Search Results

Search found 16329 results on 654 pages for 'b long'.

Page 600/654 | < Previous Page | 596 597 598 599 600 601 602 603 604 605 606 607  | Next Page >

  • weird performance in C++ (VC 2010)

    - by raicuandi
    Hello, I have this loop written in C++, that compiled with MSVC2010 takes a long time to run. (300ms) for (int i=0; i<h; i++) { for (int j=0; j<w; j++) { if (buf[i*w+j] > 0) { const int sy = max(0, i - hr); const int ey = min(h, i + hr + 1); const int sx = max(0, j - hr); const int ex = min(w, j + hr + 1); float val = 0; for (int k=sy; k < ey; k++) { for (int m=sx; m < ex; m++) { val += original[k*w + m] * ds[k - i + hr][m - j + hr]; } } heat_map[i*w + j] = val; } } } It seemed a bit strange to me, so I did some tests then changed a few bits to inline assembly: (specifically, the code that sums "val") for (int i=0; i<h; i++) { for (int j=0; j<w; j++) { if (buf[i*w+j] > 0) { const int sy = max(0, i - hr); const int ey = min(h, i + hr + 1); const int sx = max(0, j - hr); const int ex = min(w, j + hr + 1); __asm { fldz } for (int k=sy; k < ey; k++) { for (int m=sx; m < ex; m++) { float val = original[k*w + m] * ds[k - i + hr][m - j + hr]; __asm { fld val fadd } } } float val1; __asm { fstp val1 } heat_map[i*w + j] = val1; } } } Now it runs in half the time, 150ms. It does exactly the same thing, but why is it twice as quick? In both cases it was run in Release mode with optimizations on. Am I doing anything wrong in my original C++ code?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Remote Postgresql - extremely slow

    - by Muffinbubble
    Hi, I have setup PostgreSQL on a VPS I own - the software that accesses the database is a program called PokerTracker. PokerTracker logs all your hands and statistics whilst playing online poker. I wanted this accessible from several different computers so decided to installed it on my VPS and after a few hiccups I managed to get it connecting without errors. However, the performance is dreadful. I have done tons of research on 'remote postgresql slow' etc and am yet to find an answer so am hoping someone is able to help. Things to note: The query I am trying to execute is very small. Whilst connecting locally on the VPS, the query runs instantly. While running it remotely, it takes about 1 minute and 30 seconds to run the query. The VPS is running 100MBPS and then computer I'm connecting to it from is on an 8MB line. The network communication between the two is almost instant, I am able to remotely connect fine with no lag whatsoever and am hosting several websites running MSSQL and all the queries run instantly, whether connected remotely or locally so it seems specific to PostgreSQL. I'm running their newest version of the software and the newest compatible version of PostgreSQL with their software. The database is a new database, containing hardly any data and I've ran vacuum/analyze etc all to no avail, I see no improvements. I don't understand how MSSQL can query almost instantly yet PostgreSQL struggles so much. I am able to telnet to the post 5432 on the VPS IP with no problems, and as I say the query does execute it just takes an extremely long time. What I do notice is on the router when the query is running that hardly any bandwidth is being used - but then again I wouldn't expect it to for a simple query but am not sure if this is the issue. I've tried connecting remotely on 3 different networks now (including different routers) but the problem remains. Connecting remotely via another machine via the LAN is instant. I have also edited the postgre conf file to allow for more memory/buffers etc but I don't think this is the problem - what I am asking it to do is very simple - it shouldn't be intensive at all. Thanks, Ricky

    Read the article

  • how do i know how many clients are calling my WCF service function

    - by ZhengZhiren
    i am writing a program to test WCF service performance in high concurrency circumstance. On client side, i start many threads to call a WCF service function which returns a long list of data object. On server side, in that function called by my client, i need to know the number of clients calling the function. For doing that, i set a counter variable. In the beginning of the function, i add the counter by 1, but how can i decrease it after the funtion has returned the result? int clientCount=0; public DataObject[] GetData() { Interlocked.Increment(ref clientCount); List<DataObject> result = MockDb.GetData(); return result.ToArray(); Interlocked.Decrement(ref clientCount); //can't run to here... } i have seen a way in c++. Create a new class named counter. In the constructor of the counter class, increase the variable. And decrease it in the destructor. In the function, make a counter object so that its constructor will be called. And after the function returns, its destructor will be called. Like this: class counter { public: counter(){++clientCount; /* not simply like this, need to be atomic*/} ~counter(){--clientCount; /* not simply like this, need to be atomic*/} }; ... myfunction() { counter c; //do something return something; } In c# i think i can do so with the following codes, but not for sure. public class Service1 : IService1 { static int clientCount = 0; private class ClientCounter : IDisposable { public ClientCounter() { Interlocked.Increment(ref clientCount); } public void Dispose() { Interlocked.Decrement(ref clientCount); } } public DataObject[] GetData() { using (ClientCounter counter = new ClientCounter()) { List<DataObject> result = MockDb.GetData(); return result.ToArray(); } } } i write a counter class implement the IDisposable interface. And put my function codes into a using block. But it seems that it doesn't work so good. No matter how many threads i start, the clientCount variable is up to 3. Any advise would be appreciated.

    Read the article

  • How can I stop Flash from changing indent when user Clicks on hyperlink in TextField?

