Search Results

Search found 21350 results on 854 pages for 'url parsing'.

Page 606/854 | < Previous Page | 602 603 604 605 606 607 608 609 610 611 612 613  | Next Page >

  • Extracting Certain XML Elements with PHP SimpleXML

    - by Peter
    I am having some problems parsing this piece of XML using SimpleXML. There is always only one Series element, and a variable number of Episode elements beneath. I want to parse XML so I can store the Series data in one table, and all the Episode data in another table. XML: <Data> <Series> <id>80348</id> <Genre>|Action and Adventure|Comedy|Drama|</Genre> <IMDB_ID>tt0934814</IMDB_ID> <SeriesID>68724</SeriesID> <SeriesName>Chuck</SeriesName> <banner>graphical/80348-g.jpg</banner> </Series> <Episode> <id>935481</id> <Director>Robert Duncan McNeill</Director> <EpisodeName>Chuck Versus the Third Dimension 2D</EpisodeName> <EpisodeNumber>1</EpisodeNumber> <seasonid>27984</seasonid> <seriesid>80348</seriesid> </Episode> <Episode> <id>935483</id> <Director>Robert Duncan McNeill</Director> <EpisodeName>Buy More #15: Employee Health</EpisodeName> <EpisodeNumber>2</EpisodeNumber> <seasonid>27984</seasonid> <seriesid>80348</seriesid> </Episode> </Data> When I attempt to access just the first Series element and child nodes, or iterate through the Episode elements only it does not work. I have also tried to use DOMDocument with SimpleXML, but could not get that to work at all. PHP Code: <?php if(file_exists('en.xml')) { $data = simplexml_load_file('en.xml'); foreach($data as $series) { echo 'id: <br />' . $series->id; echo 'imdb: <br />' . $series->IMDB_ID; } } ?> Output: id:80348 imdb:tt0934814 id:935481 imdb: id:1534641 imdb: Any help would be greatly appreciated.

    Read the article

  • Validating against a Schema with JAXB

    - by fwgx
    I've been looking for solutions to this problem for far too long considering how easy it sounds so I've come for some help. I have an XML Schema which I have used with xjc to create my JAXB binding. This works fine when the XML is well formed. Unfortunately it also doesn't complain when the XML is not well formed. I cannot figure out how to do proper full validation against the schema when I try to unmarshall an XML file. I have managed to use a ValidationEventCollector to handle events, which works for XML parsing errors such as mismatched tags but doesn't raise any events when there is a tag that is required but is completely absent. From what I have seen validation can be done againsta schema, but you must know the path to the schema in order to pass it into the setSchema() method. The problem I have is that the path to the schema is stored in the XML header and I can't knwo at run time where the schema is going to be. Which is why it's stored in the XML file: <?xml version="1.0" encoding="utf-8"?> <DDSSettings xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:noNamespaceSchemaLocation="/a/big/long/path/to/a/schema/file/DDSSettings.xsd"> <Field1>1</Field1> <Field2>-1</Field2> ...etc Every example I see uses setValidating(true), which is now deprecated, so throws an exception. This is the Java code I have so far, which seems to only do XML validation, not schema validation: try { JAXBContext jc = new JAXBContext() { private final JAXBContext jaxbContext = JAXBContext.newInstance("blah"); @Override public Unmarshaller createUnmarshaller() throws JAXBException { Unmarshaller unmarshaller = jaxbContext.createUnmarshaller(); ValidationEventCollector vec = new ValidationEventCollector() { @Override public boolean handleEvent(ValidationEvent event) throws RuntimeException { ValidationEventLocator vel = event.getLocator(); if (event.getSeverity() == event.ERROR || event.getSeverity() == event.FATAL_ERROR) { String error = "XML Validation Exception: " + event.getMessage() + " at row: " + vel.getLineNumber() + " column: " + vel.getColumnNumber(); System.out.println(error); } m_unmarshallingOk = false; return false; } }; unmarshaller.setEventHandler(vec); return unmarshaller; } @Override public Marshaller createMarshaller() throws JAXBException { throw new UnsupportedOperationException("Not supported yet."); } @Override @SuppressWarnings("deprecation") public Validator createValidator() throws JAXBException { throw new UnsupportedOperationException("Not supported yet."); } }; Unmarshaller unmarshaller = jc.createUnmarshaller(); m_ddsSettings = (com.ultra.DDSSettings)unmarshaller.unmarshal(new File(xmlfileName)); } catch (UnmarshalException ex) { Logger.getLogger(UniversalDomainParticipant.class.getName()).log( Level.SEVERE, null, ex); } catch (JAXBException ex) { Logger.getLogger(UniversalDomainParticipant.class.getName()).log( Level.SEVERE, null, ex); } So what is the proper way to do this validation? I was expecting there to be a validate() method on the JAXB generated classes, but I guess that would be too simple for Java.

