Search Results

Search found 1731 results on 70 pages for 'skip huffman'.

Page 61/70 | < Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68  | Next Page >

  • Need help iteratating over an array, retrieve two possibilites, no repeats, for Poker AI

    - by elguapo-85
    Can't really think of a good way to word this question, nor a good title, and maybe the answer is so ridiculously simple that I am missing it. I am working on a poker AI, and I want to calculate the number of hands that exist which are better then mine, I understand how to that, but want I can't figure out is the best way to iterate over a group of cards. So I am at the flop, I know what my two cards are and there are 3 cards on the board. So there are 47 unknown cards and I want to iterate over all possible combination of those 47 cards assuming that two are passed out, so you can't have two cards of the same rank and suit, and you if you have previously calculated a set you don't want to do it over again, because I will being wasting time, and this will be called many times. If you don't understand want I am asking please tell me and I will clarify more. So I can set something up like this, if that element equals one, it means it is not in my hand and not on the board, 4 for each suit, and 13 for each rank. setOfCards[4][13] If I do a simple set of for loops like this: (pseudocode) //remove cards I know are in play from setOfCards by setting values to zero for(int i = 0; i < 4; i++) for(int j = 0; j < 13; j++) for(int k = 0; k < 4; k++) for(int l = 0; l < 4; l++) //skip if values equal zero card1 = setOfCards[i][j] card2 = setOfCards[k][l] //now compare card1, card2 and set of board cards So this is actually going to repeat many values, for example: card1 = AceOfHearts, card2 = KingOfHearts is the same as card1 = KingOfHearts, card2 = AceOfHearts. It will also alter my calculations. How should I go about avoiding this? Also is there a name for this technique? Thank you.

    Read the article

  • Finding N contiguous zero bits in an integer to the left of the MSB position of another integer

    - by James Morris
    The problem is: given an integer val1 find the position of the highest bit set (Most Significant Bit) then, given a second integer val2 find a contiguous region of unset bits, with the minimum number of zero bits given by width to the left of the position (ie, in the higher bits). Here is the C code for my solution: typedef unsigned int t; unsigned const t_bits = sizeof(t) * CHAR_BIT; _Bool test_fit_within_left_of_msb( unsigned width, t val1, t val2, unsigned* offset_result) { unsigned offbit = 0; unsigned msb = 0; t mask; t b; while(val1 >>= 1) ++msb; while(offbit + width < t_bits - msb) { mask = (((t)1 << width) - 1) << (t_bits - width - offbit); b = val2 & mask; if (!b) { *offset_result = offbit; return true; } if (offbit++) /* this conditional bothers me! */ b <<= offbit - 1; while(b <<= 1) offbit++; } return false; } Aside from faster ways of finding the MSB of the first integer, the commented test for a zero offbit seems a bit extraneous, but necessary to skip the highest bit of type t if it is set. I have also implemented similar algorithms but working to the right of the MSB of the first number, so they don't require this seemingly extra condition. How can I get rid of this extra condition, or even, are there far more optimal solutions? Edit: Some background not strictly required. The offset result is a count of bits from the high bit, not from the low bit as maybe expected. This will be part of a wider algorithm which scans a 2D array for a 2D area of zero bits. Here, for testing, the algorithm has been simplified. val1 represents the first integer which does not have all bits set found in a row of the 2D array. From this the 2D version would scan down which is what val2 represents. Here's some output showing success and failure: t_bits:32 t_high: 10000000000000000000000000000000 ( 2147483648 ) --------- ----------------------------------- *** fit within left of msb test *** ----------------------------------- val1: 00000000000000000000000010000000 ( 128 ) val2: 01000001000100000000100100001001 ( 1091569929 ) msb: 7 offbit:0 + width: 8 = 8 mask: 11111111000000000000000000000000 ( 4278190080 ) b: 01000001000000000000000000000000 ( 1090519040 ) offbit:8 + width: 8 = 16 mask: 00000000111111110000000000000000 ( 16711680 ) b: 00000000000100000000000000000000 ( 1048576 ) offbit:12 + width: 8 = 20 mask: 00000000000011111111000000000000 ( 1044480 ) b: 00000000000000000000000000000000 ( 0 ) offbit:12 iters:10 ***** found room for width:8 at offset: 12 ***** ----------------------------------- *** fit within left of msb test *** ----------------------------------- val1: 00000000000000000000000001000000 ( 64 ) val2: 00010000000000001000010001000001 ( 268469313 ) msb: 6 offbit:0 + width: 13 = 13 mask: 11111111111110000000000000000000 ( 4294443008 ) b: 00010000000000000000000000000000 ( 268435456 ) offbit:4 + width: 13 = 17 mask: 00001111111111111000000000000000 ( 268402688 ) b: 00000000000000001000000000000000 ( 32768 ) ***** mask: 00001111111111111000000000000000 ( 268402688 ) offbit:17 iters:15 ***** no room found for width:13 ***** (iters is the count of iterations of the inner while loop)

