Search Results

Search found 23845 results on 954 pages for 'instance methods'.

Page 61/954 | < Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68  | Next Page >

• VB.NET - Object reference not set to an instance of an object

  - by Daniel

  I need some help with my program. I get this error when I run my VB.NET program with a custom DayView control. ***** Exception Text ******* System.NullReferenceException: Object reference not set to an instance of an object. at SeaCow.Main.DayView1_ResolveAppointments(Object sender, ResolveAppointmentsEventArgs args) in C:\Users\Daniel\My Programs\Visual Basic\SeaCow\SeaCow\SeaCow\Main.vb:line 120 at Calendar.DayView.OnResolveAppointments(ResolveAppointmentsEventArgs args) at Calendar.DayView.OnPaint(PaintEventArgs e) at System.Windows.Forms.Control.PaintWithErrorHandling(PaintEventArgs e, Int16 layer) at System.Windows.Forms.Control.WmPaint(Message& m) at System.Windows.Forms.Control.WndProc(Message& m) at System.Windows.Forms.NativeWindow.Callback(IntPtr hWnd, Int32 msg, IntPtr wparam, IntPtr lparam) According to the error code, the 'for each' loop below is causing the NullReferenceException error. At default, the 'appointments' list is assigned to nothing and I can't find where the ResolveAppointments function is being called at. Private Sub DayView1_ResolveAppointments(ByVal sender As Object, ByVal args As Calendar.ResolveAppointmentsEventArgs) Handles DayView1.ResolveAppointments Dim m_Apps As New List(Of Calendar.Appointment) For Each m_App As Calendar.Appointment In appointments If (m_App.StartDate >= args.StartDate) AndAlso (m_App.StartDate <= args.EndDate) Then m_Apps.Add(m_App) End If Next args.Appointments = m_Apps End Sub Anyone have any suggestions?

  Read the article

• [CFArray release]: message sent to deallocated instance

  - by arielcamus

  Hi, I'm using the following method in my code: - (NSMutableArray *) newOrderedArray:(NSMutableArray *)array ByKey:(NSString *)key ascending:(BOOL)ascending { NSSortDescriptor *idDescriptor = [[NSSortDescriptor alloc] initWithKey:key ascending:ascending]; NSArray *sortDescriptors = [NSArray arrayWithObject:idDescriptor]; NSArray *orderArray = [array sortedArrayUsingDescriptors:sortDescriptors]; [idDescriptor release]; NSMutableArray *result = [NSMutableArray arrayWithArray:orderArray]; return result; } Is this a well-coded convenience method? As I think, it returns an autoreleased NSMutableArray. This method is called by another one: - (id) otherMethod { NSMutableArray *otherResult = [[[NSMutableArray alloc] initWithCapacity:[otherArray count]] autorelease]; // I add some stuff to otherResult and then... NSMutableArray *result = [dbUtils newOrderedArray:otherResult ByKey:@"objectId" ascending:NO]; return result; } This method (otherMethod) is called in some view controller where I want to store returned array and release it when deallocating the view controller. However, when [result retain] is called in this view controller (because I need it to be available and I can't allow it to be deallocated) I receive the following error: [CFArray release]: message sent to deallocated instance I've tried to log [result retainCount] just before calling retain and it print "1". I don't understand why an error is thrown when calling retain. Thank you, A

  Read the article

• Unrecognised selector sent to instance uitableview

  - by ct2k7

  I'm getting error: Unrecognised selector sent to instance, upon inspection, I see there is an issue in this section of code, and more specifically: [self.tableView insertSubview:ovController.view aboveSubview:self.parentViewController.view]; - (void) searchBarTextDidBeginEditing:(UISearchBar *)theSearchBar { if(searching) return; //Add the overlay view. ovController = [[OverlayViewController alloc] initWithNibName:@"OverlayView" bundle:[NSBundle mainBundle]]; CGFloat yaxis = self.navigationController.navigationBar.frame.size.height; CGFloat width = self.view.frame.size.width; CGFloat height = self.view.frame.size.height; //Parameters x = origion on x-axis, y = origon on y-axis. CGRect frame = CGRectMake(0, yaxis, width, height); ovController.view.frame = frame; ovController.view.backgroundColor = [UIColor grayColor]; ovController.view.alpha = 0.5; ovController.rvController = self; [self.tableView insertSubview:ovController.view aboveSubview:self.parentViewController.view]; searching = YES; letUserSelectRow = NO; //self.tableView.scrollEnabled = NO; } Looks like there's an issue with tableview?