    Read the article

  • Streamed mp3 only plays for 1 second

    - by angel6
    Hi, I'm using the plaympeg.c (modified) code of smpeg as a media player. I've got ffserver running as a streaming server. I'm a streaming an mp3 file over http. But when I run plaympeg.c, it plays the streamed file only for a second. When I run plaympeg again, it starts off from where it left and plays for 1 second. Does anyone know why this happens an how to fix it? I've tested it out on WMP and it plays the entire file in one go. So, i guess it's not a problem with the streaming or ffserver.conf include include include include /* #ifdef unix */ include include include include include include include define NET_SUPPORT /* General network support */ define HTTP_SUPPORT /* HTTP support */ ifdef NET_SUPPORT include include include include endif include "smpeg.h" ifdef NET_SUPPORT int tcp_open(char * address, int port) { struct sockaddr_in stAddr; struct hostent * host; int sock; struct linger l; memset(&stAddr,0,sizeof(stAddr)); stAddr.sin_family = AF_INET ; stAddr.sin_port = htons(port); if((host = gethostbyname(address)) == NULL) return(0); stAddr.sin_addr = *((struct in_addr *) host-h_addr_list[0]) ; if((sock = socket(AF_INET, SOCK_STREAM, IPPROTO_TCP)) < 0) return(0); l.l_onoff = 1; l.l_linger = 5; if(setsockopt(sock, SOL_SOCKET, SO_LINGER, (char*) &l, sizeof(l)) < 0) return(0); if(connect(sock, (struct sockaddr *) &stAddr, sizeof(stAddr)) < 0) return(0); return(sock); } ifdef HTTP_SUPPORT int http_open(char * arg) { char * host; int port; char * request; int tcp_sock; char http_request[1024]; char c; printf("\nin http_open passed parameter = %s\n",arg); /* Check for URL syntax */ if(strncmp(arg, "http://", strlen("http://"))) return(0); /* Parse URL */ port = 80; host = arg + strlen("http://"); if((request = strchr(host, '/')) == NULL) return(0); request++ = 0; if(strchr(host, ':') != NULL) / port is specified */ { port = atoi(strchr(host, ':') + 1); *strchr(host, ':') = 0; } /* Open a TCP socket */ if(!(tcp_sock = tcp_open(host, port))) { perror("http_open"); return(0); } /* Send HTTP GET request */ sprintf(http_request, "GET /%s HTTP/1.0\r\n" "User-Agent: Mozilla/2.0 (Win95; I)\r\n" "Pragma: no-cache\r\n" "Host: %s\r\n" "Accept: /\r\n" "\r\n", request, host); send(tcp_sock, http_request, strlen(http_request), 0); /* Parse server reply */ do read(tcp_sock, &c, sizeof(char)); while(c != ' '); read(tcp_sock, http_request, 4*sizeof(char)); http_request[4] = 0; if(strcmp(http_request, "200 ")) { fprintf(stderr, "http_open: "); do { read(tcp_sock, &c, sizeof(char)); fprintf(stderr, "%c", c); } while(c != '\r'); fprintf(stderr, "\n"); return(0); } return(tcp_sock); } endif endif void update(SDL_Surface *screen, Sint32 x, Sint32 y, Uint32 w, Uint32 h) { if ( screen-flags & SDL_DOUBLEBUF ) { SDL_Flip(screen); } } /* Flag telling the UI that the movie or song should be skipped */ int done; void next_movie(int sig) { done = 1; } int main(int argc, char *argv[]) { int use_audio, use_video; int fullscreen; int scalesize; int scale_width, scale_height; int loop_play; int i, pause; int volume; Uint32 seek; float skip; int bilinear_filtering; SDL_Surface *screen; SMPEG *mpeg; SMPEG_Info info; char *basefile; SDL_version sdlver; SMPEG_version smpegver; int fd; char buf[32]; int status; printf("\nchecking command line options "); /* Get the command line options */ use_audio = 1; use_video = 1; fullscreen = 0; scalesize = 1; scale_width = 0; scale_height = 0; loop_play = 0; volume = 100; seek = 0; skip = 0; bilinear_filtering = 0; fd = 0; for ( i=1; argv[i] && (argv[i][0] == '-') && (argv[i][1] != 0); ++i ) { if ( strcmp(argv[i], "--fullscreen") == 0 ) { fullscreen = 1; } else if ((strcmp(argv[i], "--seek") == 0)||(strcmp(argv[i], "-S") == 0)) { ++i; if ( argv[i] ) { seek = atol(argv[i]); } } else if ((strcmp(argv[i], "--volume") == 0)||(strcmp(argv[i], "-v") == 0)) { ++i; if (i >= argc) { fprintf(stderr, "Please specify volume when using --volume or -v\n"); return(1); } if ( argv[i] ) { volume = atoi(argv[i]); } if ( ( volume < 0 ) || ( volume 100 ) ) { fprintf(stderr, "Volume must be between 0 and 100\n"); volume = 100; } } else { fprintf(stderr, "Warning: Unknown option: %s\n", argv[i]); } } printf("\nuse video = %d, use audio = %d\n",use_video, use_audio); printf("\ngoing to check input parameters\n"); if defined(linux) || defined(FreeBSD) /* Plaympeg doesn't need a mouse */ putenv("SDL_NOMOUSE=1"); endif /* Play the mpeg files! */ status = 0; for ( ; argv[i]; ++i ) { /* Initialize SDL */ if ( use_video ) { if ((SDL_Init(SDL_INIT_VIDEO) < 0) || !SDL_VideoDriverName(buf, 1)) { fprintf(stderr, "Warning: Couldn't init SDL video: %s\n", SDL_GetError()); fprintf(stderr, "Will ignore video stream\n"); use_video = 0; } printf("\ninitialised video\n"); } if ( use_audio ) { if ((SDL_Init(SDL_INIT_AUDIO) < 0) || !SDL_AudioDriverName(buf, 1)) { fprintf(stderr, "Warning: Couldn't init SDL audio: %s\n", SDL_GetError()); fprintf(stderr, "Will ignore audio stream\n"); use_audio = 0; } } /* Allow Ctrl-C when there's no video output */ signal(SIGINT, next_movie); printf("\nchecking defined supports\n"); /* Create the MPEG stream */ ifdef NET_SUPPORT printf("\ndefined NET_SUPPORT\n"); ifdef HTTP_SUPPORT printf("\ndefined HTTP_SUPPORT\n"); /* Check if source is an http URL */ printf("\nabout to call http_open\n"); printf("\nhere we go\n"); if((fd = http_open(argv[i])) != 0) mpeg = SMPEG_new_descr(fd, &info, use_audio); else endif endif { if(strcmp(argv[i], "-") == 0) /* Use stdin for input */ mpeg = SMPEG_new_descr(0, &info, use_audio); else mpeg = SMPEG_new(argv[i], &info, use_audio); } if ( SMPEG_error(mpeg) ) { fprintf(stderr, "%s: %s\n", argv[i], SMPEG_error(mpeg)); SMPEG_delete(mpeg); status = -1; continue; } SMPEG_enableaudio(mpeg, use_audio); SMPEG_enablevideo(mpeg, use_video); SMPEG_setvolume(mpeg, volume); /* Print information about the video */ basefile = strrchr(argv[i], '/'); if ( basefile ) { ++basefile; } else { basefile = argv[i]; } if ( info.has_audio && info.has_video ) { printf("%s: MPEG system stream (audio/video)\n", basefile); } else if ( info.has_audio ) { printf("%s: MPEG audio stream\n", basefile); } else if ( info.has_video ) { printf("%s: MPEG video stream\n", basefile); } if ( info.has_video ) { printf("\tVideo %dx%d resolution\n", info.width, info.height); } if ( info.has_audio ) { printf("\tAudio %s\n", info.audio_string); } if ( info.total_size ) { printf("\tSize: %d\n", info.total_size); } if ( info.total_time ) { printf("\tTotal time: %f\n", info.total_time); } /* Set up video display if needed */ if ( info.has_video && use_video ) { const SDL_VideoInfo *video_info; Uint32 video_flags; int video_bpp; int width, height; /* Get the "native" video mode */ video_info = SDL_GetVideoInfo(); switch (video_info->vfmt->BitsPerPixel) { case 16: case 24: case 32: video_bpp = video_info->vfmt->BitsPerPixel; break; default: video_bpp = 16; break; } if ( scale_width ) { width = scale_width; } else { width = info.width; } width *= scalesize; if ( scale_height ) { height = scale_height; } else { height = info.height; } height *= scalesize; video_flags = SDL_SWSURFACE; if ( fullscreen ) { video_flags = SDL_FULLSCREEN|SDL_DOUBLEBUF|SDL_HWSURFACE; } video_flags |= SDL_ASYNCBLIT; video_flags |= SDL_RESIZABLE; screen = SDL_SetVideoMode(width, height, video_bpp, video_flags); if ( screen == NULL ) { fprintf(stderr, "Unable to set %dx%d video mode: %s\n", width, height, SDL_GetError()); continue; } SDL_WM_SetCaption(argv[i], "plaympeg"); if ( screen->flags & SDL_FULLSCREEN ) { SDL_ShowCursor(0); } SMPEG_setdisplay(mpeg, screen, NULL, update); SMPEG_scaleXY(mpeg, screen->w, screen->h); } else { SDL_QuitSubSystem(SDL_INIT_VIDEO); } /* Set any special playback parameters */ if ( loop_play ) { SMPEG_loop(mpeg, 1); } /* Seek starting position */ if(seek) SMPEG_seek(mpeg, seek); /* Skip seconds to starting position */ if(skip) SMPEG_skip(mpeg, skip); /* Play it, and wait for playback to complete */ SMPEG_play(mpeg); done = 0; pause = 0; while ( ! done && ( pause || (SMPEG_status(mpeg) == SMPEG_PLAYING) ) ) { SDL_Event event; while ( use_video && SDL_PollEvent(&event) ) { switch (event.type) { case SDL_VIDEORESIZE: { SDL_Surface *old_screen = screen; SMPEG_pause(mpeg); screen = SDL_SetVideoMode(event.resize.w, event.resize.h, screen->format->BitsPerPixel, screen->flags); if ( old_screen != screen ) { SMPEG_setdisplay(mpeg, screen, NULL, update); } SMPEG_scaleXY(mpeg, screen-w, screen-h); SMPEG_pause(mpeg); } break; case SDL_KEYDOWN: if ( (event.key.keysym.sym == SDLK_ESCAPE) || (event.key.keysym.sym == SDLK_q) ) { // Quit done = 1; } else if ( event.key.keysym.sym == SDLK_RETURN ) { // toggle fullscreen if ( event.key.keysym.mod & KMOD_ALT ) { SDL_WM_ToggleFullScreen(screen); fullscreen = (screen-flags & SDL_FULLSCREEN); SDL_ShowCursor(!fullscreen); } } else if ( event.key.keysym.sym == SDLK_UP ) { // Volume up if ( volume < 100 ) { if ( event.key.keysym.mod & KMOD_SHIFT ) { // 10+ volume += 10; } else if ( event.key.keysym.mod & KMOD_CTRL ) { // 100+ volume = 100; } else { // 1+ volume++; } if ( volume 100 ) volume = 100; SMPEG_setvolume(mpeg, volume); } } else if ( event.key.keysym.sym == SDLK_DOWN ) { // Volume down if ( volume 0 ) { if ( event.key.keysym.mod & KMOD_SHIFT ) { volume -= 10; } else if ( event.key.keysym.mod & KMOD_CTRL ) { volume = 0; } else { volume--; } if ( volume < 0 ) volume = 0; SMPEG_setvolume(mpeg, volume); } } else if ( event.key.keysym.sym == SDLK_PAGEUP ) { // Full volume volume = 100; SMPEG_setvolume(mpeg, volume); } else if ( event.key.keysym.sym == SDLK_PAGEDOWN ) { // Volume off volume = 0; SMPEG_setvolume(mpeg, volume); } else if ( event.key.keysym.sym == SDLK_SPACE ) { // Toggle play / pause if ( SMPEG_status(mpeg) == SMPEG_PLAYING ) { SMPEG_pause(mpeg); pause = 1; } else { SMPEG_play(mpeg); pause = 0; } } else if ( event.key.keysym.sym == SDLK_RIGHT ) { // Forward if ( event.key.keysym.mod & KMOD_SHIFT ) { SMPEG_skip(mpeg, 100); } else if ( event.key.keysym.mod & KMOD_CTRL ) { SMPEG_skip(mpeg, 50); } else { SMPEG_skip(mpeg, 5); } } else if ( event.key.keysym.sym == SDLK_LEFT ) { // Reverse if ( event.key.keysym.mod & KMOD_SHIFT ) { } else if ( event.key.keysym.mod & KMOD_CTRL ) { } else { } } else if ( event.key.keysym.sym == SDLK_KP_MINUS ) { // Scale minus if ( scalesize > 1 ) { scalesize--; } } else if ( event.key.keysym.sym == SDLK_KP_PLUS ) { // Scale plus scalesize++; } else if ( event.key.keysym.sym == SDLK_f ) { // Toggle filtering on/off if ( bilinear_filtering ) { SMPEG_Filter *filter = SMPEGfilter_null(); filter = SMPEG_filter( mpeg, filter ); filter-destroy(filter); bilinear_filtering = 0; } else { SMPEG_Filter *filter = SMPEGfilter_bilinear(); filter = SMPEG_filter( mpeg, filter ); filter-destroy(filter); bilinear_filtering = 1; } } break; case SDL_QUIT: done = 1; break; default: break; } } SDL_Delay(1000/2); } SMPEG_delete(mpeg); } SDL_Quit(); if defined(HTTP_SUPPORT) if(fd) close(fd); endif return(status); }