    - by Paul Chernoch
    I have a TextField which I initialize by setting htmlText. The text has anchor tags (hyperlinks). When a user clicks on the hyperlink, the indentation of the second and subsequent lines in the paragraph changes. Why? How do I stop it? My html has an image at the beginning of the line, followed by the tag, followed by more text. To style the hyper links to look blue always and underlined when the mouse is over them, I do this: var css:StyleSheet = new StyleSheet(); css.parseCSS("a {color: #0000FF;} a:hover {text-decoration: underline;}"); stepText.styleSheet = css; stepText.htmlText = textToUse; stepText.visible = true; Here is a fragment of the html text (with newlines and exrta whitespace added to improve readability - originally it was one long line): <textformat indent="-37" blockindent="37" > <img src="media/interface/level-1-bullets/solid-circle.png" align="left" hspace="8" vspace="1"/> American Dental Association. (n.d.). <i>Cleaning your teeth and gums (oral hygiene)</i>. Retrieved 11/24/08, from <a href="http://www.ada.org/public/topics/cleaning_faq.asp" target="_blank">http://www.ada.org/public/topics/cleaning_faq.asp </a> </textformat> <br/> As it turns out, the text field is of a width such that it wraps and the second line starts with "Retrieved 11/24/08". Clicking on the hyper link causes this particular line to be indented. Subsequent paragraphs are not affected. ASIDE: The image is a list bullet about 37 pixels wide. (I used images instead of li tags because Flash does not allow nested lists, so I faked it using a series of images with varying amounts of whitespace to simulate three levels of indentation.) IDEA: I was thinking of changing all hyperlinks to use "event:" as the URL protocol, which causes a TextEvent.LINK event to be triggered instead of following the link. Then I would have to open the browser in a second call. I could use this event handler to set the html text to itself, which might clear the problem. (When I switch pages in my application and then come back to the page, everything is OKAY again.) PROBLEM: If I use the "event:" protocol and user tries the right-mouse button click, they will get an error, or so I am told. (See http://www.blog.lessrain.com/as3-texteventlink-and-contextmenu-incompatibilities/ ) I do not like this trade-off.

    Read the article

  • Spring MVC, REST, and HATEOAS

    - by SingleShot
    I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

    Read the article

  • Parsing CSV File to MySQL DB in PHP

    - by Austin
    I have a some 350-lined CSV File with all sorts of vendors that fall into Clothes, Tools, Entertainment, etc.. categories. Using the following code I have been able to print out my CSV File. <?php $fp = fopen('promo_catalog_expanded.csv', 'r'); echo '<tr><td>'; echo implode('</td><td>', fgetcsv($fp, 4096, ',')); echo '</td></tr>'; while(!feof($fp)) { list($cat, $var, $name, $var2, $web, $var3, $phone,$var4, $kw,$var5, $desc) = fgetcsv($fp, 4096); echo '<tr><td>'; echo $cat. '</td><td>' . $name . '</td><td><a href="http://www.' . $web .'" target="_blank">' .$web.'</a></td><td>'.$phone.'</td><td>'.$kw.'</td><td>'.$desc.'</td>' ; echo '</td></tr>'; } fclose($file_handle); show_source(__FILE__); ?> First thing you will probably notice is the extraneous vars within the list(). this is because of how the excel spreadsheet/csv file: Category,,Company Name,,Website,,Phone,,Keywords,,Description ,,,,,,,,,, Clothes,,4imprint,,4imprint.com,,877-466-7746,,"polos, jackets, coats, workwear, sweatshirts, hoodies, long sleeve, pullovers, t-shirts, tees, tshirts,",,An embroidery and apparel company based in Wisconsin. ,,Apollo Embroidery,,apolloemb.com,,1-800-982-2146,,"hats, caps, headwear, bags, totes, backpacks, blankets, embroidery",,An embroidery sales company based in California. One thing to note is that the last line starts with two commas as it is also listed within "Clothes" category. My concern is that I am going about the CSV output wrong. Should I be using a foreach loop instead of this list way? Should I first get rid of any unnecessary blank columns? Please advise any flaws you may find, improvements I can use so I can be ready to import this data to a MySQL DB.

    Read the article

  • Effective Data Validation

    - by John Conde
    What's an effective way to handle data validation, say, from a form submission? Originally I had a bunch of if statements that checked each value and collected invalid values in an array for later retrieval (and listing). // Store errors here $errors = array(); // Hypothetical check if a string is alphanumeric if (!preg_match('/^[a-z\d]+$/i', $fieldvalue)) { $errors[$fieldname] = 'Please only use letters and numbers for your street address'; } // etc... What I did next was create a class that handles various data validation scenarios and store the results in an internal array. After data validation was complete I would check to see if any errors occurred and handle accordingly: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more methods here public function creditCard($cardNumber, $field, $msg = '') { // Validate credit card number } // more methods here public function hasErrors() { return count($this->errorList); } } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue1, $fieldname1, 'Please only use letters and numbers for your street address'); $validate->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Naturally it didn't take long before this class became bloated with the virtually unlimited types of data to be validated. What I'm doing now is using decorators to separate the different types of data into their own classes and call them only when needed leaving generic validations (i.e. isAlphaNumeric()) in the base class: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more generic methods here public function setError($field, $msg = '') { $this->errorList[$field] = $msg; } public function hasErrors() { return count($this->errorList); } } class ValidationCreditCard { protected $validate; public function __construct(Validation $validate) { $this->validate = $validate; } public function creditCard($cardNumber, $field, $msg = '') { // Do validation // ... // if there is an error $this->validate->setError($field, $msg); } // more methods here } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue, $fieldname, 'Please only use letters and numbers for your street address'); $validateCC = new ValidationCreditCard($validate); $validateCC->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Am I on the right track? Or did I just complicate data validation more then I needed to?