  Read the article

• Inheritance of closure objects and overriding of methods

  - by bobikk

  I need to extend a class, which is encapsulated in a closure. This base class is following: var PageController = (function(){ // private static variable var _current_view; return function(request, new_view) { ... // priveleged public function, which has access to the _current_view this.execute = function() { alert("PageController::execute"); } } })(); Inheritance is realised using the following function: function extend(subClass, superClass){ var F = function(){ }; F.prototype = superClass.prototype; subClass.prototype = new F(); subClass.prototype.constructor = subClass; subClass.superclass = superClass.prototype; StartController.cache = ''; if (superClass.prototype.constructor == Object.prototype.constructor) { superClass.prototype.constructor = superClass; } } I subclass the PageController: var StartController = function(request){ // calling the constructor of the super class StartController.superclass.constructor.call(this, request, 'start-view'); } // extending the objects extend(StartController, PageController); // overriding the PageController::execute StartController.prototype.execute = function() { alert('StartController::execute'); } Inheritance is working. I can call every PageController's method from StartController's instance. However, method overriding doesn't work: var startCont = new StartController(); startCont.execute(); alerts "PageController::execute". How should I override this method?

  Read the article

• Write to static field - is FindBugs wrong in this case?

  - by htorque

  I have a Java class like this: public class Foo { public static int counter = 0; public void bar(int counter) { Foo.counter = counter; } } FindBugs warns me about writing to the static field counter via the instance method bar. However, if I change the code to: public class Foo { public static int counter = 0; public static void setCounter(int counter) { Foo.counter = counter; } public void bar(int counter) { setCounter(counter); } } Then FindBugs won't complain. Isn't that wrong? I'm still writing to a static field from an instance method, just via a static method - no?

  Read the article

• Are MEF's ComposableParts contracts instance-based?

  - by Dave

  I didn't really know how to phrase the title of my questions, so my apologies in advance. I read through parts of the MEF documentation to try to find the answer to my question, but couldn't find it. I'm using ImportMany to allow MEF to create multiple instances of a specific plugin. That plugin Imports several parts, and within calls to a specific instance, it wants these Imports to be singletons. However, what I don't want is for all instances of this plugin to use the same singleton. For example, let's say my application ImportManys Blender appliances. Every time I ask for one, I want a different Blender. However, each Blender Imports a ControlPanel. I want each Blender to have its own ControlPanel. To make things a little more interesting, each Blender can load BlendPrograms, which are also contained within their own assemblies, and MEF takes care of this loading. A BlendProgram might need to access the ControlPanel to get the speed, but I want to ensure that it is accessing the correct ControlPanel (i.e. the one that is associated with the Blender that is associated with the program!) This diagram might clear things up a little bit: As the note shows, I believe that the confusion could come from an inherently-poor design. The BlendProgram shouldn't touch the ControlPanel directly, and instead perhaps the BlendProgram should get the speed via the Blender, which will then delegate the request to its ControlPanel. If this is the case, then I assume the BlendProgram needs to have a reference to a specific Blender. In order to do this, is the right way to leverage MEF and use an ImportingConstructor for BlendProgram, i.e. [ImportingConstructor] public class BlendProgram : IBlendProgram { public BlendProgram( Blender blender) {} } And if this is the case, how do I know that MEF will use the intended Blender plugin?

  Read the article

• Regular expressions - finding and comparing the first instance of a word

  - by Dan

  Hi there, I am currently trying to write a regular expression to pull links out of a page I have. The problem is the links need to be pulled out only if the links have 'stock' for example. This is an outline of what I have code wise: <td class="prd-details"> <a href="somepage"> ... <span class="collect unavailable"> </td> <td class="prd-details"> <a href="somepage"> ... <span class="collect available"> </td> What I would like to do is pull out the links only if 'collect available' is in the tag. I have tried to do this with the regular expression: (?s)prd-details[^=]+="([^"]+)" .+?collect{1}[^\s]+ available However on running it, it will find the first 'prd-details' class and keep going until it finds 'collect available', thereby taking the incorrect results. I thought by specifying the {1} after the word collect it would only use the first instance of the word it finds, but apparently I'm wrong. I've been trying to use different things such as positive and negative lookaheads but I cant seem to get anything to work. Might anyone be able to help me with this issue? Thanks, Dan