    Read the article

  • Retrieve names of running processes

    - by Dave DeLong
    Hi everyone, First off, I know that similar questions have been asked, but the answers provided haven't been very helpful so far (they all recommend one of the following options). I have a user application that needs to determine if a particular process is running. Here's what I know about the process: The name The user (root) It should already be running, since it's a LaunchDaemon, which means Its parent process should be launchd (pid 1) I've tried several ways to get this, but none have worked so far. Here's what I've tried: Running ps and parsing the output. This works, but it's slow (fork/exec is expensive), and I'd like this to be as fast as possible. Using the GetBSDProcessList function listed here. This also works, but the way in which they say to retrieve the process name (accessing kp_proc.p_comm from each kinfo_proc structure) is flawed. The resulting char* only contains the first 16 characters of the process name, which can be seen in the definition of the kp_proc structure: #define MAXCOMLEN 16 //defined in param.h struct extern_proc { //defined in proc.h ...snip... char p_comm[MAXCOMLEN+1]; ...snip... }; Using libProc.h to retrieve process information: pid_t pids[1024]; int numberOfProcesses = proc_listpids(PROC_ALL_PIDS, 0, NULL, 0); proc_listpids(PROC_ALL_PIDS, 0, pids, sizeof(pids)); for (int i = 0; i < numberOfProcesses; ++i) { if (pids[i] == 0) { continue; } char name[1024]; proc_name(pids[i], name, sizeof(name)); printf("Found process: %s\n", name); } This works, except it has the same flaw as GetBSDProcessList. Only the first portion of the process name is returned. Using the ProcessManager function in Carbon: ProcessSerialNumber psn; psn.lowLongOfPSN = kNoProcess; psn.highLongOfPSN = 0; while (GetNextProcess(&psn) == noErr) { CFStringRef procName = NULL; if (CopyProcessName(&psn, &procName) == noErr) { NSLog(@"Found process: %@", (NSString *)procName); } CFRelease(procName); } This does not work. It only returns process that are registered with the WindowServer (or something like that). In other words, it only returns apps with UIs, and only for the current user. I can't use -[NSWorkspace launchedApplications], since this must be 10.5-compatible. In addition, this only returns information about applications that appear in the Dock for the current user. I know that it's possible to retrieve the name of running processes (since ps can do it), but the question is "Can I do it without forking and exec'ing ps?". Any suggestions?

    Read the article

  • Cannot execute "LOAD DATA LOCAL INFILE" Mysql query in Rails after a connection reconnection

    - by Ngan
    On Rails 2.3.8 (but I think Rails 3 might have this issue as well, not sure): I get an error when trying to execute a LOAD DATA LOCAL INFILE query after reconnecting to a database. I have a process that parses a file that can potentially take a bit of time. During the parsing, Mysql closes the connection due to timeout. This is fine, I do a ActiveRecord::Base.verify_active_connections! and I get the connection back (I do this in several places through my app). However, running a LOAD DATA LOCAL INFILE statement, I get this error: Mysql::Error: The used command is not allowed with this MySQL version It's not a permission issue, I know that for sure. Check out my test in console: ActiveRecord::Base.connection.execute("LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users") [Sat Jan 08 00:09:29 2011] (9990) SQL (1.7ms) LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users => nil > ActiveRecord::Base.connection.disconnect! => #<Mysql:0x104c6f890> > ActiveRecord::Base.verify_active_connections! [Sat Jan 08 00:09:58 2011] (9990) SQL (0.2ms) SET SQL_AUTO_IS_NULL=0 => {...connection stuff...} > ActiveRecord::Base.connection.execute("LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users") [Sat Jan 08 00:10:00 2011] (9990) SQL (0.0ms) Mysql::Error: The used command is not allowed with this MySQL version: LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users ActiveRecord::StatementInvalid: Mysql::Error: The used command is not allowed with this MySQL version: LOAD DATA LOCAL INFILE '/tmp/test.infile' INTO TABLE users from ~/gems/activerecord-2.3.8/lib/active_record/connection_adapters/abstract_adapter.rb:221:in `log' from ~/gems/activerecord-2.3.8/lib/active_record/connection_adapters/mysql_adapter.rb:323:in `execute' from (irb):6 I am able to do other queries like SELECT and whatnot, and I will get the correct result. It's just this one that giving me the error. I even tested this with a fresh rails app. You'll notice that I am able to do the exact same query before the disconnect. Thanks for the help!

    Read the article

  • Constructor versus setter injection

    - by Chris
    Hi, I'm currently designing an API where I wish to allow configuration via a variety of methods. One method is via an XML configuration schema and another method is through an API that I wish to play nicely with Spring. My XML schema parsing code was previously hidden and therefore the only concern was for it to work but now I wish to build a public API and I'm quite concerned about best-practice. It seems that many favor javabean type PoJo's with default zero parameter constructors and then setter injection. The problem I am trying to tackle is that some setter methods implementations are dependent on other setter methods being called before them in sequence. I could write anal setters that will tolerate themselves being called in many orders but that will not solve the problem of a user forgetting to set the appropriate setter and therefore the bean being in an incomplete state. The only solution I can think of is to forget about the objects being 'beans' and enforce the required parameters via constructor injection. An example of this is in the default setting of the id of a component based on the id of the parent components. My Interface public interface IMyIdentityInterface { public String getId(); /* A null value should create a unique meaningful default */ public void setId(String id); public IMyIdentityInterface getParent(); public void setParent(IMyIdentityInterface parent); } Base Implementation of interface: public abstract class MyIdentityBaseClass implements IMyIdentityInterface { private String _id; private IMyIdentityInterface _parent; public MyIdentityBaseClass () {} @Override public String getId() { return _id; } /** * If the id is null, then use the id of the parent component * appended with a lower-cased simple name of the current impl * class along with a counter suffix to enforce uniqueness */ @Override public void setId(String id) { if (id == null) { IMyIdentityInterface parent = getParent(); if (parent == null) { // this may be the top level component or it may be that // the user called setId() before setParent(..) } else { _id = Helpers.makeIdFromParent(parent,getClass()); } } else { _id = id; } } @Override public IMyIdentityInterface getParent() { return _parent; } @Override public void setParent(IMyIdentityInterface parent) { _parent = parent; } } Every component in the framework will have a parent except for the top level component. Using the setter type of injection, then the setters will have different behavior based on the order of the calling of the setters. In this case, would you agree, that a constructor taking a reference to the parent is better and dropping the parent setter method from the interface entirely? Is it considered bad practice if I wish to be able to configure these components using an IoC container? Chris

    Read the article

  • Is it possible to read infinity or NaN values using input streams?

    - by Drise
    I have some input to be read by a input filestream (for example): -365.269511 -0.356123 -Inf 0.000000 When I use std::ifstream mystream; to read from the file to some double d1 = -1, d2 = -1, d3 = -1, d4 = -1; (assume mystream has already been opened and the file is valid), mystream >> d1 >> d2 >> d3 >> d4; mystream is in the fail state. I would expect std::cout << d1 << " " << d2 << " " << d3 << " " << d4 << std::endl; to output -365.269511 -0.356123 -1 -1. I would want it to output -365.269511 -0.356123 -Inf 0 instead. This set of data was output using C++ streams. Why can't I do the reverse process (read in my output)? How can I get the functionality I seek? From MooingDuck: #include <iostream> #include <limits> using namespace std; int main() { double myd = std::numeric_limits<double>::infinity(); cout << myd << '\n'; cin >> myd; cout << cin.good() << ":" << myd << endl; return 0; } Input: inf Output: inf 0:inf See also: http://ideone.com/jVvei Also related to this problem is NaN parsing, even though I do not give examples for it.

