string escaping - Page 6

increasing string size through loop

- by calccrypto

what's a simple way to increase the length of a string given an arbitrary integer x? like 'a' goes to 'z' and then goes to 'aa' to 'zz' to 'aaa', etc.

What is the most efficient way to parse a C# string in the form of "(params (abc 1.3)(sdc 2.0)....)" into a struct in the form struct Params { double abc,sdc....; } Thanks EDIT The structure always have the same parameters (number and names).. but the order is not granted..

Read the article

finding and returning a string with a specified prefix

- by tipu

I am close but I am not sure what to do with the restuling match object. If I do p = re.search('[/@.* /]', str) I'll get any words that start with @ and end up with a space. This is what I want. However this returns a Match object that I dont' know what to do with. What's the most computationally efficient way of finding and returning a string which is prefixed with a @? For example, "Hi there @guy" After doing the proper calculations, I would be returned guy

Read the article

python - remove string from words in an array

- by tekknolagi

#!/usr/bin/python #this looks for words in dictionary that begin with 'in' and the suffix is a real word wordlist = [line.strip() for line in open('/usr/share/dict/words')] newlist = [] for word in wordlist: if word.startswith("in"): newlist.append(word) for word in newlist: word = word.split('in') print newlist how would I get the program to remove the string "in" from all the words that it starts with? right now it does not work

Read the article

Split a long JSON string into lines in Ruby

- by David J.

Read the article

String.IsNullOrWhiteSpace

- by Scott Dorman

An empty string is different than an unassigned string variable (which is null), and is a string containing no characters between the quotes (""). The .NET Framework provides String.Empty to represent an empty string, and there is no practical difference between ("") and String.Empty. One of the most common string comparisons to perform is to determine if a string variable is equal to an empty string. The fastest and simplest way to determine if a string is empty is to test if the Length property is equal to 0. However, since strings are reference types it is possible for a string variable to be null, which would result in a runtime error when you tried to access the Length property. Since testing to determine if a string is empty is such a common occurrence, the .NET Framework provides the static method String.IsNullOrEmpty method: public static bool IsNullOrEmpty(string value) { if (value != null) { return (value.Length == 0); } return true; } It is also very common to determine if a string is empty and contains more than just whitespace characters. For example, String.IsNullOrEmpty(" ") would return false, since this string is actually made up of three whitespace characters. In some cases, this may be acceptable, but in many others it is not. TO help simplify testing this scenario, the .NET Framework 4 introduces the String.IsNullOrWhiteSpace method: public static bool IsNullOrWhiteSpace(string value) { if (value != null) { for (int i = 0; i < value.Length; i++) { if (!char.IsWhiteSpace(value[i])) { return false; } } } return true; } Using either String.IsNullOrEmpty or String.IsNullOrWhiteSpace helps ensure correctness, readability, and consistency, so they should be used in all situations where you need to determine if a string is null, empty, or contains only whitespace characters. Technorati Tags: .NET,C# 4

Read the article

How do I concatenate 2 strings in NSIS

- by Apoc

How do I concatenate 2 strings in NSIS?

Read the article

how to create a string literal as a function argument via string concatenation in c

- by Reed Debaets

I need to pass a string literal to a function myfunction("arg1" CONSTANT "arg1"); now part of that constructed string literal needs to be a function return stmp = createString(); myfunction("arg1" stmp "arg2"); is there any way to do this in one line? myfunction("arg1" createString() "arg2"); //doesn't work ... why not? what instead? NOTE: C only please.

Read the article

String replacement problem.

- by fastcodejava

I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

Read the article

Lack of example escaping special characters in struts2

- by Dewfy

Hello colleagues! Googling today I couldn't found sample or mentioning of best practice: how to escape user input in Struts2. Of course I can manually convert characters on validate() method, but it looks too obvious. So may be exists some automation to avoid code/script injection?

Read the article

Transforming a string to a valid PDO_MYSQL DSN

- by Alix Axel

What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

Read the article

PHP String tokenizer not working correctly

- by asdadas

I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

Read the article

Escaping curly braces in XML

- by ChiTec

I cannot find the answer for this question. I read that doubling the bracket should help so something like <node>http://test.com?test={{0}}</node> But it didn't