  Read the article

• Inereritance of clousure objects and overriding of methods

  - by bobikk

  I need to extend a class, which is encapsulated in a closure. This base class is following: var PageController = (function(){ // private static variable var _current_view; return function(request, new_view) { ... // priveleged public function, which has access to the _current_view this.execute = function() { alert("PageController::execute"); } } })();` Inheritance is realised using the following function: function extend(subClass, superClass){ var F = function(){ }; F.prototype = superClass.prototype; subClass.prototype = new F(); subClass.prototype.constructor = subClass; subClass.superclass = superClass.prototype; StartController.cache = ''; if (superClass.prototype.constructor == Object.prototype.constructor) { superClass.prototype.constructor = superClass; } } I subclass the PageController: var StartController = function(request){ // calling the constructor of the super class StartController.superclass.constructor.call(this, request, 'start-view'); } // extending the objects extend(StartController, PageController); // overriding the PageController::execute StartController.prototype.execute = function() { alert('StartController::execute'); } Inheritance is working. I can call every PageController's method from StartController's instance. However, method overriding doesn't work: var startCont = new StartController(); startCont.execute(); alerts "PageController::execute". How should I override this method?

  Read the article

• jQuery Cycle : Multiple Instances, detect end of each instance

  - by guylabbe.ca

  I am using multiple instances of Cycle for a portfolio; Only one is shown and the others are hidden. Each Cycle is a project with multiple images. The only thing I can't figure out is how to detect the end of the « current » Cycle instance. with after: function, it is triggered for all instances at once, impossible to get « local » events. Here is my code : $('.sldr_closeup').each(function() { var currId = $(this).attr('id'); window['num_'+currId] = 0; $(this).cycle({ timeout:0, speed:500, fx:'fade', next:'.nextimages', prev:'.previmages', fit:1, nowrap:1, autstop:0, after : function(c,n,o,f) { var currId = $(this).parent('div').attr('id'); (f) ? window['num_'+currId] ++ : window['num_'+currId] --; if ((o.slideCount == window['num_'+currId] )) { alert(currId); $('.nextimages').stop().fadeTo(400,0,function(){ if(currId != $('.projectList .projet').last().find('a').attr('rel')) $('.nextproject').stop().fadeTo(400,1); $(this).hide(); }); } } }).cycle('pause'); });

  Read the article

• method __getattr__ is not inherited from parent class

  - by ??????

  Trying to subclass mechanize.Browser class: from mechanize import Browser class LLManager(Browser, object): IS_AUTHORIZED = False def __init__(self, login = "", passw = "", *args, **kwargs): super(LLManager, self).__init__(*args, **kwargs) self.set_handle_robots(False) But when I make something like this: lm["Widget[LinksList]_link_1_title"] = anc then I get an error: Traceback (most recent call last): File "<pyshell#8>", line 1, in <module> lm["Widget[LinksList]_link_1_title"] = anc TypeError: 'LLManager' object does not support item assignment Browser class have overridden method __getattr__ as shown: def __getattr__(self, name): # pass through _form.HTMLForm methods and attributes form = self.__dict__.get("form") if form is None: raise AttributeError( "%s instance has no attribute %s (perhaps you forgot to " ".select_form()?)" % (self.__class__, name)) return getattr(form, name) Why my class or instance don't get this method as in parent class?

  Read the article

• Create an instance of an exported C++ class from Delphi

  - by Alan G.

  I followed an excellent article by Rudy Velthuis about using C++ classes in DLL's. Everything was golden, except that I need access to some classes that do not have corresponding factories in the C++ DLL. How can I construct an instance of a class in the DLL? The classes in question are defined as class __declspec(dllexport) exampleClass { public: void foo(); }; Now without a factory, I have no clear way of instantiating the class, but I know it can be done, as I have seen SWIG scripts (.i files) that make these classes available to Python. If Python&SWIG can do it, then I presume/hope there is some way to make it happen in Delphi too. Now I don't know much about SWIG, but it seems like it generates some sort of map for C++ mangled names? Is that anywhere near right? Looking at the exports from the DLL, I suppose I could access functions & constructor/destructor by index or the mangled name directly, but that would be nasty; and would it even work? Even if I can call the constructor, how can I do the equivalent of "new CClass();" in Delphi?