    Read the article

  • J2ME/Java: Referencing StringBuffer through Threads

    - by Jemuel Dalino
    This question might be long, but I want to provide much information. Overview: I'm creating a Stock Quotes Ticker app for Blackberry. But I'm having problems with my StringBuffer that contains an individual Stock information. Process: My app connects to our server via SocketConnection. The server sends out a formatted set of strings that contains the latest Stock trade. So whenever a new trade happens, the server will send out an individual Stock Quote of that trade. Through an InputStream I am able to read that information and place each character in a StringBuffer that is referenced by Threads. By parsing based on char3 I am able to determine a set of stock quote/information. char1 - to separate data char3 - means end of a stock quote/information sample stock quote format sent out by our server: stock_quote_name(char 1)some_data(char1)some_data(char1)(char3) My app then parses that stock quote to compare certain data and formats it how it will look like when displayed in the screen. When trades happen gradually(slow) the app works perfectly. However.. Problem: When trades happen too quickly and almost at the same time, My app is not able to handle the information sent efficiently. The StringBuffer has its contents combined with the next trade. Meaning Two stock information in one StringBuffer. field should be: Stock_quote_name some_data some_data sample of what's happening: Stock_quote_name some_data some_dataStock_quote_name some_data some_data here's my code for this part: while (-1 != (data = is.read())) { sb.append((char)data); while(3 != (data = is.read())) { sb.append((char)data); } UiApplication.getUiApplication().invokeLater(new Runnable() { public void run() { try { synchronized(UiApplication.getEventLock()) { SetStringBuffer(sb); DisplayStringBuffer(); RefreshStringBuffer(); } } catch (Exception e) { System.out.println("Error in setting stringbuffer: " + e.toString()); } } }); } public synchronized void DisplayStringBuffer() { try { //parse sb - string buffer ...... } catch(Exception ex) { System.out.println("error in DisplayStringBuffer(): " + ex.toString()); } } public synchronized void SetStringBuffer(StringBuffer dataBuffer) { this.sb =dataBuffer; System.out.println(sb); } public synchronized void RefreshStringBuffer() { this.sb.delete(0, this.sb.length()); } From what I can see, when trades happen very fast, The StringBuffer is not refreshed immediately and still has the contents of the previous trade, when i try to put new data. My Question is: Do you guys have any suggestion on how i can put data into the StringBuffer, without the next information being appended to the first content

    Read the article

  • Realtime Twitter Replies?

    - by ejunker
    I have created Twitter bots for many geographic locations. I want to allow users to @-reply to the Twitter bot with commands and then have the bot respond with the results. I would like to have the bot reply to the user as quickly as possible (realtime). Apparently, Twitter used to have an XMPP/Jabber interface that would provide this type of realtime feed of replies but it was shut down. As I see it my options are to use one of the following: REST API This would involve polling every X minutes for each bot. The problem with this is that it is not realtime and each Twitter account would have to be polled. Search API The search API does allow specifying a "-to" parameter in the search and replies to all bots could be aggregated in a search such as "-to bot1 OR -to bot2...". Though if you have hundreds of bots then the search string would get very long and probably exceed the maximum length of a GET request. Streaming API The streaming API looks very promising as it provides realtime results. The API allows you to specify a follow and track parameters. follow is not useful as the bot does not know who will be sending it commands. track allows you to specify keywords to track. This could possibly work by creating a daemon process that connects to the Streaming API and tracks all references to the bot's names. Once again since there are lots of bots to track the length and complexity of the query may be an issue. Another idea would be to track a special hashtag such as #botcommand and then a user could send a command using this syntax @bot1 weather #botcommand. Then by using the Streaming API to track all references to #botcommand would give you a realtime stream of all the commands. Further parsing could then be done to determine which bot to send the command to. Third-party service Are there any third-party companies that have access to the Twitter firehouse and offer realtime data? I haven't investigated these, but here are a few that I have found: Gnip Tweet.IM excla.im TwitterSpy - seems to use polling, not realtime I'm leaning towards using the Streaming API. Is there a better way to get near realtime @-replies for many (hundreds) of Twitter accounts?

    Read the article

  • JavaCC: How can one exclude a string from a token? (A.k.a. understanding token ambiguity.)

    - by java.is.for.desktop
    Hello, everyone! I had already many problems with understanding, how ambiguous tokens can be handled elegantly (or somehow at all) in JavaCC. Let's take this example: I want to parse XML processing instruction. The format is: "<?" <target> <data> "?>": target is an XML name, data can be anything except ?>, because it's the closing tag. So, lets define this in JavaCC: (I use lexical states, in this case DEFAULT and PROC_INST) TOKEN : <#NAME : (very-long-definition-from-xml-1.1-goes-here) > TOKEN : <WSS : (" " | "\t")+ > // WSS = whitespaces <DEFAULT> TOKEN : {<PI_START : "<?" > : PROC_INST} <PROC_INST> TOKEN : {<PI_TARGET : <NAME> >} <PROC_INST> TOKEN : {<PI_DATA : ~[] >} // accept everything <PROC_INST> TOKEN : {<PI_END : "?>" > : DEFAULT} Now the part which recognizes processing instructions: void PROC_INSTR() : {} { ( <PI_START> (t=<PI_TARGET>){System.out.println("target: " + t.image);} <WSS> (t=<PI_DATA>){System.out.println("data: " + t.image);} <PI_END> ) {} } Let's test it with <?mytarget here-goes-some-data?>: The target is recognized: "target: mytarget". But now I get my favorite JavaCC parsing error: !! procinstparser.ParseException: Encountered "" at line 1, column 15. !! Was expecting one of: !! Encountered nothing? Was expecting nothing? Or what? Thank you, JavaCC! I know, that I could use the MORE keyword of JavaCC, but this would give me the whole processing instruction as one token, so I'd had to parse/tokenize it further by myself. Why should I do that? Am I writing a parser that does not parse? The problem is (i guess): hence <PI_DATA> recognizes "everything", my definition is wrong. I should tell JavaCC to recognize "everything except ?>" as processing instruction data. But how can it be done? NOTE: I can only exclude single characters using ~["a"|"b"|"c"], I can't exclude strings such as ~["abc"] or ~["?>"]. Another great anti-feature of JavaCC. Thank you.

    Read the article

  • PDF Report generation

    - by IniTech
    EDIT : I completed this project using ABCpdf. For anyone interested, I love this product and their support is A+. Everything I listed as a 'Con' for the HTML - PDF solution was easily doable in ABCpdf. I've been charged with creating a data driven pdf report. After reviewing the plethora of options, I have narrowed it down to 2. I need you all to to help me decide, or offer alternatives I haven't considered. Here are the requirements: 100% Data driven Eventually PDF (a stop in HTML is fine, so long as it is converted) Can be run with multiple sets of data (the layout is always the same, the data is variable) Contains normal analysis-style copy (saved in DB with html markup) Contains tables (data for tables is generated at run-time) Header/Page # on each page Table of Contents .NET (VB or C#) Done quickly Now, because of the fact that the report is going to be generated with multiple sets of data, I don't think a stamped pdf template will work since I won't know how long or how many pages a certain piece of the report could require. So, I think my best options are: Programmatic creation using an iText-like solution. Generate in HTML and convert to PDF using a third-party application (ABCPdf is the tool I have played with so far) Both solutions have their pro's and con's. Programmatic solution: Pros: Flexible Easy page numbering/page header/table of contents Free Cons: Time consuming (to write a layer on top of iText to do what I need and keep maintainable) Since the copy is already stored in the db with html markup, I would have to parse through the data before I place it into the pdf, ensuring I don't have to break the paragraph into chunks so I can apply bold, italic, underline, etc. to specific phrases. This seems like a huge PITA, and I hope I am wrong about that assumption. HTML - PDF Pros: Easy to generate from db (no parsing necessary) Many tools for conversion Uses technology I am already familiar with Built-in "Print Preview" - not a req, but nice Cons: (Edited after project completion. All of my assumptions were incorrect and ABCpdf is awesome) 1. Almost impossible to generate page headers - Not True 2. Very difficult to generate page numbers Not True 3. Nearly impossible to generate table of contents Not True 4. (Cross-browser support isn't a con; Since its internal, I can dictate what browser to use) 5. Conversion tool quirks - may not convert exactly as rendered in browser Not True 6. Overall, I think it would be very hard to format the HTML exactly as I would want it to appear/convert to PDF. Not True That's it - I need the communitys help in deciding which way I should go. I might be wrong about some of my Pro/Con assumptions. If I am, please tell me. All thoughts and suggestions are welcome and appreciated. Thanks

    Read the article

  • Sort/Group XML data with PHP?

    - by Volmar
    I'm trying to make a page using data from the discogs.com (XML)-API. i've been parsing it with simpleXML and it's working pretty well but there is some things i'm not sure how to do. Here is part of the XML: <releases> <release id="1468764" status="Accepted" type="Main"> <title>Versions</title> <format>12", EP</format> <label>Not On Label</label> <year>1999</year> </release> <release id="72246" status="Accepted" type="Main"> <title>The M.O.F Blend</title> <format>LP</format> <label>Blenda Records</label> <year>2002</year> </release> <release id="890064" status="Accepted" type="Main"> <title>The M.O.F Blend</title> <format>CD</format> <label>Blenda Records</label> <year>2002</year> </release> <release id="1563561" status="Accepted" type="TrackAppearance"> <title>Ännu En Gång Vol. 3</title> <trackinfo>Backtrack</trackinfo> <format>Cass, Comp, Mix</format> <label>Hemmalaget</label> <year>2001</year> </release> </releases> What i want to achieve is something similair to how discogs presents the releases: http://www.discogs.com/artist/Mics+Of+Fury where diferent versions of the same release are sorted together. (see. The M.O.F Blend in my link) This is done on discogs with having a master release that features the other releases. unfortunately this information isn't present in the API data, so i want to do the same thing by grouping the <release>-nodes with the same <title>-tags, or add a flag to the <releases> that don't have a unique <title>? any good ideas on the best way of doing this? i also like to know if it's possible to count the <release>-nodes (child of releases) that have the same type-attribute? like in this example count the releases with the type "Main"? maybe it's better to do this things with XMLReader or XPath?

