and TrimFinishs (486 at present), I need to be able to filter the second form to show only the TrimFinish I need. Private Sub lbl600SeriesS_Click() Dim stDocName As String Dim stLinkCriteria As String stDocName = "frmModules" stLinkCriteria = "Forms!frmModules![TrimFinish] = 1" DoCmd.OpenForm stDocName, , , stLinkCriteria End Sub At the moment it shows only a new record, I know there should be 162 records using 1, what have I missed or done incorrect.

    Read the article

  • How can we define more than one table,define columns and write data in xml file ?

    - by Harikrishna
    I am writing my xml file manually. And I am writing that for storing data and retrieving data from that. I have written file like for the table PersonalInfo. <?xml version="1.0" standalone="yes"?> <PersonalInfo> <xs:schema id="PersonalInfo" xmlns="" xmlns:xs="http://www.w3.org/2001/XMLSchema" xmlns:msdata="urn:schemas-microsoft-com:xml-msdata"> <xs:element name="PersonalInfo" msdata:IsDataSet="true" msdata:UseCurrentLocale="true"> <xs:complexType> <xs:choice minOccurs="0" maxOccurs="unbounded"> <xs:element name="PesonalInfo."> <xs:complexType> <xs:sequence> <!--Define Column Here....--> <xs:element name="name" type="xs:string" /> <xs:element name="address" type="xs:string" /> </xs:sequence> </xs:complexType> </xs:element> </xs:choice> </xs:complexType> </xs:element> </xs:schema> <!--First Row--> <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <!--Second Row--> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> </PersonalInfo> Please suggest any mistake with writing file here. And now I want define more than table in this file. And here I have to write data for the table like <PersonalInfo.> <name>Harikrishna</name> <address>India</address> </PersonalInfo.> <PersonalInfo.> <name>Jatin</name> <address>India</address> </PersonalInfo.> Is not possible some thing writing data when defining columns EDIT : <xs:element name="name" type="xs:string",Harikrishna,Jatin.... /> <xs:element name="address" type="xs:string",India,India.... /> And how to define more than one table in a single xml file ?

    Read the article

  • Get the type name

    - by Neir0
    How i can get full right name of generic type? For example: This code typeof(List<string>).Name return List`1 instead of List<string> How to get a right name?

    Read the article

  • LINQ - array property contains element from another array

    - by Rob
    I have a object (product), with a property of type 'array' e.g. product.tags = {"tag1","tag2","tag9"} I have an array of input tags to filter on. ... but this is not quite working: List<string> filterTags = new List<string>() { "tag1", "tag3" }; var matches = from p in products where p.Tags.Contains(filterTags) select p; Any recommendations? Thanks.

    Read the article

  • Html code clearner

    - by Blanca
    Hi! Is there any library or method to input a String with html code, and which has a return value another String whitout this htmlo code, just the information??? I am watching libraries such JTidy, or HtmlParser, but I don't know how to use it! Something easier??? Thank you!

    Read the article

  • regex question: independent position of words

    - by Fuxi
    hi all, is it possible to define a regex pattern which checks eg. for 3 terms independent to their position in the main string? eg. my string is something like "click here to unsubscribe: http://www.url.com" the pattern should also work with "http:// unsubscribe click" thx

    Read the article

  • Regular expression to extract text between either square or curly brackets

    - by ObiWanKenobi
    Related to my previous question, I have a string on the following format: this {is} a [sample] string with [some] {special} words. [another one] What is the regular expression to extract the words within either square or curly brackets, ie. {is} [sample] [some] {special} [another one] Note: In my use case, brackets cannot be nested. I would also like to keep the enclosing characters, so that I can tell the difference between them when processing the results.

    Read the article

  • How to make a parameter optional in WSDL?

    - by user305069
    I have a WebService API which needs 2 of its parameters to be optional in the WSDL public wsProxy[] Insert(wsProxy[] proxies, string loginname, string password, bool returnNewData) { //code here } I need to a way to show loginname and password as optional in the WSDL. Is there any way to do this in C#. Can I maybe add an tag in front of the parameters like this [optional]loginname? I have been looking around but haven't been able to find anything so far.

    Read the article

  • How to create a 2D map in Java?

    - by Roman
    I would like to have a mapping which maps two string into one string. For example: map["MainServer","Status"] return "active". What is the best way to do it in Java. Should I use HashMap which include another HashMap as its elements?

    Read the article

  • Display html text in uitextview

    - by milanjansari
    Hello, How to display html text in textview for example string <h1>Krupal testing <span style="font-weight: bold;">Customer WYWO</span></h1> Suppose text is bold so it display in textview as bold string but i want display normal text.is this possible in iphone sdk. Thanks you,

    Read the article

  • Difference between WinMain and wWinMain

    - by Sherwood Hu
    The only difference is that Winmain takes char* for lpCmdLine parameter, while wWinMain takes wchar_t*. On Windows XP, if an application entry is WinMain, does Windows convert the command line from Unicode to Ansi and pass to the application? If the command line parameter must be in Unicode (for example, Unicode file name, conversion will cause some characters missing), does that mean that I must use wWinMain as the entry function?

    Read the article

  • user creating/saving

    - by Xaver
    i want to write 2 program: 1) programm saves all local users to the file. 2) loads file find that users not found on local machine and create user. for searching all users which create on local machine i use next code: foreach (ManagementObject user in userSearcher.Get()) { if ((bool)user["LocalAccount"]) { string UserName = (string)user["FullName"]; } } How can i save the settings of user by name and create user?

    Read the article

  • please help turn a simple Python2 code to PHP

    - by user296516
    Hi guys, Sorry to bother again, but I really need help transforming this Python2 code into PHP. net, cid, lac = 25002, 9164, 4000 import urllib a = '000E00000000000000000000000000001B0000000000000000000000030000' b = hex(cid)[2:].zfill(8) + hex(lac)[2:].zfill(8) c = hex(divmod(net,100)[1])[2:].zfill(8) + hex(divmod(net,100)[0])[2:].zfill(8) string = (a + b + c + 'FFFFFFFF00000000').decode('hex') data = urllib.urlopen('http://www.google.com/glm/mmap',string) r = data.read().encode('hex') print float(int(r[14:22],16))/1000000, float(int(r[22:30],16))/1000000 Would be great if someone could help, thanks in advance!

    Read the article

< Previous Page | 588 589 590 591 592 593 594 595 596 597 598 599  | Next Page >