    Read the article

  • Code golf - hex to (raw) binary conversion

    - by Alnitak
    In response to this question asking about hex to (raw) binary conversion, a comment suggested that it could be solved in "5-10 lines of C, or any other language." I'm sure that for (some) scripting languages that could be achieved, and would like to see how. Can we prove that comment true, for C, too? NB: this doesn't mean hex to ASCII binary - specifically the output should be a raw octet stream corresponding to the input ASCII hex. Also, the input parser should skip/ignore white space. edit (by Brian Campbell) May I propose the following rules, for consistency? Feel free to edit or delete these if you don't think these are helpful, but I think that since there has been some discussion of how certain cases should work, some clarification would be helpful. The program must read from stdin and write to stdout (we could also allow reading from and writing to files passed in on the command line, but I can't imagine that would be shorter in any language than stdin and stdout) The program must use only packages included with your base, standard language distribution. In the case of C/C++, this means their respective standard libraries, and not POSIX. The program must compile or run without any special options passed to the compiler or interpreter (so, 'gcc myprog.c' or 'python myprog.py' or 'ruby myprog.rb' are OK, while 'ruby -rscanf myprog.rb' is not allowed; requiring/importing modules counts against your character count). The program should read integer bytes represented by pairs of adjacent hexadecimal digits (upper, lower, or mixed case), optionally separated by whitespace, and write the corresponding bytes to output. Each pair of hexadecimal digits is written with most significant nibble first. The behavior of the program on invalid input (characters besides [a-fA-F \t\r\n], spaces separating the two characters in an individual byte, an odd number of hex digits in the input) is undefined; any behavior (other than actively damaging the user's computer or something) on bad input is acceptable (throwing an error, stopping output, ignoring bad characters, treating a single character as the value of one byte, are all OK) The program may write no additional bytes to output. Code is scored by fewest total bytes in the source file. (Or, if we wanted to be more true to the original challenge, the score would be based on lowest number of lines of code; I would impose an 80 character limit per line in that case, since otherwise you'd get a bunch of ties for 1 line).

    Read the article

  • Looping through all attributes of a XML element in XSLT

    - by TheGNUGuy
    Hey everyone, I am trying to use <xsl:for-each select="@*"> to grab all the attributes of a given element but when i do that my <xsl:choose> statement doesn't execute. Here is the element that I'm working with: <textBox id="Airfare" value="" label="text 1"/> Here is the XSLT template I'm using: <xsl:template match="textBox"> <div> <xsl:choose> <xsl:when test="@label"> <xsl:value-of select="@label"/> </xsl:when> <xsl:otherwise> <xsl:text>No Label Defined</xsl:text> </xsl:otherwise> </xsl:choose> <xsl:element name="input"> <xsl:attribute name="type">text</xsl:attribute> <xsl:for-each select="@*"> <xsl:choose> <xsl:when test="@id"> <xsl:attribute name="name">form_<xsl:value-of select="@id"/></xsl:attribute> <xsl:attribute name="id">form_<xsl:value-of select="@id"/></xsl:attribute> </xsl:when> <xsl:when test="@label"> </xsl:when> <xsl:otherwise> <xsl:copy-of select="current()"/> </xsl:otherwise> </xsl:choose> </xsl:for-each> </xsl:element> </div> And when I generate the HTML using PHP I get this: <div>text 1<input type="text" id="Airfare" value="" label="text 1"></div> As you can see it didn't add form_ to the id attribute it didn't generate a name attribute and it didn't skip over the label attribute. Thanks for your help!

    Read the article

  • Quick question regarding this issue, Why doesnt it print out the second value(converted second value