    Read the article

  • Fixed strptime exception with thread lock, but slows down the program

    - by eWizardII
    I have the following code, which when is running inside of a thread (the full code is here - https://github.com/eWizardII/homobabel/blob/master/lovebird.py) for null in range(0,1): while True: try: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='w') as f: f.write('[') threadLock.acquire() for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): if i>0: f.write(", ") f.write("%s" % (json.dumps(dict(sc=seed.author.statuses_count)))) j = j + 1 threadLock.release() f.write("]") except tweepy.TweepError, e: with open('C:/Twitter/tweets/user_0_' + str(self.id) + '.json', mode='a') as f: f.write("]") print "ERROR on " + str(self.ip) + " Reason: ", e with open('C:/Twitter/errors_0.txt', mode='a') as a_file: new_ii = "ERROR on " + str(self.ip) + " Reason: " + str(e) + "\n" a_file.write(new_ii) break Now without the thread lock I generate the following error: Exception in thread Thread-117: Traceback (most recent call last): File "C:\Python27\lib\threading.py", line 530, in __bootstrap_inner self.run() File "C:/Twitter/homobabel/lovebird.py", line 62, in run for i, seed in enumerate(Cursor(api.user_timeline,screen_name=self.ip).items(200)): File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 110, in next self.current_page = self.page_iterator.next() File "build\bdist.win-amd64\egg\tweepy\cursor.py", line 85, in next items = self.method(page=self.current_page, *self.args, **self.kargs) File "build\bdist.win-amd64\egg\tweepy\binder.py", line 196, in _call return method.execute() File "build\bdist.win-amd64\egg\tweepy\binder.py", line 182, in execute result = self.api.parser.parse(self, resp.read()) File "build\bdist.win-amd64\egg\tweepy\parsers.py", line 75, in parse result = model.parse_list(method.api, json) File "build\bdist.win-amd64\egg\tweepy\models.py", line 38, in parse_list results.append(cls.parse(api, obj)) File "build\bdist.win-amd64\egg\tweepy\models.py", line 49, in parse user = User.parse(api, v) File "build\bdist.win-amd64\egg\tweepy\models.py", line 86, in parse setattr(user, k, parse_datetime(v)) File "build\bdist.win-amd64\egg\tweepy\utils.py", line 17, in parse_datetime date = datetime(*(time.strptime(string, '%a %b %d %H:%M:%S +0000 %Y')[0:6])) File "C:\Python27\lib\_strptime.py", line 454, in _strptime_time return _strptime(data_string, format)[0] File "C:\Python27\lib\_strptime.py", line 300, in _strptime _TimeRE_cache = TimeRE() File "C:\Python27\lib\_strptime.py", line 188, in __init__ self.locale_time = LocaleTime() File "C:\Python27\lib\_strptime.py", line 77, in __init__ raise ValueError("locale changed during initialization") ValueError: locale changed during initialization The problem is with thread lock on, each thread runs itself serially basically, and it takes way to long for each loop to run for there to be any advantage to having a thread anymore. So if there isn't a way to get rid of the thread lock, is there a way to have it run the for loop inside of the try statement faster?

    Read the article

  • Multiple word Auttosuggest using Lucene.Net

    - by eric
    I am currently working on an search application which uses Lucene.Net to index the data from the database to Index file. I have a product catalog which has Name, short and long description, sku and other fields. The data is stored in Index using StandardAnalyzer. I am trying to add auto suggestion for a text field and using TermEnum to get all the keyword terms and its score from the Index. But the terms returned are of single term. For example, if I type for co, the suggestion returned are costume, count, collection, cowboy, combination etc. But I want the suggestion to return phrases. For exmaple, if I search for co, the suggestions should be cowboy costume, costume for adults, combination locks etc. The following is the code used to get the suggestions: public string[] GetKeywords(string strSearchExp) { IndexReader rd = IndexReader.Open(mIndexLoc); TermEnum tenum = rd.Terms(new Term("Name", strSearchExp)); string[] strResult = new string[10]; int i = 0; Dictionary<string, double> KeywordList = new Dictionary<string, double>(); do { //terms = tenum.Term(); if (tenum.Term() != null) { //strResult[i] = terms.text.ToString(); KeywordList.Add(tenum.Term().text.ToString(), tenum.DocFreq()); } } while (tenum.Next() && tenum.Term().text.StartsWith(strSearchExp) && tenum.Term().text.Length > 1); var sortedDict = (from entry in KeywordList orderby entry.Value descending select entry); foreach (KeyValuePair<string, double> data in sortedDict) { if (data.Key.Length > 1) { strResult[i] = data.Key; i++; } if (i >= 10) //Exit the for Loop if the count exceeds 10 break; } tenum.Close(); rd.Close(); return strResult; } Can anyone please give me directions to achive this? Thanks for looking into this.

