Search Results

Search found 40595 results on 1624 pages for 'string processing'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 6/1624 | < Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13  | Next Page >

  • finding and returning a string with a specified prefix

    - by tipu
    I am close but I am not sure what to do with the restuling match object. If I do p = re.search('[/@.* /]', str) I'll get any words that start with @ and end up with a space. This is what I want. However this returns a Match object that I dont' know what to do with. What's the most computationally efficient way of finding and returning a string which is prefixed with a @? For example, "Hi there @guy" After doing the proper calculations, I would be returned guy

    Read the article

  • How is 'processing credit card data' defined (PCI)?

    - by Chris
    If i have a web application and i receive credit card data transmitted via a POST request by a web browser over HTTPS and instantly open a socket (SSL) to a remote PCI compilant card processor to forward the data and wait for a response, am i allowed to do that? or is this receiving the data with my application and forwarding it already subject of "processing credit card data"? if i create an iframe that is displayed in a client browser to enter cc data and this iframe posts the data via HTTPS to remote card processor (directly!) is this already a case of processing credit card data? even if my application code 'doesnt touch' the entered data with any event handlers? i'm interested in the definition "credit card data processing". when does it start to be a cc data processing application? can somebody maybe point me to that section in PCI-DSS standard that clearly defines when you start to 'be a processing application'? Thanks,

    Read the article

  • Split a long JSON string into lines in Ruby

    - by David J.
    First, the background: I'm writing a Ruby app that uses SendGrid to send mass emails. SendGrid uses a custom email header (in JSON format) to set recipients, values to substitute, etc. SendGrid's documentation recommends splitting up the header so that the lines are shorter than 1,000 bytes. My question, then, is this: given a long JSON string, how can I split it into lines < 1,000 so that lines are split at appropriate places (i.e., after a comma) rather than in the middle of a word? This is probably unnecessary, but here's an example of the sort of string I'd like to split: X-SMTPAPI: {"sub": {"pet": ["dog", "cat"]}, "to": ["[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]", "[email protected]"]} Thanks in advance for any help you can provide!

    Read the article

  • String.IsNullOrWhiteSpace

    - by Scott Dorman
    An empty string is different than an unassigned string variable (which is null), and is a string containing no characters between the quotes (""). The .NET Framework provides String.Empty to represent an empty string, and there is no practical difference between ("") and String.Empty. One of the most common string comparisons to perform is to determine if a string variable is equal to an empty string. The fastest and simplest way to determine if a string is empty is to test if the Length property is equal to 0. However, since strings are reference types it is possible for a string variable to be null, which would result in a runtime error when you tried to access the Length property. Since testing to determine if a string is empty is such a common occurrence, the .NET Framework provides the static method String.IsNullOrEmpty method: public static bool IsNullOrEmpty(string value) { if (value != null) { return (value.Length == 0); }   return true; } It is also very common to determine if a string is empty and contains more than just whitespace characters. For example, String.IsNullOrEmpty("   ") would return false, since this string is actually made up of three whitespace characters. In some cases, this may be acceptable, but in many others it is not. TO help simplify testing this scenario, the .NET Framework 4 introduces the String.IsNullOrWhiteSpace method: public static bool IsNullOrWhiteSpace(string value) { if (value != null) { for (int i = 0; i < value.Length; i++) { if (!char.IsWhiteSpace(value[i])) { return false; } } } return true; }   Using either String.IsNullOrEmpty or String.IsNullOrWhiteSpace helps ensure correctness, readability, and consistency, so they should be used in all situations where you need to determine if a string is null, empty, or contains only whitespace characters. Technorati Tags: .NET,C# 4

    Read the article

  • String replacement problem.

    - by fastcodejava
    I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

    Read the article

  • Transforming a string to a valid PDO_MYSQL DSN

    - by Alix Axel
    What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

    Read the article

  • PHP String tokenizer not working correctly

    - by asdadas
    I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • apt-get fails to upgrade, install, remove etc