  Read the article

• PHP/MySQL - Working with two databases, one shared and one local to an instance of application

  - by Extrakun

  The situation: Using a off-the-shelf PHP application, I have to add in a new module for extra functionality. Today, it is made known that eventually four different instances of the application are to be deployed, but the data from the new functionality is to be shared among those 4 instances. Each instance should still have their own database for users, content and etc. So the data for the new functionality goes into a 'shared' database. The data for the application (user login, content, uploads) go into a 'local' database To make things more complex, the new module I am writing will fetch data from the local DB and the shared DB at the same time. A re-write of the base application will take too long. I only have control over the new module which I am writing. The ideal solution: Is there a way to encapsulate 2 databases into one name using MySQL? I do not wish to switch DB connections or specifically name the DB to query from inside my SQL statements. The application uses a DB wrapper, so I am able to change it somehow so I can invisibly attempt to read/write to two different DB. What is the best way to handle this problem?

  Read the article

• Object reference not set to an instance of an object

  - by MBTHQ

  Can anyone help with the following code? I'm trying to get data from the database colum to the datagridview... I'm getting error over here "Dim sql_1 As String = "SELECT * FROM item where item_id = '" + DataGridView_stockout.CurrentCell.Value.ToString() + "'"" Private Sub DataGridView_stockout_CellMouseClick(ByVal sender As Object, ByVal e As System.Windows.Forms.DataGridViewCellMouseEventArgs) Handles DataGridView_stockout.CellMouseClick Dim i As Integer = Stock_checkDataSet1.Tables(0).Rows.Count > 0 Dim thiscur_stok As New System.Data.SqlClient.SqlConnection("Data Source=MBTHQ\SQLEXPRESS;Initial Catalog=stock_check;Integrated Security=True") ' Sql Query Dim sql_1 As String = "SELECT * FROM item where item_id = '" + DataGridView_stockout.CurrentCell.Value.ToString() + "'" ' Create Data Adapter Dim da_1 As New SqlDataAdapter(sql_1, thiscur_stok) ' Fill Dataset and Get Data Table da_1.Fill(Stock_checkDataSet1, "item") Dim dt_1 As DataTable = Stock_checkDataSet1.Tables("item") If i >= DataGridView_stockout.Rows.Count Then 'MessageBox.Show("Sorry, DataGridView_stockout doesn't any row at index " & i.ToString()) Exit Sub End If If 1 >= Stock_checkDataSet1.Tables.Count Then 'MessageBox.Show("Sorry, Stock_checkDataSet1 doesn't any table at index 1") Exit Sub End If If i >= Stock_checkDataSet1.Tables(1).Rows.Count Then 'MessageBox.Show("Sorry, Stock_checkDataSet1.Tables(1) doesn't any row at index " & i.ToString()) Exit Sub End If If Not Stock_checkDataSet1.Tables(1).Columns.Contains("os") Then 'MessageBox.Show("Sorry, Stock_checkDataSet1.Tables(1) doesn't any column named 'os'") Exit Sub End If 'DataGridView_stockout.Item("cs_stockout", i).Value = Stock_checkDataSet1.Tables(0).Rows(i).Item("os") Dim ab As String = Stock_checkDataSet1.Tables(0).Rows(i)(0).ToString() End Sub I keep on getting the error saying "Object reference not set to an instance of an object" I dont know where I'm going wrong. Help really appreciated!!