    Read the article

  • One intent is working, second is giving me a crash

    - by user1480742
    ok, so both intents receiver sides are on the same activite and they are sending from different ones....second one is not working, first one does, dont know why...all 3 activites are ok in manifest and all that //second intent on senders side public void onItemSelected(AdapterView<?> arg0, View users, int i, long l) { FILENAME = (adapter.getItem(i)).toString(); Bundle viewBag2 = new Bundle(); viewBag2.putString("profile_name", FILENAME); Intent b = new Intent(OptionsMenu.this, CoreActivity.class); b.putExtras(viewBag2); startActivity(b); } //second intent on receiver side private void Data_transfer() { Bundle gotbasket2 = getIntent().getExtras(); profileName = gotbasket2.getString("profile_name"); } //first (working intent) on senders side public void onClick(View v) { Bundle viewBag = new Bundle(); viewBag.putString("spinner_result", s); a.putExtras(viewBag); } //first (working intent) on receiver side private void Data_transfer() { // TODO Auto-generated method stub Bundle gotbasket = getIntent().getExtras(); x = gotbasket.getString("spinner_result"); } 06-26 20:22:09.787: D/AndroidRuntime(1802): Shutting down VM 06-26 20:22:09.787: W/dalvikvm(1802): threadid=1: thread exiting with uncaught exception (group=0x40015560) 06-26 20:22:09.847: E/AndroidRuntime(1802): FATAL EXCEPTION: main 06-26 20:22:09.847: E/AndroidRuntime(1802): java.lang.RuntimeException: Unable to start activity ComponentInfo{mioc.diver/mioc.diver.CoreActivity}: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1647) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.handleLaunchActivity(ActivityThread.java:1663) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.access$1500(ActivityThread.java:117) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread$H.handleMessage(ActivityThread.java:931) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Handler.dispatchMessage(Handler.java:99) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.os.Looper.loop(Looper.java:123) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.main(ActivityThread.java:3683) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invokeNative(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): at java.lang.reflect.Method.invoke(Method.java:507) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:839) 06-26 20:22:09.847: E/AndroidRuntime(1802): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:597) 06-26 20:22:09.847: E/AndroidRuntime(1802): at dalvik.system.NativeStart.main(Native Method) 06-26 20:22:09.847: E/AndroidRuntime(1802): Caused by: java.lang.NullPointerException 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.Data_transfer(CoreActivity.java:189) 06-26 20:22:09.847: E/AndroidRuntime(1802): at mioc.diver.CoreActivity.onCreate(CoreActivity.java:88) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.Instrumentation.callActivityOnCreate(Instrumentation.java:1047) 06-26 20:22:09.847: E/AndroidRuntime(1802): at android.app.ActivityThread.performLaunchActivity(ActivityThread.java:1611) 06-26 20:22:09.847: E/AndroidRuntime(1802): ... 11 more

    Read the article

  • Simple RSA encryption (Java)

    - by jake blue
    This is simply for fun. This will not be used for any actual encryption. I'm only first year comp sci student and love cryptography. This took a long time to get working. At approximately N = 18, it begins breaking down. It won't encrypt messages properly after that point. I'm not sure why. Any insights? I'd also appreciate any links you could provide me to tutorials or interesting reading about Cryptography. import java.math.BigInteger; import java.security.SecureRandom; /** * Cryptography. * * Generates public and private keys used in encryption and * decryption * */ public class RSA { private final static BigInteger one = new BigInteger("1"); private final static SecureRandom random = new SecureRandom(); // prime numbers private BigInteger p; private BigInteger q; // modulus private BigInteger n; // totient private BigInteger t; // public key private BigInteger e; // private key private BigInteger d; private String cipherText; /** * Constructor for objects of class RSA */ public RSA(int N) { p = BigInteger.probablePrime(N/2, random); q = BigInteger.probablePrime(N/2, random); // initialising modulus n = p.multiply(q); // initialising t by euclid's totient function (p-1)(q-1) t = (p.subtract(one)).multiply(q.subtract(one)); // initialising public key ~ 65537 is common public key e = new BigInteger("65537"); } public int generatePrivateKey() { d = e.modInverse(t); return d.intValue(); } public String encrypt(String plainText) { String encrypted = ""; int j = 0; for(int i = 0; i < plainText.length(); i++){ char m = plainText.charAt(i); BigInteger bi1 = BigInteger.valueOf(m); BigInteger bi2 = bi1.modPow(e, n); j = bi2.intValue(); m = (char) j; encrypted += m; } cipherText = encrypted; return encrypted; } public String decrypt() { String decrypted = ""; int j = 0; for(int i = 0; i < cipherText.length(); i++){ char c = cipherText.charAt(i); BigInteger bi1 = BigInteger.valueOf(c); BigInteger bi2 = bi1.modPow(d, n); j = bi2.intValue(); c = (char) j; decrypted += c; } return decrypted; } }

    Read the article

  • how to deal with the position in a c# stream

    - by CapsicumDreams
    The (entire) documentation for the position property on a stream says: When overridden in a derived class, gets or sets the position within the current stream. The Position property does not keep track of the number of bytes from the stream that have been consumed, skipped, or both. That's it. OK, so we're fairly clear on what it doesn't tell us, but I'd really like to know what it in fact does stand for. What is 'the position' for? Why would we want to alter or read it? If we change it - what happens? In a pratical example, I have a a stream that periodically gets written to, and I have a thread that attempts to read from it (ideally ASAP). From reading many SO issues, I reset the position field to zero to start my reading. Once this is done: Does this affect where the writer to this stream is going to attempt to put the data? Do I need to keep track of the last write position myself? (ie if I set the position to zero to read, does the writer begin to overwrite everything from the first byte?) If so, do I need a semaphore/lock around this 'position' field (subclassing, perhaps?) due to my two threads accessing it? If I don't handle this property, does the writer just overflow the buffer? Perhaps I don't understand the Stream itself - I'm regarding it as a FIFO pipe: shove data in at one end, and suck it out at the other. If it's not like this, then do I have to keep copying the data past my last read (ie from position 0x84 on) back to the start of my buffer? I've seriously tried to research all of this for quite some time - but I'm new to .NET. Perhaps the Streams have a long, proud (undocumented) history that everyone else implicitly understands. But for a newcomer, it's like reading the manual to your car, and finding out: The accelerator pedal affects the volume of fuel and air sent to the fuel injectors. It does not affect the volume of the entertainment system, or the air pressure in any of the tires, if fitted. Technically true, but seriously, what we want to know is that if we mash it to the floor you go faster..