Read the article

Escaping colons in hibernate createSQLQuery

- by Stratosgear

I am confused on how I can create an SQL statement containing colons. I am trying to create a view and I am using (notice the double colons): create view MyView as ( SELECT tableA.colA as colA, tableB.colB as colB, round(tableB.colD / 1024)::numeric, 2) as calcValue, FROM tableA, tableB WHERE tableA.colC = 'someValue' ); This is a postgres query and I am forced to use the double colons (::) in order to correctly run the statement. I then pass the above statement through: s.createSQLQuery(myQuery).executeUpdate(); and I get a: Exception in thread "main" org.hibernate.exception.DataException: \ could not execute native bulk manipulation query at org.hibernate.exception.SQLStateConverter.convert(\ SQLStateConverter.java:102) ... more stacktrace... with an output of my above statement changed as (notice the question mark): create view MyView as ( SELECT tableA.colA as colA, tableB.colB as colB, round(tableB.colD / 1024)?, 2) as calcValue, FROM tableA, tableB WHERE tableA.colC = 'someValue' ); Obviously, hibernate confuses my colons with named parameters. Is there a way to escape the colons (a google suggestion that mentions that a single colon is escaped as a double colon does NOT work) or another way of running this statement? Thanks.

Read the article

PHP keeps escaping my form's input (adding \ behind my ')

- by Haskella

So basically when I type something with an apostrophe, such as John's bike it will echo John\'s bike. The code below: <?php $searchname = $_POST["name"] ; echo "$searchname"; My form uses the POST method. Is there any way to stop this?

Read the article

Pros and cons of escaping strategies in symfony

- by zergu

I am still not sure in that matter. While turned on we're quite safe but some other problems appear (with passing template variables or counting characters). On the other hand we have magic turned off, everything is clear, but we have to manually escape every variable (that come from untrusted source) in templates. By the way, non-magic solution is used in Ruby-on-Rails. So the question is: when starting a new project in symfony do you disable escaping_strategy and why?

Read the article

PHP Escaping from HTML, faster, cleanner?!

- by rno

I've read about it from the php website (http://us3.php.net/manual/en/language.basic-syntax.phpmode.php) Using: echo "<html tag>" is slower and also annoying because you got to escape char like " with \" But what's about using $output = <<< EOF <html code> EOF; Then later on in the code I can use $output .= <<< EOF <some more html code> EOF; then when I want to print it: echo "$output"; I think it's a great idea, but really wonder what you PHP guru think about it. Cheers, rno

Read the article

Escaping textarea content

- by user198729

<textarea><?php echo htmlspecialchars($content)?></textarea> Does content inside <textarea need to be converted into HTML entities? Is htmlspecialchars necessary here? I tried with and without it, and both work for the content I used.

Read the article

JQuery selector value escaping

- by user53794

I have a dropdown list that contains a series of options: <select id=SomeDropdown> <option value="a'b]<p>">a'b]<p></option> <option value="easy">easy</option> <select> Notice that the option value/text contains some nasty stuff: single quotes closing square bracket escaped html I need to remove the a'b]<p option but I'm having no luck writing the selector. Neither: $("#SomeDropdown >option[value='a''b]<p>']"); or $("#SomeDropdown >option[value='a\'b]<p>']"); are returning the option. What is the correct way to escape values when using the "value=" selector?

Read the article

Finding multiple values in a string Jquery / Javascript

- by user257503

I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

Read the article

Search for string allowing for one mismatches in any location of the string, Python

- by Vincent

I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

Read the article

C# collection/string .Contains vs collection/string.IndexOf

- by Daniel

Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

Read the article

Making a string out of a string and an integer in Python

- by Waterfox

I get this error when trying to take an integer and prepend "b" to it, converting it into a string: File "program.py", line 19, in getname name = "b" + num TypeError: Can't convert 'int' object to str implicitly That's related to this function: num = random.randint(1,25) name = "b" + num

Read the article

Findind string in another string in PHP

- by Mamadou

Hi everybody I got a string like this : $str1 = "mod 1 + mode 2 + comp 1 + toto" I would like to test even " mod 1" is in $str1. I used strpos but this function dosen't help Pliz can anyone give an idea to fix this problem thank u.

Read the article

Finding substring of a word found in joining a string from another string

- by 2er0

Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

Search Results

Search found 35459 results on 1419 pages for 'string escaping'.

Page 6/1419 | < Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13 | Next Page >

- by calccrypto

- by Betamoo

- by tipu

- by tekknolagi

- by David J.

- by Scott Dorman

- by Apoc

- by Reed Debaets

- by fastcodejava

- by Dewfy

- by Alix Axel

- by asdadas

- by ChiTec

- by Stratosgear

- by Haskella

- by zergu

- by rno

- by user198729

- by user53794

- by user257503

- by Vincent

- by Daniel

- by Waterfox

- by Mamadou

- by 2er0

< Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13 | Next Page >