  Read the article

• What to name 2 methods with same signatures

  - by coffeeaddict

  Initially I had a method in our DL that would take in the object it's updating like so: internal void UpdateCash(Cash Cash) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set captureID = @captureID, ac_code = @acCode, captureDate = @captureDate, errmsg = @errorMessage, isDebit = @isDebit, SourceInfoID = @sourceInfoID, PayPalTransactionInfoID = @payPalTransactionInfoID, CreditCardTransactionInfoID = @CreditCardTransactionInfoID where id = @cashID"; conn.AddParam("@captureID", cash.CaptureID); conn.AddParam("@acCode", cash.ActionCode); conn.AddParam("@captureDate", cash.CaptureDate); conn.AddParam("@errorMessage", cash.ErrorMessage); conn.AddParam("@isDebit", cyberCash.IsDebit); conn.AddParam("@PayPalTransactionInfoID", cash.PayPalTransactionInfoID); conn.AddParam("@CreditCardTransactionInfoID", cash.CreditCardTransactionInfoID); conn.AddParam("@sourceInfoID", cash.SourceInfoID); conn.AddParam("@cashID", cash.Id); conn.ExecuteNonQuery(); } } My boss felt that creating an object every time just to update one or two fields is overkill. But I had a couple places in code using this. He recommended using just UpdateCash and sending in the ID for CAsh and field I want to update. Well the problem is I have 2 places in code using my original method. And those 2 places are updating 2 completely different fields in the Cash table. Before I was just able to get the existing Cash record and shove it into a Cash object, then update the properties I wanted to be updated in the DB, then send back the cash object to my method above. I need some advice on what to do here. I have 2 methods and they have the same signature. I'm not quite sure what to rename these because both are updating 2 completely different fields in the Cash table: internal void UpdateCash(int cashID, int paypalCaptureID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set CaptureID = @paypalCaptureID where id = @cashID"; conn.AddParam("@captureID", paypalCaptureID); conn.ExecuteNonQuery(); } } internal void UpdateCash(int cashID, int PayPalTransactionInfoID) { using (OurCustomDbConnection conn = CreateConnection("UpdateCash")) { conn.CommandText = @"update Cash set PaymentSourceID = @PayPalTransactionInfoID where id = @cashID"; conn.AddParam("@PayPalTransactionInfoID", PayPalTransactionInfoID); conn.ExecuteNonQuery(); } } So I thought hmm, maybe change the names to these so that they are now unique and somewhat explain what field its updating: UpdateCashOrderID UpdateCashTransactionInfoID ok but that's not really very good names. And I can't go too generic, for example: UpdateCashTransaction(int cashID, paypalTransactionID) What if we have different types of transactionIDs that the cash record holds besides just the paypalTransactionInfoID? such as the creditCardInfoID? Then what? Transaction doesn't tell me what kind. And furthermore what if you're updating 2 fields so you have 2 params next to the cashID param: UpdateCashTransaction(int cashID, paypalTransactionID, someOtherFieldIWantToUpdate) see my frustration? what's the best way to handle this is my boss doesn't like my first route?

  Read the article

• -[UITableViewRowData isEqualToString:]: unrecognized selector sent to instance 0x391dce0

  - by tak

  I have a datatable which shows the list of contacts. when I start the application all the data is loaded correctly.But after selecting a contact, I am sometimes getting this exception :- Program received signal: “EXC_BAD_ACCESS”. and sometimes -[UITableViewRowData isEqualToString:]: unrecognized selector sent to instance 0x391dce0 most probably for this code:- - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } ExpenseTrackerAppDelegate *appDelegate = (ExpenseTrackerAppDelegate *)[[UIApplication sharedApplication] delegate]; Person *person = (Person *)[appDelegate.expensivePersonsList objectAtIndex:indexPath.row]; NSString *name = (NSString *)[NSMutableString stringWithFormat:@"%@ %@" ,person.lastName , person.firstName]; cell.textLabel.text = name; //cell.detailTextLabel.text = person.lastName; // Configure the cell. return cell; } If I replace these lines of code NSString *name = (NSString *)[NSMutableString stringWithFormat:@"%@ %@" ,person.lastName , person.firstName]; cell.textLabel.text = name; with this code cell.textLabel.text = person.lastName; then everything works fine? I dont know what exactly happens?

  Read the article

• Testing InlineFormset clean methods

  - by Rory

  I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

  Read the article

• Cocos2d: is it good practice to use a shared GameScene when having various levels?

  - by mm24

  In my code (based on the ShootEmUp example in this book, which I highly reccomend, source code in chapter 8 available here) I often use the trick of accessing the GameScene via: +(GameScene*) sharedGameScene; which returns a reference to the static instance of GameScene. Is a static instance of GameScene as in the book still a valid pattern in case I want a MainMenu calling GameScene initialized with different level data each time (e.g. different enemies)? (I have created a sceneWithId:(int) method where I load different level data each time. Or should I pheraps create a GameScene class and then sublcass it? E.g. FirstGameScene : GameScene

  Read the article

• Right way to return proxy model instance from a base model instance in Django ?