    Read the article

  • SQL query - choosing 'last updated' record in a group, better db design?

    - by Jimmy
    Hi, Let's say I have a MySQL database with 3 tables: table 1: Persons, with 1 column ID (int) table 2: Newsletters, with 1 column ID (int) table 3: Subscriptions, with columns Person_ID (int), Newsletter_ID (int), Subscribed (bool), Updated (Datetime) Subscriptions.Person_ID points to a Person, and Subscription.Newsletter_ID points to a Newsletter. Thus, each person may have 0 or more subscriptions to 0 or more magazines at once. The table Subscriptions will also store the entire history of each person's subscriptions to each newsletter. If a particular Person_ID-Newsletter_ID pair doesn't have a row in the Subscriptions table, then it's equivalent to that pair having a subscription status of 'false'. Here is a sample dataset Persons ID 1 2 3 Newsletters ID 4 5 6 Subscriptions Person_ID Newsletter_ID Subscribed Updated 2 4 true 2010-05-01 3 4 true 2010-05-01 3 5 true 2010-05-10 3 4 false 2010-05-15 Thus, as of 2010-05-16, Person 1 has no subscription, Person 2 has a subscription to Newsletter 4, and Person 3 has a subscription to Newsletter 5. Person 3 had a subscription to Newsletter 4 for a while, but not anymore. I'm trying to do 2 kinds of query. A query that shows everyone's active subscriptions as of query time (we can assume that updated will never be in the future -- thus, this means returning the record with the latest 'updated' value for each Person_ID-Newsletter_ID pair, as long as Subscribed is true (if the latest record for a Person_ID-Newsletter_ID pair has a Subscribed status of false, then I don't want that record returned)). A query that returns all active subscriptions for a specific newsletter - same qualification as in 1. regarding records with 'false' in the Subscribed column. I don't use SQL/databases often enough to tell if this design is good, or if the SQL queries needed would be slow on a database with, say, 1M records in the Subscriptions table. I was using the Visual query builder tool in Visual Studio 2010 but I can't even get the query to return the latest updated record for each Person_ID-Newsletter_ID pair. Is it possible to come up with SQL queries that don't involve using subqueries (presumably because they would become too slow with a larger data set)? If not, would it be a better design to have a separate Subscriptions_History table, and every time a subscription status for a Person_ID-Newsletter-ID pair is added to Subscriptions, any existing record for that pair is moved to Subscriptions_History (that way the Subscriptions table only ever contains the latest status update for any Person_ID-Newsletter_ID pair)? I'm using .net on Windows, so would it be easier (or the same, or harder) to do this kind of queries using Linq? Entity Framework? Thanks!

    Read the article

  • Android onActivityResult is always 0

    - by Dean
    This has been killing me for two days now. I have a main Activity A which calls a second Activity B. Activity B simply presents the user with a listview. When I press an item on the list view I want a couple of strings to be passed back to the main Activity A and Activiy B will finish. The problem is I always get a resultcode of 0 and the data bundle is null. I really don't understand why this is happening. Here is my code. Start Activity B for result; Test.setOnClickListener(new View.OnClickListener() { @Override public void onClick(View v) { Intent i = new Intent(recipeActivity.this, BrowseLoadRecipes.class); startActivityForResult(i, RECIPE_CHOOSER); } }); This starts the second Activity fine. Activity B populates a listview and when I click an item I'm trying to send some data back to the calling Activity A. Any text at the moment, so I used the following in Activity B; lv.setOnItemClickListener(new OnItemClickListener() { @Override public void onItemClick(AdapterView<?> a, View v, int position, long id) { Bundle bundle = new Bundle(); bundle.putString("TEXT", "Please work... pleeeeaasee"); Intent mIntent = new Intent(); mIntent.putExtras(bundle); setResult(RESULT_OK, mIntent); finish(); } }); In the calling activity I have the following listening for the return as follows; protected void onActivityResult(int requestCode, int resultCode, Intent data) { switch(requestCode) { //TODO case RECIPE_CHOOSER: Toast.makeText(getApplicationContext(), "In recipe return", Toast.LENGTH_SHORT).show(); Toast.makeText(getApplicationContext(), "resultCode is " + String.valueOf(resultCode), Toast.LENGTH_SHORT).show(); if (resultCode == RESULT_OK) { Bundle b = getIntent().getExtras(); Toast.makeText(getApplicationContext(), "Returned " + b.getString("TEXT"), Toast.LENGTH_LONG).show(); } if (resultCode == RESULT_CANCELED) { } break; } } } I can see that the request code is correctly returned, but the resultcode is always a 0 and the data is always a null. I've ran through the debug and the setResult is doing its job and the bundle does indeed have the data I'm passing, but it's lost at some point along the way. Is there something in the manifest I'm missing or something. It's killed my progress on this project so far. Any help would truly be appreciated. Thanks, Dean