    Read the article

  • Deserialization error in a new environment

    - by cerhart
    I have a web application that calls a third-party web service. When I run it locally, I have no problems, but when I move it to my production environment, I get the following error: There is an error in XML document (2, 428). Stack: at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle, XmlDeserializationEvents events) at System.Xml.Serialization.XmlSerializer.Deserialize(XmlReader xmlReader, String encodingStyle) at System.Web.Services.Protocols.SoapHttpClientProtocol.ReadResponse(SoapClientMessage message, WebResponse response, Stream responseStream, Boolean asyncCall) at System.Web.Services.Protocols.SoapHttpClientProtocol.Invoke(String methodName, Object[] parameters) at RMXClasses.RMXContactService.ContactService.getActiveSessions(String user, String pass) in C:\Users\hp\Documents\Visual Studio 2008\Projects\ReklamStore\RMXClasses\Web References\RMXContactService\Reference.cs:line 257 at I have used the same web config file from the production environment but it still works locally. My local machine is a running vista home edition and the production environment is windows server 2003. The application is written in asp.net 3.5, wierdly under the asp.net config tab in iis, 3.5 doesn't show up in the drop down list, although that version of the framework is installed. The error is not being thrown in my code, it happens during serialization. I called the method on the proxy, I have checked the arguments and they are OK. I have also logged the SOAP request and response, and they both look OK as well. I am really at a loss here. Any ideas? SOAP log: This is the soap response that the program seems to have trouble parsing only on server 2003. On my machine the soap is identical, and yet it parses with no problems. SoapResponse BeforeDeserialize; <?xml version="1.0" encoding="UTF-8"?> <SOAP-ENV:Envelope xmlns:SOAP-ENV="http://schemas.xmlsoap.org/soap/envelope/" xmlns:ns1="urn:ContactService" xmlns:ns2="http://api.yieldmanager.com/types" xmlns:SOAP-ENC="http://schemas.xmlsoap.org/soap/encoding/" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" SOAP-ENV:encodingStyle="http://schemas.xmlsoap.org/soap/encoding/"><SOAP-ENV:Body><ns1:getActiveSessionsResponse> <sessions SOAP-ENC:arrayType="ns2:session[1]" xsi:type="ns2:array_of_session"> <item xsi:type="ns2:session"> <token xsi:type="xsd:string">xxxxxxxxxxxxxxxxxxxx1ae12517584b</token> <creation_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</creation_time> <modification_time xsi:type="xsd:dateTime">2009-09-25T05:51:19Z</modification_time> <ip_address xsi:type="xsd:string">xxxxxxxxxx</ip_address> <contact_id xsi:type="xsd:long">xxxxxx</contact_id></item></sessions> </ns1:getActiveSessionsResponse></SOAP-ENV:Body></SOAP-ENV:Envelope>

    Read the article

  • Convert NSData into Hex NSString

    - by Dawson
    With reference to the following question: Convert NSData into HEX NSSString I have solved the problem using the solution provided by Erik Aigner which is: NSData *data = ...; NSUInteger capacity = [data length] * 2; NSMutableString *stringBuffer = [NSMutableString stringWithCapacity:capacity]; const unsigned char *dataBuffer = [data bytes]; NSInteger i; for (i=0; i<[data length]; ++i) { [stringBuffer appendFormat:@"%02X", (NSUInteger)dataBuffer[i]]; } However, there is one small problem in that if there are extra zeros at the back, the string value would be different. For eg. if the hexa data is of a string @"3700000000000000", when converted using a scanner to integer: unsigned result = 0; NSScanner *scanner = [NSScanner scannerWithString:stringBuffer]; [scanner scanHexInt:&result]; NSLog(@"INTEGER: %u",result); The result would be 4294967295, which is incorrect. Shouldn't it be 55 as only the hexa 37 is taken? So how do I get rid of the zeros? EDIT: (In response to CRD) Hi, thanks for clarifying my doubts. So what you're doing is to actually read the 64-bit integer directly from a byte pointer right? However I have another question. How do you actually cast NSData to a byte pointer? To make it easier for you to understand, I'll explain what I did originally. Firstly, what I did was to display the data of the file which I have (data is in hexadecimal) NSData *file = [NSData dataWithContentsOfFile:@"file path here"]; NSLog(@"Patch File: %@",file); Output: Next, what I did was to read and offset the first 8 bytes of the file and convert them into a string. // 0-8 bytes [file seekToFileOffset:0]; NSData *b = [file readDataOfLength:8]; NSUInteger capacity = [b length] * 2; NSMutableString *stringBuffer = [NSMutableString stringWithCapacity:capacity]; const unsigned char *dataBuffer = [b bytes]; NSInteger i; for (i=0; i<[b length]; ++i) { [stringBuffer appendFormat:@"%02X", (NSUInteger)dataBuffer[i]]; } NSLog(@"0-8 bytes HEXADECIMAL: %@",stringBuffer); As you can see, 0x3700000000000000 is the next 8 bytes. The only changes I would have to make to access the next 8 bytes would be to change the value of SeekFileToOffset to 8, so as to access the next 8 bytes of data. All in all, the solution you gave me is useful, however it would not be practical to enter the hexadecimal values manually. If formatting the bytes as a string and then parsing them is not the way to do it, then how do I access the first 8 bytes of the data directly and cast them into a byte pointer?

    Read the article

  • Cannot see the variable In my own JQuery plugin's function.

