Search Results

Search found 3518 results on 141 pages for 'arguments'.

Page 60/141 | < Previous Page | 56 57 58 59 60 61 62 63 64 65 66 67  | Next Page >

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Changing forecolor according to backcolor

    - by strakastroukas
    Dear SO family, I have created an iframe which contains the label, "powered by MyWebsite.site" The "iframe itself" accepts arguments, so other webmasters may customize the appearance of it. The problem is that since the background of the iframe could be customized, anyone can "vanish" the "powered by MyWebsite.site". So what option do i have? How should i dynamically change the label color depending on any background?

    Read the article

  • jquery dialog form with dynamic variables

    - by Patrick
    Hello, Currently I have an html form - which I call with jquery dialog - to insert new records into a table. But I also would like to update existing records with the same form - using jquery dialog. I'm not sure within the dialog how I access these data values - or pass them in as arguments - and hook them up with the form elements...? Anyone has done this before and knows an agile technique to do this? kind regards, Patrick

    Read the article

  • Execute a Application On The Server Using VBScript

    - by Nathan Campos
    I have an application on my server that is called leaf.exe, that haves two arguments needed to run, they are: inputfile and outputfile, that will be like this example: leaf.exe input.jpg output.leaf They are all on the same directory as my home page file(the executable and the input file). But I need that a VBScript could run the application like that, then I want to know how could I do this.

    Read the article

  • how to get $form_state outside of FAPI's functions?

    - by logii
    I'm writing a custom module and I'd like to use $form_state of the current form in another non-form api function - custom_facet_view_build(). any help is appreciated :) <?php /** * Implementation of hook_perm(). */ function custom_facet_perm() { return array( 'access foo content', 'access baz content', ); } /** * Implementation of hook_menu(). */ function custom_facet_menu() { $items['faceted-search'] = array( 'title' => 'Faceted Search', 'page callback' => 'drupal_get_form', 'access arguments' => array(), ); $items['facet-search-test'] = array( 'page callback' => 'drupal_get_form', 'page arguments' => array('custom_facet_form'), 'access callback' => TRUE, 'type' => MENU_CALLBACK, ); return $items; } /** * Form definition; ahah_helper_demo form. */ function custom_facet_form($form_state) { $form = array(); ahah_helper_register($form, $form_state); if (isset($form_state['storage']['categories'])) { $categories_default_value = $form_state['storage']['categories']["#value"]; } $form['facet_search_form'] = array( '#type' => 'fieldset', '#title' => t('Faceted Search'), '#prefix' => '<div id="billing-info-wrapper">', // This is our wrapper div. '#suffix' => '</div>', '#tree' => TRUE, // Don't forget to set #tree! ); $form['facet_search_form']['categories'] = array( '#type' => 'select', '#title' => t('Category'), '#options' => _custom_facet_taxonomy_query(1), '#multiple' => TRUE, '#default_value' => $categories_default_value, ); $form['save'] = array( '#type' => 'submit', '#value' => t('Save'), ); return $form; } /** * Validate callback for the form. */ function custom_facet_form_validate($form, &$form_state) { } /** * Submit callback for the form. */ function custom_facet_form_submit($form, &$form_state) { drupal_set_message('nothing done'); $form_state['storage']['categories'] = $form['facet_search_form']['categories']; // dpm($form_state); // There's a value returned in form_state['storage] within this function } /** * Implementation of hook_views_api(). */ function custom_facet_views_api() { return array( 'api' => 2, ); } function custom_facet_view_build(&$view) { dpm($form_state); // form_state['storage] remains NULL even though there's a value on previous submission }

    Read the article

  • Usable mainmenu when sheet is shown

    - by neoneye
    How does one react to menuitems that are clicked via mouse or invoked via keyboard, e.g: CMD+Q ? [NSApp beginSheet:my_sheet ...arguments... ]; /* The sheet is now shown and the mainmenu isn't usable. How does one make it usable? */ [NSApp endSheet:my_sheet returnCode:0];

    Read the article

  • Can this jQuery/Javascript functionality be replicated with PHP

    - by benhowdle89
    This is the code to grab tweets, but i need this in PHP, can anybody offer any insight? $(document).ready( function() { var url = "http://twitter.com/status/user_timeline/joebloggs.json?count=1&callback=?"; $.getJSON(url, function(data){ $.each(data, function(i, item) { $("#twitter-posts").append("<p>" + item.text.linkify() + " <span class='created_at'>" + relative_time(item.created_at) + " via " + item.source + "</span></p>"); }); }); }); String.prototype.linkify = function() { return this.replace(/[A-Za-z]+:\/\/[A-Za-z0-9-_]+\.[A-Za-z0-9-_:%&\?\/.=]+/, function(m) { return m.link(m); }); }; function relative_time(time_value) { var values = time_value.split(" "); time_value = values[1] + " " + values[2] + ", " + values[5] + " " + values[3]; var parsed_date = Date.parse(time_value); var relative_to = (arguments.length > 1) ? arguments[1] : new Date(); var delta = parseInt((relative_to.getTime() - parsed_date) / 1000); delta = delta + (relative_to.getTimezoneOffset() * 60); var r = ''; if (delta < 60) { r = 'a minute ago'; } else if(delta < 120) { r = 'couple of minutes ago'; } else if(delta < (45*60)) { r = (parseInt(delta / 60)).toString() + ' minutes ago'; } else if(delta < (90*60)) { r = 'an hour ago'; } else if(delta < (24*60*60)) { r = '' + (parseInt(delta / 3600)).toString() + ' hours ago'; } else if(delta < (48*60*60)) { r = '1 day ago'; } else { r = (parseInt(delta / 86400)).toString() + ' days ago'; } return r; } function twitter_callback () { return true; }

    Read the article

  • Patterns for wrapping a command line tool in another language

    - by Tom Duckering
    I'm currently writing some Java to wrap around an extensive command line tool. It feels like I'm writing a lot of similar code. I'm wondering if there are any established patterns for wrapping command line tools - passing arguments and handling output and so on. Specific examples in Java would obviously be great, but any general suggestions or pointers are welcome too.