    Read the article

  • SQL Server architecture guidance

    - by Liam
    Hi, We are designing a new version of our existing product on a new schema. Its an internal web application with possibly 100 concurrent users (max)This will run on a SQL Server 2008 database. On of the discussion items recently is whether we should have a single database of split the database for performance reasons across 2 separate databases. The database could grow anywhere from 50-100GB over 5 years. We are Developers and not DBAs so it would be nice to get some general guidance. [I know the answer is not simple as it depends on the schema, archiving policy, amount of data etc. ] Option 1 Single Main Database [This is my preferred option]. The plan would be to have all the tables in a single database and possibly to use file groups and partitioning to separate the data if required across multiple disks. [Use schema if appropriate]. This should deal with the performance concerns One of the comments wrt this was that the a single server instance would still be processing this data so there would still be a processing bottle neck. For reporting we could have a separate reporting DB but this is still being discussed. Option 2 Split the database into 2 separate databases DB1 - Customers, Accounts, Customer resources etc DB2 - This would contain the bulk of the data [i.e. Vehicle tracking data, financial transaction tables etc]. These tables would typically contain a lot of data. [It could reside on a separate server if required] This plan would involve keeping the main data in a smaller database [DB1] and retaining the [mainly] read only transaction type data in a separate DB [DB2]. The UI would mainly read from DB1 and thus be more responsive. [I'm aware that this option makes it harder for Referential Integrity to be enforced.] Points for consideration As we are at the design stage we can at least make proper use of indexes to deal performance issues so thats why option 1 to me is attractive and its more of a standard approach. For both options we are considering implementing an archiving database. Apologies for the long Question. In summary the question is 1 DB or 2? Thanks in advance, Liam

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • Database schema for simple stats project

    - by Bubnoff
    Backdrop: I have a file hierarchy of cvs files for multiple locations named by dates they cover ...by month specifically. Each cvs file in the folder is named after the location. eg', folder name: 2010-feb contains: location1.csv location2.csv Each CSV file holds records like this: 2010-06-28, 20:30:00 , 0 2010-06-29, 08:30:00 , 0 2010-06-29, 09:30:00 , 0 2010-06-29, 10:30:00 , 0 2010-06-29, 11:30:00 , 0 meaning of record columns ( column names ): Date, time, # of sessions I have a perl script that pulls the data from this mess and originally I was going to store it as json files, but am thinking a database might be more appropriate long term ...comparing year to year trends ...fun stuff like that. Pt 2 - My question/problem: So I now have a REST service that coughs up json with a test database. My question is [ I suck at db design ], how best to design a database backend for this? I am thinking the following tables would suffice and keep it simple: Location: (PK)location_code, name session: (PK)id, (FK)location_code, month, hour, num_sessions I need to be able to average sessions (plus min and max) for each hour across days of week in addition to days of week in a given month or months. I've been using perl hashes to do this and am trying to decide how best to implement this with a database. Do you think stored procedures should be used? As to the database, depending on info gathered here, it will be postgresql or sqlite. If there is no compelling reason for postgresql I'll stick with sqlite. How and where should I compare the data to hours of operation. I am storing the hours of operation in a yaml file. I currently 'match' the hour in the data to a hash from the yaml to do this. Would a database open simpler methods? I am thinking I would do this comparison as I do now then insert the data. Can be recalled with: SELECT hour, num_sessions FROM session WHERE location_code=LOC1 Since only hours of operation are present, I do not need to worry about it. Should I calculate all results as I do now then store as a stats table for different 'reports'? This, rather than processing on demand? How would this look? Anyway ...I ramble. Thanks for reading! Bubnoff

    Read the article

  • Jquery-UI tabs : Double loading of the default tab with

    - by Stephane
    I use jqueryui-tabs to display a tabbed UI. here is how my markup looks in a MasterPage: <div id="channel-tabs" class="ui-tabs"> <ul class="ui-tabs-nav"> <li><%=Html.ActionLink("Blogs", "Index", "Blog", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, new{ title="Blog Results" }) %></li> <li><%=Html.ActionLink("Forums", "Index", "Forums", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> <li><%=Html.ActionLink("Twitter", "Index", "Twitter", new { query = Model.Query, lang = Model.SelectedLanguage, fromTo = Model.FromTo, filters = Model.FilterId }, null) %></li> </ul> <div id="Blog_Results"> <asp:ContentPlaceHolder ID="ResultPlaceHolder" runat="server"> </asp:ContentPlaceHolder> </div> If the content is loaded via ajax, I return a partial view with the content of the tab. If the content is loaded directly, I load a page that include the content in the ContentPlaceHolder. somewhat like this : <asp:Content ID="Content2" ContentPlaceHolderID="BlogPlaceHolder" runat="server"> <%=Html.Partial("Partial",Model) %> </asp:Content> //same goes for the other tabs. With this in place, if I access the url "/Forums" It loads the forum content in the Blog tab first, trigger the ajax load of the Blog tab and replace the content with the blog content. I tried putting a different placeholder for each tab, but that didn't fix everything either, since when loading "/Forums" it will sure load the forum tab, but the Blog tab will show up first. Furthermore, when using separate placeholders, If I load the "/Blogs" url, It will first load the content statically in the Blog contentplaceholder and then trigger an ajax call to load it a second time and replace it. If I just link the tab to the hashtag, then when loading the forum tabs, I won't get the blog content... How would you achieve the expected behaviour? I feel like I might have a deeper probelm in the organization of my views. Is putting the tabs in the masterpage the way to go? Maybe I should just hijax the links manually and not rely on jquery-ui tabs to do the work for me. I cannot load all tabs by default and display them using the hash tags, I need an ajax loading because it is a search process that can be long. So to sum up : /Forum should load the forum tab, and let the other tabs be loaded with an ajax call when clicking on it. /Twitter should load the twitter tab and let the other tabs.... the same goes for /Blogs and any tabs I would add later.