    - by qinHaiXiang
    I am writing one of my own JQuery plugin. And I got some strange which make me confused. I am using JQuery UI datepicker with my plugin. ;(function($){ var newMW = 1, mwZIndex = 0; // IgtoMW contructor Igtomw = function(elem , options){ var activePanel, lastPanel, daysWithRecords, sliding; // used to check the animation below is executed to the end. // used to access the plugin's default configuration this.opts = $.extend({}, $.fn.igtomw.defaults, options); // intial the model window this.intialMW(); }; $.extend(Igtomw.prototype, { // intial model window intialMW : function(){ this.sliding = false; //this.daysWithRecords = []; this.igtoMW = $('<div />',{'id':'igto'+newMW,'class':'igtoMW',}) .css({'z-index':mwZIndex}) // make it in front of all exist model window; .appendTo('body') .draggable({ containment: 'parent' , handle: '.dragHandle' , distance: 5 }); //var igtoWrapper = igtoMW.append($('<div />',{'class':'igtoWrapper'})); this.igtoWrapper = $('<div />',{'class':'igtoWrapper'}).appendTo(this.igtoMW); this.igtoOpacityBody = $('<div />',{'class':'igtoOpacityBody'}).appendTo(this.igtoMW); //var igtoHeaderInfo = igtoWrapper.append($('<div />',{'class':'igtoHeaderInfo dragHandle'})); this.igtoHeaderInfo = $('<div />',{'class':'igtoHeaderInfo dragHandle'}) .appendTo(this.igtoWrapper); this.igtoQuickNavigation = $('<div />',{'class':'igtoQuickNavigation'}) .css({'color':'#fff'}) .appendTo(this.igtoWrapper); this.igtoContentSlider = $('<div />',{'class':'igtoContentSlider'}) .appendTo(this.igtoWrapper); this.igtoQuickMenu = $('<div />',{'class':'igtoQuickMenu'}) .appendTo(this.igtoWrapper); this.igtoFooter = $('<div />',{'class':'igtoFooter dragHandle'}) .appendTo(this.igtoWrapper); // append to igtoHeaderInfo this.headTitle = this.igtoHeaderInfo.append($('<div />',{'class':'headTitle'})); // append to igtoQuickNavigation this.igQuickNav = $('<div />', {'class':'igQuickNav'}) .html('??') .appendTo(this.igtoQuickNavigation); // append to igtoContentSlider this.igInnerPanelTopMenu = $('<div />',{'class':'igInnerPanelTopMenu'}) .appendTo(this.igtoContentSlider); this.igInnerPanelTopMenu.append('<div class="igInnerPanelButtonPreWrapper"><a href="" class="igInnerPanelButton Pre" action="" style="background-image:url(images/igto/igInnerPanelTopMenu.bt.bg.png);"></a></div>'); this.igInnerPanelTopMenu.append('<div class="igInnerPanelSearch"><input type="text" name="igInnerSearch" /><a href="" class="igInnerSearch">??</a></div>' ); this.igInnerPanelTopMenu.append('<div class="igInnerPanelButtonNextWrapper"><a href="" class="igInnerPanelButton Next" action="sm" style="background-image:url(images/igto/igInnerPanelTopMenu.bt.bg.png); background-position:-272px"></a></div>' ); this.igInnerPanelBottomMenu = $('<div />',{'class':'igInnerPanelBottomMenu'}) .appendTo(this.igtoContentSlider); this.icWrapper = $('<div />',{'class':'icWrapper','id':'igto'+newMW+'Panel'}) .appendTo(this.igtoContentSlider); this.icWrapperCotentPre = $('<div class="slider pre"></div>').appendTo(this.icWrapper); this.icWrapperCotentShow = $('<div class="slider firstShow "></div>').appendTo(this.icWrapper); this.icWrapperCotentnext = $('<div class="slider next"></div>').appendTo(this.icWrapper); this.initialPanel(); this.initialQuickMenus(); console.log(this.leftPad(9)); newMW++; mwZIndex++; this.igtoMW.bind('mousedown',function(){ var $this = $(this); //alert($this.css('z-index') + ' '+mwZIndex); if( parseInt($this.css('z-index')) === (mwZIndex-1) ) return; $this.css({'z-index':mwZIndex}); mwZIndex++; //alert(mwZIndex); }); }, initialPanel : function(){ this.defaultPanelNum = this.opts.initialPanel; this.activePanel = this.defaultPanelNum; this.lastPanel = this.defaultPanelNum; this.defaultPanel = this.loadPanelContents(this.defaultPanelNum); $(this.defaultPanel).appendTo(this.icWrapperCotentShow); }, initialQuickMenus : function(){ // store the current element var obj = this; var defaultQM = this.opts.initialQuickMenu; var strMenu = ''; var marginFirstEle = '8'; $.each(defaultQM,function(key,value){ //alert(key+':'+value); if(marginFirstEle === '8'){ strMenu += '<a href="" class="btPanel" panel="'+key+'" style="margin-left: 8px;" >'+value+'</a>'; marginFirstEle = '4'; } else{ strMenu += '<a href="" class="btPanel" panel="'+key+'" style="margin-left: 4px;" >'+value+'</a>'; } }); // append to igtoQuickMenu this.igtoQMenu = $(strMenu).appendTo(this.igtoQuickMenu); this.igtoQMenu.bind('click',function(event){ event.preventDefault(); var element = $(this); if(element.is('.active')){ return; } else{ $(obj.igtoQMenu).removeClass('active'); element.addClass('active'); } var d = new Date(); var year = d.getFullYear(); var month = obj.leftPad( d.getMonth() ); var inst = null; if( obj.sliding === false){ console.log(obj.lastPanel); var currentPanelNum = parseInt(element.attr('panel')); obj.checkAvailability(); obj.getDays(year,month,inst,currentPanelNum); obj.slidePanel(currentPanelNum); obj.activePanel = currentPanelNum; console.log(obj.activePanel); obj.lastPanel = obj.activePanel; obj.icWrapper.find('input').val(obj.activePanel); } }); }, initialLoginPanel : function(){ var obj = this; this.igPanelLogin = $('<div />',{'class':"igPanelLogin"}); this.igEnterName = $('<div />',{'class':"igEnterName"}).appendTo(this.igPanelLogin); this.igInput = $('<input type="text" name="name" value="???" />').appendTo(this.igEnterName); this.igtoLoginBtWrap = $('<div />',{'class':"igButtons"}).appendTo(this.igPanelLogin); this.igtoLoginBt = $('<a href="" class="igtoLoginBt" action="OK" >??</a>\ <a href="" class="igtoLoginBt" action="CANCEL" >??</a>\ <a href="" class="igtoLoginBt" action="ADD" >????</a>').appendTo(this.igtoLoginBtWrap); this.igtoLoginBt.bind('click',function(event){ event.preventDefault(); var elem = $(this); var action = elem.attr('action'); var userName = obj.igInput.val(); obj.loadRootMenu(); }); return this.igPanelLogin; }, initialWatchHistory : function(){ var obj = this; // for thirt part plugin used if(this.sliding === false){ this.watchHistory = $('<div />',{'class':'igInnerPanelSlider'}).append($('<div />',{'class':'igInnerPanel_pre'}).addClass('igInnerPanel')) .append($('<div />',{'class':'igInnerPanel'}).datepicker({ dateFormat: 'yy-mm-dd',defaultDate: '2010-12-01' ,showWeek: true,firstDay: 1, //beforeShow:setDateStatistics(), onChangeMonthYear:function(year, month, inst) { var panelNum = 1; month = obj.leftPad(month); obj.getDays(year,month,inst,panelNum); } , beforeShowDay: obj.checkAvailability, onSelect: function(dateText, inst) { obj.checkAvailability(); } }).append($('<div />',{'class':'extraMenu'})) ) .append($('<div />',{'class':'igInnerPanel_next'}).addClass('igInnerPanel')); return this.watchHistory; } }, loadPanelContents : function(panelNum){ switch(panelNum){ case 1: alert('inside loadPanelContents') return this.initialWatchHistory(); break; case 2: return this.initialWatchHistory(); break; case 3: return this.initialWatchHistory(); break; case 4: return this.initialWatchHistory(); break; case 5: return this.initialLoginPanel(); break; } }, loadRootMenu : function(){ var obj = this; var mainMenuPanel = $('<div />',{'class':'igRootMenu'}); var currentMWId = this.igtoMW.attr('id'); this.activePanel = 0; $('#'+currentMWId+'Panel .pre'). queue(function(next){ $(this). html(mainMenuPanel). addClass('panelShow'). removeClass('pre'). attr('panelNum',0); next(); }). queue(function(next){ $('<div style="width:0;" class="slider pre"></div>'). prependTo('#'+currentMWId+'Panel').animate({width:348}, function(){ $('#'+currentMWId+'Panel .slider:last').remove() $('#'+currentMWId+'Panel .slider:last').replaceWith('<div class="slider next"></div>'); $('.btMenu').remove(); // remove bottom quick menu obj.sliding = false; $(this).removeAttr('style'); }); $('.igtoQuickMenu .active').removeClass('active'); next(); }); }, slidePanel : function(currentPanelNum){ var currentMWId = this.igtoMW.attr('id'); var obj = this; //alert(obj.loadPanelContents(currentPanelNum)); if( this.activePanel > currentPanelNum){ $('#'+currentMWId+'Panel .pre'). queue(function(next){ alert('inside slidePanel') //var initialDate = getPanelDateStatus(panelNum); //console.log('intial day in bigger panel '+initialDate) $(this). html(obj.loadPanelContents(currentPanelNum)). addClass('panelShow'). removeClass('pre'). attr('panelNum',currentPanelNum); $('#'+currentMWId+'Panel .next').remove(); next(); }). queue(function(next){ $('<div style="width:0;" class="slider pre"></div>'). prependTo('#'+currentMWId+'Panel').animate({width:348}, function(){ //$('#igto1Panel .slider:last').find(setPanel(currentPanelNum)).datepicker('destroy'); $('#'+currentMWId+'Panel .slider:last').empty().removeClass('panelShow').addClass('next').removeAttr('panelNum'); $('#'+currentMWId+'Panel .slider:last').replaceWith('<div class="slider next"></div>') obj.sliding = false;console.log('inuse inside animation: '+obj.sliding); $(this).removeAttr('style'); }); next(); }); } else{ ///// current panel num smaller than next $('#'+currentMWId+'Panel .next'). queue(function(next){ $(this). html(obj.loadPanelContents(currentPanelNum)). addClass('panelShow'). removeClass('next'). attr('panelNum',currentPanelNum); $('<div class="slider next">empty</div>').appendTo('#'+currentMWId+'Panel'); next(); }). queue(function(next){ $('#'+currentMWId+'Panel .pre').animate({width:0}, function(){ $(this).remove(); //$('#igto1Panel .slider:first').find(setPanel(currentPanelNum)).datepicker('destroy'); $('#'+currentMWId+'Panel .slider:first').empty().removeClass('panelShow').addClass('pre').removeAttr('panelNum').removeAttr('style'); $('#'+currentMWId+'Panel .slider:first').replaceWith('<div class="slider pre"></div>') obj.sliding = false; console.log('inuse inside animation: '+obj.sliding); }); next(); }); } }, getDays : function(year,month,inst,panelNum){ var obj = this; // depand on the mysql qurey condition var table_of_record = 'moviewh';//getTable(panelNum); var date_of_record = 'watching_date';//getTableDateCol(panelNum); var date_to_find = year+'-'+month; var node_of_xml_date_list = 'whDateRecords';//getXMLDateNode(panelNum); var user_id = '1';//getLoginUserId(); //var daysWithRecords = []; // empty array before asigning this.daysWithRecords.length = 0; $.ajax({ type: "GET", url: "include/get.date.list.process.php", data:({ table_of_record : table_of_record,date_of_record:date_of_record,date_to_find:date_to_find,user_id:user_id,node_of_xml_date_list:node_of_xml_date_list }), dataType: "json", cache: false, // force broser don't cache the xml file async: false, // using this option to prevent datepicker refresh ??NO success:function(data){ // had no date records if(data === null) return; obj.daysWithRecords = data; } }); //setPanelDateStatus(year,month,panelNum); console.log('call from getdays() ' + this.daysWithRecords); }, checkAvailability : function(availableDays) { // var i; var checkdate = $.datepicker.formatDate('yy-mm-dd', availableDays); //console.log( checkdate); // for(var i = 0; i < this.daysWithRecords.length; i++) { // // if(this.daysWithRecords[i] == checkdate){ // // return [true, "available"]; // } // } //console.log('inside check availablility '+ this.daysWithRecords); //return [true, "available"]; console.log(typeof this.daysWithRecords) for(i in this.daysWithRecords){ //if(this.daysWithRecords[i] == checkdate){ console.log(typeof this.daysWithRecords[i]); //return [true, "available"]; //} } return [true, "available"]; //return [false, ""]; }, leftPad : function(num) { return (num < 10) ? '0' + num : num; } }); $.fn.igtomw = function(options){ // Merge options passed in with global defaults var opt = $.extend({}, $.fn.igtomw.defaults , options); return this.each(function() { new Igtomw(this,opt); }); }; $.fn.igtomw.defaults = { // 0:mainMenu 1:whatchHistor 2:requestHistory 3:userManager // 4:shoppingCart 5:loginPanel initialPanel : 5, // default panel is LoginPanel initialQuickMenu : {'1':'whatchHIstory','2':'????','3':'????','4':'????'} // defalut quick menu }; })(jQuery); usage: $('.openMW').click(function(event){ event.preventDefault(); $('<div class="">').igtomw(); }) HTML code: <div id="taskBarAndStartMenu"> <div class="taskBarAndStartMenuM"> <a href="" class="openMW" >??IGTO</a> </div> <div class="taskBarAndStartMenuO"></div> </div> In my work flow: when I click the "whatchHistory" button, my plugin would load a panel with JQuery UI datepicker applied which days had been set to be availabled or not. I am using the function "getDays()" to get the available days list and stored the data inside daysWithRecords, and final the UI datepicker's function "beforeShowDay()" called the function "checkAvailability()" to set the days. the variable "daysWithRecords" was declared inside Igtomw = function(elem , options) and was initialized inside the function getDays() I am using the function "initialWatchHistory()" to initialization and render the JQuery UI datepicker in the web. My problem is the function "checkAvailability()" cannot see the variable "daysWithRecords".The firebug prompts me that "daysWithRecords" is "undefined". this is the first time I write my first plugin. So .... Thank you very much for any help!!