    Read the article

  • error in creating my own Robot class in android..

    - by manju
    Hi All, I have decided to create my own Java's Robot class in android to take screen capture..i have written the source code of the robot class by my own but the problem is here, the following line in the code is throwing compilation error..saying "The method createRobot(Robot, GraphicsDevice) in the type ComponentFactory is not applicable for the arguments (Robot, GraphicsDevice)" peer = ((ComponentFactory)toolkit).createRobot(this, screen); Can anyone suggest me what would be the solution.... thanks..

    Read the article

  • Other ternary operators besides ternary conditional (?:)

    - by Malcolm
    The "ternary operator" expression is now almost equivalent to the ternary conditional operator: condition ? trueExpression : falseExpression; However, "ternary operator" only means that it takes three arguments. I'm just curious, are there any languages with any other built-in ternary operators besides conditional operator and which ones?

    Read the article

  • Python tkInter text entry validation

    - by meade
    I'm trying to validate the entry of text using Python/tkInter def validate_text(): return False text = Entry(textframe, validate="focusout", validatecommand=validate_text) where validate_text is the function - I've tried always returning False and always returning True and there's no difference in the outcome..? Is there a set of arguments in the function that I need to include? Edit - changed from NONE to focusout...still not working

    Read the article

  • Call trace in Android

    - by DenMark
    I want to know how to do method tracing for Android applications. I mean, a sequence of calls on each object, not a stack trace. It's very similar to this question (Call trace in java), but on different platforms (jvm-PC vs dvm-Android). I have no control over the start arguments of dalvik, thus I cannot specify a java agent (or am I wrong here?). Is there another way to do method tracing? Thanks!

    Read the article

  • splat operator in groovy?

    - by IttayD
    def foo(map, name) { println(map) } foo("bar", hi: "bye") will print [hi:bye] Now I have a previous map that I wish to pass along to foo. In pseudo code, something like: def otherMap = [hi: "world"] foo("bar", hi: "bye", otherMap*) So that it prints [hi:world] This doesn't work of course. Also, trying to pass just the map mixes the order of arguments: def otherMap = [hi: "world"] foo("bar", otherMap) will print bar How can I fix this?

    Read the article

  • Variable popen calls in C

    - by Bushman
    I'm trying to execute MS-DOS DEL commands inside a Win32 C program, and I already know that system and popen can be used for this. However, the problem is that both require string literals (type const char) for the commands, and I need something like the DOS equivalent of dir ~ | grep -P '/\d{7,8}\.exe$/' | rm, which obviously can't use string literals. Is there some other subprocess function in C that allows for char arrays as arguments for process names?

    Read the article

  • Doing things with objects as if they were parents

    - by General Ackbar
    Sorry that this is probably a super noob question. But the following code give me an error saying that there are invalid arguments in my call of doStuffToLines(segments) shouldnt I be able to do this since I have my DimensionLineSegment inherits from Lines? private void doStuff() { List<DimensionLineSegment> segments = new List<DimensionLineSegment>(); doStuffToLines(segments); } private void doStuffToLines(List<Line> lines) { }

    Read the article

  • Render {embed} for each entry in {exp:weblog:entries} loop

    - by eyelidlessness
    {exp:weblog:entries [args]} [content] {embed="path/to/sub-template" [args]} {/exp:weblog:entries} The sub-template only renders for the first entry, and the {embed} template tag is swallowed for all subsequent entries. Is there a way to make it render the sub-template for each iteration? Edit: stranger yet, if caching is enabled for the sub-template, it renders for each iteration—but, of course, the arguments on the embed tag aren't passed to subsequent iterations, as the sub-template is cached.

    Read the article

  • httpURLConnection vs apache commons http

    - by Pablo Fernandez
    Hi everyone! I just wanted to know if any of you had any problems using java default HttpURLConnection class. Some kind of bug that made you switch to apache commons. Or is it just the (ugly) interface that class exposes that justifies the birth of 3rd party http lib? Disclosure: I heard some arguments against java.net having some serious problems, but I'm finding hard to believe that a class that is part of the java core distribution still has issues after several releases of the JDK

    Read the article

  • How to wrap two unmannaged C++ functions into two managed C# functions?

    - by Gbps
    I've got two unmanaged C++ functions, Compress and Decompress. The arguments and returns go as followed: unsigned char* Compress (unsigned char*,int) unsigned char* Decompress (unsigned char*,int) Where all uchars are arrays of uchars. Could someone please help me lay out a way to convert these into managed C# code using the Byte[] array instead of unsigned char*? Thank you very much!

    Read the article

  • add a decorate function to a class

    - by wiso
    I have a decorated function (simplified version): class Memoize: def __init__(self, function): self.function = function self.memoized = {} def __call__(self, *args, **kwds): hash = args try: return self.memoized[hash] except KeyError: self.memoized[hash] = self.function(*args) return self.memoized[hash] @Memoize def _DrawPlot(self, options): do something... now I want to add this method to a pre-esisting class. ROOT.TChain.DrawPlot = _DrawPlot when I call this method: chain = TChain() chain.DrawPlot(opts) I got: self.memoized[hash] = self.function(*args) TypeError: _DrawPlot() takes exactly 2 arguments (1 given) why doesn't it propagate self?

    Read the article

< Previous Page | 56 57 58 59 60 61 62 63 64 65 66 67  | Next Page >