    Read the article

  • Error with connection in my database servlet

    - by Zerobu
    Hello, I am writing a Database servlet, all seems well except that there seems to be an error in my connection import java.io.IOException; import java.sql.Connection; import java.sql.DriverManager; import java.sql.PreparedStatement; import java.sql.ResultSet; import java.sql.SQLException; import java.sql.Statement; import java.util.ArrayList; import javax.servlet.RequestDispatcher; import javax.servlet.ServletContext; import javax.servlet.ServletException; import javax.servlet.http.HttpServlet; import javax.servlet.http.HttpServletRequest; import javax.servlet.http.HttpServletResponse; public class DBServlet3 extends HttpServlet { private static final long serialVersionUID = 1L; @Override public void init() throws ServletException { super.init(); try { String jdbcDriverClass= getServletContext().getInitParameter( "jdbcDriverClass" ); if (jdbcDriverClass == null) throw new ServletException( "Could not find jdbcDriverClass initialization parameter" ); Class.forName( jdbcDriverClass ); } catch (ClassNotFoundException e) { throw new ServletException( "Could not load JDBC driver class", e ); } } @Override protected void doGet( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { RequestDispatcher dispatcher= request.getRequestDispatcher( "/db.jsp" ); ServletContext application= getServletContext(); ArrayList<String> names= new ArrayList<String>(); try { Connection connection= null; Statement statement= null; ResultSet results= null; try { String jdbcUrl= application.getInitParameter( "jdbcUrl" ); String jdbcUser= application.getInitParameter( "jdbcUser" ); String jdbcPassword= application.getInitParameter( "jdbcPassword" ); connection= DriverManager.getConnection( jdbcUrl, jdbcUser, jdbcPassword ); statement= connection.createStatement(); results= statement.executeQuery( "SELECT * FROM students" ); while (results.next()) { String name= results.getString( "name" ); names.add( name ); } } finally { if (results != null) results.close(); if (statement != null) statement.close(); if (connection != null) connection.close(); } } catch (SQLException e) { throw new ServletException( e ); } request.setAttribute( "names", names ); dispatcher.forward( request, response ); } @Override protected void doPost( HttpServletRequest request, HttpServletResponse response ) throws ServletException, IOException { String sql= "INSERT INTO students VALUES (" + request.getParameter( "id" ) + ", '" + request.getParameter( "name" ) + "')"; sql= "INSERT INTO students VALUES (?, ?, ?, ?)"; PreparedStatement statement= connection.prepareStatement( sql ); //error on this line statement.setString( 1, request.getParameter( "id" ) ); statement.setString( 2, request.getParameter( "name" ) ); } }

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • SQL Server 2005: Update rows in a specified order (like ORDER BY)?

    - by JMTyler
    I want to update rows of a table in a specific order, like one would expect if including an ORDER BY clause, but SQL Server does not support the ORDER BY clause in UPDATE queries. I have checked out this question which supplied a nice solution, but my query is a bit more complicated than the one specified there. UPDATE TableA AS Parent SET Parent.ColA = Parent.ColA + (SELECT TOP 1 Child.ColA FROM TableA AS Child WHERE Child.ParentColB = Parent.ColB ORDER BY Child.Priority) ORDER BY Parent.Depth DESC; So, what I'm hoping that you'll notice is that a single table (TableA) contains a hierarchy of rows, wherein one row can be the parent or child of any other row. The rows need to be updated in order from the deepest child up to the root parent. This is because TableA.ColA must contain an up-to-date concatenation of its own current value with the values of its children (I realize this query only concats with one child, but that is for the sake of simplicity - the purpose of the example in this question does not necessitate any more verbosity), therefore the query must update from the bottom up. The solution suggested in the question I noted above is as follows: UPDATE messages SET status=10 WHERE ID in (SELECT TOP (10) Id FROM Table WHERE status=0 ORDER BY priority DESC ); The reason that I don't think I can use this solution is because I am referencing column values from the parent table inside my subquery (see WHERE Child.ParentColB = Parent.ColB), and I don't think two sibling subqueries would have access to each others' data. So far I have only determined one way to merge that suggested solution with my current problem, and I don't think it works. UPDATE TableA AS Parent SET Parent.ColA = Parent.ColA + (SELECT TOP 1 Child.ColA FROM TableA AS Child WHERE Child.ParentColB = Parent.ColB ORDER BY Child.Priority) WHERE Parent.Id IN (SELECT Id FROM TableA ORDER BY Parent.Depth DESC); The WHERE..IN subquery will not actually return a subset of the rows, it will just return the full list of IDs in the order that I want. However (I don't know for sure - please tell me if I'm wrong) I think that the WHERE..IN clause will not care about the order of IDs within the parentheses - it will just check the ID of the row it currently wants to update to see if it's in that list (which, they all are) in whatever order it is already trying to update... Which would just be a total waste of cycles, because it wouldn't change anything. So, in conclusion, I have looked around and can't seem to figure out a way to update in a specified order (and included the reason I need to update in that order, because I am sure I would otherwise get the ever-so-useful "why?" answers) and I am now hitting up Stack Overflow to see if any of you gurus out there who know more about SQL than I do (which isn't saying much) know of an efficient way to do this. It's particularly important that I only use a single query to complete this action. A long question, but I wanted to cover my bases and give you guys as much info to feed off of as possible. :) Any thoughts?