    - by Kieran Peat
    I upgraded from 11.10 to 12.04, had no issues that I noticed. Recently tried to install something via software center, but it was throwing errors. Changed to trying to sudo apt-get install instead but again no luck. I've genuinely tried as much as I know to fix this, but I can't so I figured I'd ask here. I've done sudo apt-get update successfully but sudo apt-get upgrade failed with... You might want to run ‘apt-get -f install’ to correct these. The following packages have unmet dependencies. ia32-libs-multiarch:i386 : Depends: libqtcore4:i386 but it is not installed libqt4-dbus:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-declarative:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-designer:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-network:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-opengl:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-qt3support:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-script:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-scripttools:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-sql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-sql-mysql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-svg:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-test:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-xml:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqt4-xmlpatterns:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqtgui4:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not installed libqtwebkit4:i386 : Depends: libqtcore4:i386 (>= 4:4.8.0~) but it is not installed libssl1.0.0 : Breaks: libssl1.0.0:i386 (!= 1.0.1-4ubuntu5.2) but 1.0.0e-2ubuntu4.6 is installed libssl1.0.0:i386 : Breaks: libssl1.0.0 (!= 1.0.0e-2ubuntu4.6) but 1.0.1-4ubuntu5.2 is installed E: Unmet dependencies. Try using -f. Using sudo apt-get -f install... The following packages were automatically installed and are no longer required: libgtkmm-2.4-1c2a libgtkhtml3.14-19 libglade2-0 Use 'apt-get autoremove' to remove them. The following extra packages will be installed: libqtcore4:i386 libssl1.0.0:i386 The following NEW packages will be installed libqtcore4:i386 The following packages will be upgraded: libssl1.0.0:i386 1 upgraded, 1 newly installed, 0 to remove and 33 not upgraded. 20 not fully installed or removed. Need to get 0 B/3,063 kB of archives. After this operation, 9,044 kB of additional disk space will be used. Do you want to continue [Y/n]? y E: Internal Error, No file name for libssl1.0.0 I've tried sudo apt-get remove libssl1.0.0 and sudo apt-get remove libssl1.0.0:i386 Reading package lists... Done Building dependency tree Reading state information... Done You might want to run 'apt-get -f install' to correct these: The following packages have unmet dependencies. ia32-libs-multiarch:i386 : Depends: libqtcore4:i386 but it is not going to be installed Depends: libssl1.0.0:i386 but it is not going to be installed libcurl3:i386 : Depends: libssl1.0.0:i386 (>= 1.0.0) but it is not going to be installed libqt4-dbus:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-declarative:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-designer:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-network:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-opengl:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-qt3support:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-script:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-scripttools:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-sql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-sql-mysql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-svg:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-test:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-xml:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-xmlpatterns:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqtgui4:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqtwebkit4:i386 : Depends: libqtcore4:i386 (>= 4:4.8.0~) but it is not going to be installed libsasl2-modules:i386 : Depends: libssl1.0.0:i386 (>= 1.0.0) but it is not going to be installed E: Unmet dependencies. Try 'apt-get -f install' with no packages (or specify a solution). I've also tried sudo apt-get dist-upgrade, sudo apt-get autoremove etc without any luck. I also tried to download the .deb and use dpkg -i, but that failed and did not fully understand the method to be honest. Edit This is in response to the comments ref: sudo apt-get install -f doesn't fix broken packages. And now? sudo dpkg --configure -a --force-all dpkg: error processing libssl1.0.0 (--configure): libssl1.0.0:amd64 1.0.1-4ubuntu5.2 cannot be configured because libssl1.0.0:i386 is in a different version (1.0.0e-2ubuntu4.6) dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: also configuring `libssl1.0.0:i386' (required by `ia32-libs-multiarch:i386') dpkg: error processing libssl1.0.0:i386 (--configure): libssl1.0.0:i386 1.0.0e-2ubuntu4.6 cannot be configured because libssl1.0.0:amd64 is in a different version (1.0.1-4ubuntu5.2) dpkg: too many errors, stopping Errors were encountered while processing: libssl1.0.0 libssl1.0.0:i386 ... libssl1.0.0:i386 Processing was halted because there were too many errors. Ref: Package manager doesn't work anymore moving /var/lib/kpkg/info/libssl.. kieran@kieran-EX58-UD3R:~$ sudo mv /var/lib/dpkg/info/libssl1.0.0:i386.postinst /var/lib/dpkg/info/libssl1.0.0:i386.postinst.bad kieran@kieran-EX58-UD3R:~$ sudo mv /var/lib/dpkg/info/libssl1.0.0:amd64.postinst /var/lib/dpkg/info/libssl1.0.0:amd64.postinst.bad kieran@kieran-EX58-UD3R:~$ sudo apt-get --reinstall