  - by sotangochips

  Say I have models: class Animal(models.Model): type = models.CharField(max_length=255) class Dog(Animal): def make_sound(self): print "Woof!" class Meta: proxy = True class Cat(Animal): def make_sound(self): print "Meow!" class Meta: proxy = True Let's say I want to do: animals = Animal.objects.all() for animal in animals: animal.make_sound() I want to get back a series of Woofs and Meows. Clearly, I could just define a make_sound in the original model that forks based on animal_type, but then every time I add a new animal type (imagine they're in different apps), I'd have to go in and edit that make_sound function. I'd rather just define proxy models and have them define the behavior themselves. From what I can tell, there's no way of returning mixed Cat or Dog instances, but I figured maybe I could define a "get_proxy_model" method on the main class that returns a cat or a dog model. Surely you could do this, and pass something like the primary key and then just do Cat.objects.get(pk = passed_in_primary_key). But that'd mean doing an extra query for data you already have which seems redundant. Is there any way to turn an animal into a cat or a dog instance in an efficient way? What's the right way to do what I want to achieve?

  Read the article

• Ruby: how does constant-lookup work in instance_eval/class_eval?

  - by Alan O'Donnell

  I'm working my way through Pickaxe 1.9, and I'm a bit confused by constant-lookup in instance/class_eval blocks. I'm using 1.9.2. It seems that Ruby handles constant-lookup in *_eval blocks the same way it does method-lookup: look for a definition in receiver.singleton_class (plus mixins); then in receiver.singleton_class.superclass (plus mixins); then continue up the eigenchain until you get to #<Class:BasicObject>; whose superclass is Class; and then up the rest of the ancestor chain (including Object, which stores all the constants you define at the top-level), checking for mixins along the way Is this correct? The Pickaxe discussion is a bit terse. Some examples: class Foo CONST = 'Foo::CONST' class << self CONST = 'EigenFoo::CONST' end end Foo.instance_eval { CONST } # => 'EigenFoo::CONST' Foo.class_eval { CONST } # => 'EigenFoo::CONST', not 'Foo::CONST'! Foo.new.instance_eval { CONST } # => 'Foo::CONST' In the class_eval example, Foo-the-class isn't a stop along Foo-the-object's ancestor chain! And an example with mixins: module M CONST = "M::CONST" end module N CONST = "N::CONST" end class A include M extend N end A.instance_eval { CONST } # => "N::CONST", because N is mixed into A's eigenclass A.class_eval { CONST } # => "N::CONST", ditto A.new.instance_eval { CONST } # => "M::CONST", because A.new.class, A, mixes in M

  Read the article

• Mocking methods that call other methods Still hit database.Can I avoid it?

  - by devnet247

  Hi, It has been decided to write some unit tests using moq etc..It's lots of legacy code c# (this is beyond my control so cannot answer the whys of this) Now how do you cope with a scenario when you dont want to hit the database but you indirectly still hit the database? This is something I put together it's not the real code but gives you an idea. How would you deal with this sort of scenario? Basically calling a method on a mocked interface still makes a dal call as inside that method there are other methods not part of that interface?Hope it's clear [TestFixture] public class Can_Test_this_legacy_code { [Test] public void Should_be_able_to_mock_login() { var mock = new Mock<ILoginDal>(); User user; var userName = "Jo"; var password = "password"; mock.Setup(x => x.login(It.IsAny<string>(), It.IsAny<string>(),out user)); var bizLogin = new BizLogin(mock.Object); bizLogin.Login(userName, password, out user); } } public class BizLogin { private readonly ILoginDal _login; public BizLogin(ILoginDal login) { _login = login; } public void Login(string userName, string password, out User user) { //Even if I dont want to this will call the DAL!!!!! var bizPermission = new BizPermission(); var permissionList = bizPermission.GetPermissions(userName); //Method I am actually testing _login.login(userName,password,out user); } } public class BizPermission { public List<Permission>GetPermissions(string userName) { var dal=new PermissionDal(); var permissionlist= dal.GetPermissions(userName); return permissionlist; } } public class PermissionDal { public List<Permission> GetPermissions(string userName) { //I SHOULD NOT BE GETTING HERE!!!!!! return new List<Permission>(); } } public interface ILoginDal { void login(string userName, string password,out User user); } public interface IOtherStuffDal { List<Permission> GetPermissions(); } public class Permission { public int Id { get; set; } public string Name { get; set; } } Any suggestions? Am I missing the obvious? Is this Untestable code? Very very grateful for any suggestions.