    Read the article

  • Parallel programming in C#

    - by Alxandr
    I'm interested in learning about parallel programming in C#.NET (not like everything there is to know, but the basics and maybe some good-practices), therefore I've decided to reprogram an old program of mine which is called ImageSyncer. ImageSyncer is a really simple program, all it does is to scan trough a folder and find all files ending with .jpg, then it calculates the new position of the files based on the date they were taken (parsing of xif-data, or whatever it's called). After a location has been generated the program checks for any existing files at that location, and if one exist it looks at the last write-time of both the file to copy, and the file "in its way". If those are equal the file is skipped. If not a md5 checksum of both files is created and matched. If there is no match the file to be copied is given a new location to be copied to (for instance, if it was to be copied to "C:\test.jpg" it's copied to "C:\test(1).jpg" instead). The result of this operation is populated into a queue of a struct-type that contains two strings, the original file and the position to copy it to. Then that queue is iterated over untill it is empty and the files are copied. In other words there are 4 operations: 1. Scan directory for jpegs 2. Parse files for xif and generate copy-location 3. Check for file existence and if needed generate new path 4. Copy files And so I want to rewrite this program to make it paralell and be able to perform several of the operations at the same time, and I was wondering what the best way to achieve that would be. I've came up with two different models I can think of, but neither one of them might be any good at all. The first one is to parallelize the 4 steps of the old program, so that when step one is to be executed it's done on several threads, and when the entire of step 1 is finished step 2 is began. The other one (which I find more interesting because I have no idea of how to do that) is to create a sort of worker and consumer model, so when a thread is finished with step 1 another one takes over and performs step 2 at that object (or something like that). But as said, I don't know if any of these are any good solutions. Also, I don't know much about parallel programming at all. I know how to make a thread, and how to make it perform a function taking in an object as its only parameter, and I've also used the BackgroundWorker-class on one occasion, but I'm not that familiar with any of them. Any input would be appreciated.

    Read the article

  • highlight query string in more than one field using solr search feature

    - by Romi
    i am using solr indexes for showing my search results. to show serch results i am parsing json data received from solr. i am able to highlight a query string in search result but only in a single field. for this i set hl=true and hl.fl="field1". i did it as $.getJSON("http://192.168.1.9:8983/solr/db/select/?wt=json&&start=0&rows=100&q="+lowerCaseQuery+"&hl=true&hl.fl=description,name&hl.usePhraseHighlighter=true&sort=price asc&json.wrf=?", function(result){ var n=result.response.numFound var highlight = new Array(n); $.each(result.highlighting, function(i, hitem){ var match = hitem.text[0].match(/<em>(.*?)<\/em>/); highlight[i]=match[1]; }); $.each(newresult.response.docs, function(i,item){ var word=highlight[item["UID_PK"]]; var result = item.text[0].replace(new RegExp(word,'g'), '<em>' + word + '</em>'); }); for this json object is as : { "responseHeader": { "status": 0, "QTime": 32 }, "response": { "numFound": 21, "start": 0, "docs": [ { "description": "The matte finish waves on this wedding band contrast with the high polish borders. This sharp and elegant design was finely crafted in Japan.", "UID_PK": "8252", }, { "description": "This elegant ring has an Akoya cultured pearl with a band of bezel-set round diamonds making it perfect for her to wear to work or the night out.", "UID_PK": "8142", }, ] }, "highlighting": { "8252": { "description": [ " and <em>elegant</em> design was finely crafted in Japan." ] }, "8142": { "description": [ "This <em>elegant</em> ring has an Akoya cultured pearl with a band of bezel-set round diamonds making" ] }, } } Now if i want to highlight query string in two fields i did as hl=true hl.fl=descrption, name my json is as: { "responseHeader":{ "status":0, "QTime":16 }, "response":{ "numFound":1904, "start":0, "docs":[ { "description":"", "UID_PK":"7780", "name":[ "Diamond bracelet with Milgrain Bezel1" ] }, { "description":"This pendant is sure to win hearts. Round diamonds form a simple and graceful line.", "UID_PK":"8121", "name":[ "Heartline Diamond Pendant" ] }, "highlighting":{ "7780":{ "name":[ "<em>Diamond</em> bracelet with Milgrain Bezel1" ] }, "8121":{ "description":[ "This pendant is sure to win hearts. Round <em>diamonds</em> form a simple and graceful line." ], "name":[ "Heartline <em>Diamond</em> Pendant" ] } } } Now how should i parse it to get the result. suggest me some general technique, so if i want to highlight query in more fields then i could do so. Thanks

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • Calling a function that resides in the main page from a plugin?

    - by Justin Lee
    I want to call a function from within plugin, but the function is on the main page and not the plugin's .js file. EDIT I have jQuery parsing a very large XML file and building, subsequently, a large list (1.1 MB HTML file when dynamic content is copied, pasted, then saved) that has expand/collapse functionality through a plugin. The overall performance on IE is super slow and doggy, assuming since the page/DOM is so big. I am currently trying to save the collapsed content in the event.data when it is collapsed and remove it from the DOM, then bring it back when it is told to expand... the issue that I am having is that when I bring the content back, obviously the "click" and "hover" events are gone. I'm trying to re-assign them, currently doing so inside the plugin after the plugin expands the content. The issue then though is that is says the function that I declare within the .click() is not defined. Also the hover event doesn't seem to be re-assigning either.... if ($(event.data.trigger).attr('class').indexOf('collapsed') != -1 ) { // if expanding // console.log(event.data.targetContent); $(event.data.trigger).after(event.data.targetContent); $(event.data.target).hide(); /* This Line --->*/ $(event.data.target + 'a.addButton').click(addResourceToList); $(event.data.target + 'li.resource') .hover( function() { if (!($(this).attr("disabled"))) { $(this).addClass("over"); $(this).find("a").css({'display':'block'}); } }, function () { if (!($(this).attr("disabled"))) { $(this).removeClass("over"); $(this).children("a").css({'display':'none'}); } } ); $(event.data.target).css({ "height": "0px", "padding-top": "0px", "padding-bottom": "0px", "margin-top": "0px", "margin-bottom": "0px"}); $(event.data.target).show(); $(event.data.target).animate({ height: event.data.heightVal + "px", paddingTop: event.data.topPaddingVal + "px", paddingBottom: event.data.bottomPaddingVal + "px", marginTop: event.data.topMarginVal + "px", marginBottom: event.data.bottomMarginVal + "px"}, "normal");//, function(){$(this).hide();}); $(event.data.trigger).removeClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'expanded', {hoursToLive: 24 * 365}); } else if ($(event.data.trigger).attr('class').indexOf('collapsed') == -1 ) { // if collapsing $(event.data.target).animate({ height: "0px", paddingTop: "0px", paddingBottom: "0px", marginTop: "0px", marginBottom: "0px"}, "normal", function(){$(this).hide();$(this).remove();}); $(event.data.trigger).addClass("collapsed"); $.cookies.set('jcollapserSub_' + event.data.target, 'collapsed', {hoursToLive: 24 * 365}); } EDIT So, having new eyes truly makes a difference. As I was reviewing the code in this post this morning after being away over the weekend, I found where I had err'd. This: $(event.data.target + 'a.addButton').click(addResourceToList); Should be this (notice the space before a.addbutton): $(event.data.target + ' a.addButton').click(addResourceToList); Same issue with the "li.resource". So it was never pointing to the right elements... Thank you, Rene, for your help!!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • zlib gzgets extremely slow?