install libssl Reading package lists... Done Building dependency tree Reading state information... Done Package libssl is not available, but is referred to by another package. This may mean that the package is missing, has been obsoleted, or is only available from another source E: Package 'libssl' has no installation candidate kieran@kieran-EX58-UD3R:~$ sudo apt-get --reinstall install libssl1.0.0 Reading package lists... Done Building dependency tree Reading state information... Done You might want to run 'apt-get -f install' to correct these: The following packages have unmet dependencies. ia32-libs-multiarch:i386 : Depends: libqtcore4:i386 but it is not going to be installed libqt4-dbus:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-declarative:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-designer:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-network:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-opengl:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-qt3support:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-script:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-scripttools:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-sql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-sql-mysql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-svg:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-test:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-xml:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-xmlpatterns:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqtgui4:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqtwebkit4:i386 : Depends: libqtcore4:i386 (>= 4:4.8.0~) but it is not going to be installed libssl1.0.0 : Breaks: libssl1.0.0:i386 (!= 1.0.1-4ubuntu5.2) but 1.0.0e-2ubuntu4.6 is to be installed libssl1.0.0:i386 : Breaks: libssl1.0.0 (!= 1.0.0e-2ubuntu4.6) but 1.0.1-4ubuntu5.2 is to be installed E: Unmet dependencies. Try 'apt-get -f install' with no packages (or specify a solution). kieran@kieran-EX58-UD3R:~$ sudo apt-get -f install Reading package lists... Done Building dependency tree Reading state information... Done Correcting dependencies... Done The following packages were automatically installed and are no longer required: libgtkmm-2.4-1c2a libgtkhtml3.14-19 libglade2-0 Use 'apt-get autoremove' to remove them. The following extra packages will be installed: libqtcore4:i386 libssl1.0.0:i386 The following NEW packages will be installed libqtcore4:i386 The following packages will be upgraded: libssl1.0.0:i386 1 upgraded, 1 newly installed, 0 to remove and 58 not upgraded. 20 not fully installed or removed. Need to get 3,063 kB of archives. After this operation, 9,044 kB of additional disk space will be used. Do you want to continue [Y/n]? y Get:1 http://gb.archive.ubuntu.com/ubuntu/ precise-updates/main libssl1.0.0 i386 1.0.1-4ubuntu5.2 [1,002 kB] Get:2 http://gb.archive.ubuntu.com/ubuntu/ precise-updates/main libqtcore4 i386 4:4.8.1-0ubuntu4.1 [2,061 kB] Fetched 3,063 kB in 4s (731 kB/s) E: Internal Error, No file name for libssl1.0.0 ref: libssl Dependencies removing libssl1.0.0:i386 kieran@kieran-EX58-UD3R:~$ sudo apt-get remove libssl1.0.0:i386 Reading package lists... Done Building dependency tree Reading state information... Done You might want to run 'apt-get -f install' to correct these: The following packages have unmet dependencies. ia32-libs-multiarch:i386 : Depends: libqtcore4:i386 but it is not going to be installed Depends: libssl1.0.0:i386 but it is not going to be installed libcurl3:i386 : Depends: libssl1.0.0:i386 (>= 1.0.0) but it is not going to be installed libqt4-dbus:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-declarative:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-designer:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-network:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-opengl:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-qt3support:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-script:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-scripttools:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-sql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-sql-mysql:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-svg:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-test:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-xml:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqt4-xmlpatterns:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqtgui4:i386 : Depends: libqtcore4:i386 (= 4:4.8.1-0ubuntu4.1) but it is not going to be installed libqtwebkit4:i386 : Depends: libqtcore4:i386 (>= 4:4.8.0~) but it is not going to be installed libsasl2-modules:i386 : Depends: libssl1.0.0:i386 (>= 1.0.0) but it is not going to be installed E: Unmet dependencies. Try 'apt-get -f install' with no packages (or specify a solution).

    Read the article

  • Remove characters after specific character in string, then remove substring?

    - by sah302
    I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • String formatting error

    - by wrongusername
    Using the code print('{0} is not'.format('That that is not')) in Python 3.1.1, I get the following error: AttributeError: 'str' object has no attribute 'format' when I delete the line Netbeans automatically inserted at the beginning: from distutils.command.bdist_dumb import format which itself causes an error of ImportError: cannot import name format What am I doing wrong here?

    Read the article

  • How to replace round bracket tag in javascript string

    - by tomaszs
    I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 2 3 4 5 6 7 8 9 10 11 12 13  | Next Page >