  Read the article

• How to unit test private methods in BDD / TDD?

  - by robert_d

  I am trying to program according to Behavior Driven Development, which states that no line of code should be written without writing failing unit test first. My question is, how to use BDD with private methods? How can I unit test private methods? Is there better solution than: - making private methods public first and then making them private when I write public method that uses those private methods; or - in C# making all private methods internal and using InternalsVisibleTo attribute. Robert

  Read the article

• "no inclosing instance error " while getting top term frequencies for document from Lucene index

  - by Julia

  Hello ! I am trying to get the most occurring term frequencies for every particular document in Lucene index. I am trying to set the treshold of top occuring terms that I care about, maybe 20 However, I am getting the "no inclosing instance of type DisplayTermVectors is accessible" when calling Comparator... So to this function I pass vector of every document and max top terms i would like to know protected static Collection getTopTerms(TermFreqVector tfv, int maxTerms){ String[] terms = tfv.getTerms(); int[] tFreqs = tfv.getTermFrequencies(); List result = new ArrayList(terms.length); for (int i = 0; i < tFreqs.length; i++) { TermFrq tf = new TermFrq(terms[i], tFreqs[i]); result.add(tf); } Collections.sort(result, new FreqComparator()); if(maxTerms < result.size()){ result = result.subList(0, maxTerms); } return result; } /Class for objects to hold the term/freq pairs/ static class TermFrq{ private String term; private int freq; public TermFrq(String term,int freq){ this.term = term; this.freq = freq; } public String getTerm(){ return this.term; } public int getFreq(){ return this.freq; } } /*Comparator to compare the objects by the frequency*/ class FreqComparator implements Comparator{ public int compare(Object pair1, Object pair2){ int f1 = ((TermFrq)pair1).getFreq(); int f2 = ((TermFrq)pair2).getFreq(); if(f1 > f2) return 1; else if(f1 < f2) return -1; else return 0; } } Explanations and corrections i will very much appreciate, and also if someone else had experience with term frequency extraction and did it better way, I am opened to all suggestions! Please help!!!! Thanx!

  Read the article

• How to fix: unrecognized selector sent to instance

  - by Matt

  I am having a problem that may be simple to fix, but not simple for me to debug. I simple have a button inside a view in IB; the file's owner is set to the view controller class I am using and when making the connections, everything seems fine, ie. the connector is finding the method I am trying to call etc. however, I am receiving this error: Terminating app due to uncaught exception 'NSInvalidArgumentException', reason: '*** -[UIApplication getStarted:]: unrecognized selector sent to instance 0x3d19130' My code is as follows: RootViewController.h @interface RootViewController : UIViewController { IBOutlet UIButton* getStartedButton; } @property (nonatomic, retain) UIButton* getStartedButton; - (IBAction) getStarted: (id)sender; @end RootViewController.m #import "RootViewController.h" #import "SimpleDrillDownAppDelegate.h" @implementation RootViewController @synthesize getStartedButton; - (void)viewDidLoad { [super viewDidLoad]; } - (IBAction) getStarted: (id)sender { NSLog(@"Button Tapped!"); //[self.view removeFromSuperview]; } - (void)dealloc { [getStartedButton release]; [super dealloc]; } @end Seems simple enough...any thoughs?

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• Python: Hack to call a method on an object that isn't of its class

  - by cool-RR

  Assume you define a class, which has a method which does some complicated processing: class A(object): def my_method(self): # Some complicated processing is done here return self And now you want to use that method on some object from another class entirely. Like, you want to do A.my_method(7). This is what you'd get: TypeError: unbound method my_method() must be called with A instance as first argument (got int instance instead). Now, is there any possibility to hack things so you could call that method on 7? I'd want to avoid moving the function or rewriting it. (Note that the method's logic does depend on self.) One note: I know that some people will want to say, "You're doing it wrong! You're abusing Python! You shouldn't do it!" So yes, I know, this is a terrible terrible thing I want to do. I'm asking if someone knows how to do it, not how to preach to me that I shouldn't do it.

  Read the article

< Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68  | Next Page >