    Read the article

  • Calculate minimum moves to solve a puzzle

    - by Luke
    I'm in the process of creating a game where the user will be presented with 2 sets of colored tiles. In order to ensure that the puzzle is solvable, I start with one set, copy it to a second set, then swap tiles from one set to another. Currently, (and this is where my issue lies) the number of swaps is determined by the level the user is playing - 1 swap for level 1, 2 swaps for level 2, etc. This same number of swaps is used as a goal in the game. The user must complete the puzzle by swapping a tile from one set to the other to make the 2 sets match (by color). The order of the tiles in the (user) solved puzzle doesn't matter as long as the 2 sets match. The problem I have is that as the number of swaps I used to generate the puzzle approaches the number of tiles in each set, the puzzle becomes easier to solve. Basically, you can just drag from one set in whatever order you need for the second set and solve the puzzle with plenty of moves left. What I am looking to do is after I finish building the puzzle, calculate the minimum number of moves required to solve the puzzle. Again, this is almost always less than the number of swaps used to create the puzzle, especially as the number of swaps approaches the number of tiles in each set. My goal is to calculate the best case scenario and then give the user a "fudge factor" (i.e. 1.2 times the minimum number of moves). Solving the puzzle in under this number of moves will result in passing the level. A little background as to how I currently have the game configured: Levels 1 to 10: 9 tiles in each set. 5 different color tiles. Levels 11 to 20: 12 tiles in each set. 7 different color tiles. Levels 21 to 25: 15 tiles in each set. 10 different color tiles. Swapping within a set is not allowed. For each level, there will be at least 2 tiles of a given color (one for each set in the solved puzzle). Is there any type of algorithm anyone could recommend to calculate the minimum number of moves to solve a given puzzle?

    Read the article

  • I have a problem with a TextBox in an application... A window has a Grid with two columns. The left

    - by haagel
    I have a problem with a TextBox in an application... A window has a Grid with two columns. The left column contains a control with a constant width but with a height that adapts. The right column contains a TextBox that takes up all remaining space in the Grid (and thereby in the Window). The Grid is given a minimal width and height and is wrapped within a ScrollViewer. If the user resizes the window to be smaller than the minimal widht/height of the Grid, scrollbars are displayed. This is exactly how I want it to be. However, a problem occurs when the user starts typing text. If the text is to long to fit in one line in the TextBox, I want the text to wrap. Therefore I set TextWrapping="Wrap" on the TextBox. But since the TextBox has an automatic width and is wrapped in a ScrollViewer (its actually the whole Grid that is wrapped), the TextBox just keeps expanding to the right. I do want the TextBox to expand if the window is expanded, but I don't want the TextBox to expand by the text. Rather the text should wrap inside the available TextBox. If the text don't fit within the TextBox height, a scrollbar should be displayed within the TextBox. Is there a way to accomplish this? Below is some code that shows my problem. <Window x:Class="AdaptingTextBoxes.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="300" Width="400" Background="DarkCyan"> <Grid Margin="10" Name="LayoutRoot"> <ScrollViewer HorizontalScrollBarVisibility="Auto" VerticalScrollBarVisibility="Auto"> <Grid MinWidth="300" MinHeight="200"> <Grid.ColumnDefinitions> <ColumnDefinition Width="auto" /> <ColumnDefinition Width="*" /> </Grid.ColumnDefinitions> <Button Grid.Column="0" Margin="0,0,10,0" Content="Button" Width="100" /> <TextBox Grid.Column="1" AcceptsReturn="True" TextWrapping="Wrap" ScrollViewer.HorizontalScrollBarVisibility="Disabled" ScrollViewer.VerticalScrollBarVisibility="Auto" /> </Grid> </ScrollViewer> </Grid> </Window>

    Read the article

  • Casting to derived type problem in C++

    - by GONeale
    Hey there everyone, I am quite new to C++, but have worked with C# for years, however it is not helping me here! :) My problem: I have an Actor class which Ball and Peg both derive from on an objective-c iphone game I am working on. As I am testing for collision, I wish to set an instance of Ball and Peg appropriately depending on the actual runtime type of actorA or actorB. My code that tests this as follows: // Actors that collided Actor *actorA = (Actor*) bodyA->GetUserData(); Actor *actorB = (Actor*) bodyB->GetUserData(); Ball* ball; Peg* peg; if (static_cast<Ball*> (actorA)) { // true ball = static_cast<Ball*> (actorA); } else if (static_cast<Ball*> (actorB)) { ball = static_cast<Ball*> (actorB); } if (static_cast<Peg*> (actorA)) { // also true?! peg = static_cast<Peg*> (actorA); } else if (static_cast<Peg*> (actorB)) { peg = static_cast<Peg*> (actorB); } if (peg != NULL) { [peg hitByBall]; } Once ball and peg are set, I then proceed to run the hitByBall method (objective c). Where my problem really lies is in the casting procedurel Ball casts fine from actorA; the first if (static_cast<>) statement steps in and sets the ball pointer appropriately. The second step is to assign the appropriate type to peg. I know peg should be a Peg type and I previously know it will be actorB, however at runtime, detecting the types, I was surprised to find actually the third if (static_cast<>) statement stepped in and set this, this if statement was to check if actorA was a Peg, which we already know actorA is a Ball! Why would it have stepped here and not in the fourth if statement? The only thing I can assume is how casting works differently from c# and that is it finds that actorA which is actually of type Ball derives from Actor and then it found when static_cast<Peg*> (actorA) is performed it found Peg derives from Actor too, so this is a valid test? This could all come down to how I have misunderstood the use of static_cast. How can I achieve what I need? :) I'm really uneasy about what feels to me like a long winded brute-casting attempt here with a ton of ridiculous if statements. I'm sure there is a more elegant way to achieve a simple cast to Peg and cast to Ball dependent on actual type held in actorA and actorB. Hope someone out there can help! :) Thanks a lot.

    Read the article

< Previous Page | 596 597 598 599 600 601 602 603 604 605 606 607  | Next Page >