    - by monkeyking
    I'm doing stuff related to parsing huge globs of textfiles, and was testing what input method to use. There is not much of a difference using c++ std::ifstreams vs c FILE, According to the documentation of zlib, it supports uncompressed files, and will read the file without decompression. I'm seeing a difference from 12 seconds using non zlib to more than 4 minutes using zlib.h This I've tested doing multiple runs, so its not a disk cache issue. Am I using zlib in some wrong way? thanks #include <zlib.h> #include <cstdio> #include <cstdlib> #include <fstream> #define LENS 1000000 size_t fg(const char *fname){ fprintf(stderr,"\t-> using fgets\n"); FILE *fp =fopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(NULL!=fgets(buffer,LENS,fp)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t is(const char *fname){ fprintf(stderr,"\t-> using ifstream\n"); std::ifstream is(fname,std::ios::in); size_t nLines =0; char *buffer = new char[LENS]; while(is. getline(buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } size_t iz(const char *fname){ fprintf(stderr,"\t-> using zlib\n"); gzFile fp =gzopen(fname,"r"); size_t nLines =0; char *buffer = new char[LENS]; while(0!=gzgets(fp,buffer,LENS)) nLines++; fprintf(stderr,"%lu\n",nLines); return nLines; } int main(int argc,char**argv){ if(atoi(argv[2])==0) fg(argv[1]); if(atoi(argv[2])==1) is(argv[1]); if(atoi(argv[2])==2) iz(argv[1]); }

    Read the article

  • What regular expression(s) would I use to remove escaped html from large sets of data.

    - by Elizabeth Buckwalter
    Our database is filled with articles retrieved from RSS feeds. I was unsure of what data I would be getting, and how much filtering was already setup (WP-O-Matic Wordpress plugin using the SimplePie library). This plugin does some basic encoding before insertion using Wordpress's built in post insert function which also does some filtering. I've figured out most of the filters before insertion, but now I have whacko data that I need to remove. This is an example of whacko data that I have data in one field which the content I want in the front, but this part removed which is at the end: <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:V_sGLiPBpWU" border="0"></img> <img src="http://feeds.feedburner.com/~ff/SoundOnTheSound?d=qj6IDK7rITs" border="0"></img> &lt;img src=&quot;http://feeds.feedburner.com/~ff/SoundOnTheSound?i=xFxEpT2Add0:xFbIkwGc-fk:D7DqB2pKExk&quot; Notice how some of the images are escape and some aren't. I believe this has to do with the last part being cut off so as to be unrecognizable as an html tag, which then caused it to be html endcoded. Another field has only this which is now filtered before insertion, but I have to get rid of the others: &lt;img src=&quot;http://farm3.static.flickr.com/2183/2289902369_1d95bcdb85.jpg&quot; alt=&quot;post_img&quot; width=&quot;80&quot; (all examples are on one line, but broken up for readability) Question: What is the best way to work with the above escaped html (or portion of an html tag)? I can do it in Perl, PHP, SQL, Ruby, and even Python. I believe Perl to be the best at text parsing, so that's why I used the Perl tag. And PHP times out on large database operations, so that's pretty much out unless I wanted to do batch processing and what not. PS One of the nice things about using Wordpress's insert post function, is that if you use php's strip_tags function to strip out all html, insert post function will insert <p> at the paragraph points. Let me know if there's anything more that I can answer. Some article that didn't quite answer my questions. (http://stackoverflow.com/questions/2016751/remove-text-from-within-a-database-text-field) (http://stackoverflow.com/questions/462831/regular-expression-to-escape-html-ampersands-while-respecting-cdata)

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • How to populate GridView if Internet not available but images already cached to SD Card

    - by Sophie
    Hello I am writing an Application in which i am parsing JSON Images and then caching into SD Card. What I want to do ? I want to load images into GridView from JSON (by caching images into SD Card), and wanna populate GridView (no matter Internet available or not) once images already downloaded into SD Card. What I am getting ? I am able to cache images into SD Card, also to populate GridView, but not able to show images into GridView (if Internet not available) but images cached into SD Card @Override public View onCreateView(LayoutInflater inflater, ViewGroup container, Bundle savedInstanceState) { myGridView = inflater.inflate(R.layout.fragment_church_grid, container, false); if (isNetworkAvailable()) { new DownloadJSON().execute(); } else { Toast.makeText(getActivity(), "Internet not available !", Toast.LENGTH_LONG).show(); } return myGridView ; } private boolean isNetworkAvailable() { ConnectivityManager cm = (ConnectivityManager) getActivity().getSystemService(Context.CONNECTIVITY_SERVICE); NetworkInfo info = cm.getActiveNetworkInfo(); return (info != null); } // DownloadJSON AsyncTask private class DownloadJSON extends AsyncTask<Void, Void, Void> { @Override protected void onPreExecute() { super.onPreExecute(); // Create a progressdialog mProgressDialog = new ProgressDialog(getActivity()); // Set progressdialog title mProgressDialog.setTitle("Church Application"); // Set progressdialog message mProgressDialog.setMessage("Loading Images..."); mProgressDialog.setIndeterminate(false); // Show progressdialog mProgressDialog.show(); } @Override protected Void doInBackground(Void... params) { // Create an array arraylist = new ArrayList<HashMap<String, String>>(); // Retrieve JSON Objects from the given URL address jsonobject = JSONfunctions .getJSONfromURL("http://snapoodle.com/APIS/android/feed.php"); try { // Locate the array name in JSON jsonarray = jsonobject.getJSONArray("print"); for (int i = 0; i < jsonarray.length(); i++) { HashMap<String, String> map = new HashMap<String, String>(); jsonobject = jsonarray.getJSONObject(i); // Retrive JSON Objects map.put("saved_location", jsonobject.getString("saved_location")); // Set the JSON Objects into the array arraylist.add(map); } } catch (JSONException e) { Log.e("Error", e.getMessage()); e.printStackTrace(); } return null; } @Override protected void onPostExecute(Void args) { // Locate the listview in listview_main.xml listview = (GridView) shriRamView.findViewById(R.id.listview); // Pass the results into ListViewAdapter.java adapter = new ChurchImagesAdapter(getActivity(), arraylist); // Set the adapter to the ListView listview.setAdapter(adapter); // Close the progressdialog mProgressDialog.dismiss(); } } }

    Read the article

  • Having problems creating an array from XML data in Acrobat Javascript, please help if you can

    - by Kevin Minke
    I have a manually created array that already works example below: var PartsData = { 179: { ref:"", partNum: "201-2007-C00-00", descript: "System Monitor Card (Tracewell Only)", cage: "39764", qty: "1", SMR: "XBOZZ", UOC: "A" }}; Now this array above is is just one value in the array and it works fine. Here is the XML that I am trying to use to dynamically change the values. <?xml version="1.0" encoding="utf-8"?> <partsTables> <partsList> <part sheetNum="ta1"> <breakDownIndexNo>-1 </breakDownIndexNo> <referenceDesg/> <indent>20534220P01 </indent> <description/> <cage>TAC RI, GRADE-A SHOCK (TEC RACK), ALT P/N 72304-1</cage> <qtyPerAssy>23991 </qtyPerAssy> <smr>1 </smr> <uoc>ADODD </uoc> <blank/> </part> </partsList> </partsTables> I have this parsing just fine in Acrobat. Now I want to make the array work for me in using these values. if I have the following below it will work. Where part.item(i).indent.value equals the value of the indent node, etc. newArr = { 179: { ref: part.item(i).referenceDesg.value, partNum: part.item(i).indent.value, descript: part.item(i).cage.value, cage: part.item(i).qtyPerAssy.value, qty: part.item(i).smr.value, SMR: part.item(i).uoc.value, UOC: part.item(i).blank.value}}; As soon as I try to make the 179 value, which is in the breakDownIndexNo node, dynamic by using the direct part.item(i).breakDownIndexNo.value it will not compile. Acrobat is using javascript so I'm not sure why I can not get this to parse. I have tried to create a variable out of the breakDownIndexNo node and typed it to both a String and an Integer. this will let it create the array but it will not let me output from the array. newArr[indexNum].partNum gives me "no properties" where newArr[179].partNum if I were to manually set the index number to 179 will print out the value of part.item(i).indent.value. If any of you have an idea or an answer please let me know.

    Read the article

< Previous Page | 602 603 604 605 606 607 608 609 610 611 612 613  | Next Page >