    - by sil3nt
    Quick question, What have I done wrong here. The purpose of this code is to get the input into a string, the input being "12 34", with a space in between the "12" and "32" and to convert and print the two separate numbers from an integer variable known as number. Why doesn't the second call to the function copyTemp, not produce the value 34?. I have an index_counter variable which keeps track of the string index and its meant to skip the 'space' character?? what have i done wrong? thanks. #include <stdio.h> #include <string.h> int index_counter = 0; int number; void copyTemp(char *expr,char *temp); int main(){ char exprstn[80]; //as global? char tempstr[80]; gets(exprstn); copyTemp(exprstn,tempstr); printf("Expression: %s\n",exprstn); printf("Temporary: %s\n",tempstr); printf("number is: %d\n",number); copyTemp(exprstn,tempstr); //second call produces same output shouldnt it now produce 34 in the variable number? printf("Expression: %s\n",exprstn); printf("Temporary: %s\n",tempstr); printf("number is: %d\n",number); return 0; } void copyTemp(char *expr,char *temp){ int i; for(i = index_counter; expr[i] != '\0'; i++){ if (expr[i] == '0'){ temp[i] = expr[i]; } if (expr[i] == '1'){ temp[i] = expr[i]; } if (expr[i] == '2'){ temp[i] = expr[i]; } if (expr[i] == '3'){ temp[i] = expr[i]; } if (expr[i] == '4'){ temp[i] = expr[i]; } if (expr[i] == '5'){ temp[i] = expr[i]; } if (expr[i] == '6'){ temp[i] = expr[i]; } if (expr[i] == '7'){ temp[i] = expr[i]; } if (expr[i] == '8'){ temp[i] = expr[i]; } if (expr[i] == '9'){ temp[i] = expr[i]; } if (expr[i] == ' '){ temp[i] = '\0'; sscanf(temp,"%d",&number); index_counter = i+1; //skips? } } // is this included here? temp[i] = '\0'; }

    Read the article

  • Why does C# exit when calling the Ada elaboration routine using debug?

    - by erict
    I have a DLL created in Ada using GPS. I am dynamically loading it and calling it successfully both from Ada and from C++. But when I try to call it from C#, the program exits on the call to Elaboration init. What am I missing? The exact same DLL is perfectly happy getting called from C++ and Ada. Edit: If I start the program without Debugging, it also works with C#. But if I run it with the Debugger, then it exits on the call to ElaborationInit. There are no indications in any of the Windows event logs. If the Ada DLL is Pure, and I skip the elaboration init call, the actual function DLL is called correctly, so it has something to do with the elaboration. using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Runtime.InteropServices; namespace CallingDLLfromCS { class Program { [DllImport("kernel32.dll", CharSet = CharSet.Auto, SetLastError = true)] public static extern IntPtr LoadLibrary(string dllToLoad); [DllImport("kernel32.dll", CharSet = CharSet.Ansi, SetLastError = true)] public static extern IntPtr GetProcAddress(IntPtr hModule, string procedureName); [DllImport("kernel32.dll", CharSet = CharSet.Auto, SetLastError = true)] public static extern bool FreeLibrary(IntPtr hModule); [UnmanagedFunctionPointer(CallingConvention.StdCall)] delegate int AdaCallable2_dlgt(int val); static AdaCallable2_dlgt fnAdaCallable2 = null; [UnmanagedFunctionPointer(CallingConvention.StdCall)] delegate void ElaborationInit_dlgt(); static ElaborationInit_dlgt ElaborationInit = null; [UnmanagedFunctionPointer(CallingConvention.StdCall)] delegate void AdaFinal_dlgt(); static AdaFinal_dlgt AdaFinal = null; static void Main(string[] args) { int result; bool fail = false; // assume the best IntPtr pDll2 = LoadLibrary("libDllBuiltFromAda.dll"); if (pDll2 != IntPtr.Zero) { // Note the @4 is because 4 bytes are passed. This can be further reduced by the use of a DEF file in the DLL generation. IntPtr pAddressOfFunctionToCall = GetProcAddress(pDll2, "AdaCallable@4"); if (pAddressOfFunctionToCall != IntPtr.Zero) { fnAdaCallable2 = (AdaCallable2_dlgt)Marshal.GetDelegateForFunctionPointer(pAddressOfFunctionToCall, typeof(AdaCallable2_dlgt)); } else fail = true; pAddressOfFunctionToCall = GetProcAddress(pDll2, "DllBuiltFromAdainit"); if (pAddressOfFunctionToCall != IntPtr.Zero) { ElaborationInit = (ElaborationInit_dlgt)Marshal.GetDelegateForFunctionPointer(pAddressOfFunctionToCall, typeof(ElaborationInit_dlgt)); } else fail = true; pAddressOfFunctionToCall = GetProcAddress(pDll2, "DllBuiltFromAdafinal"); if (pAddressOfFunctionToCall != IntPtr.Zero) AdaFinal = (AdaFinal_dlgt)Marshal.GetDelegateForFunctionPointer(pAddressOfFunctionToCall, typeof(AdaFinal_dlgt)); else fail = true; if (!fail) { ElaborationInit.Invoke(); // ^^^^^^^^^^^^^^^^^^^^^^^^^ FAILS HERE result = fnAdaCallable2(50); Console.WriteLine("Return value is " + result.ToString()); AdaFinal(); } FreeLibrary(pDll2); } } } }

    Read the article

  • Using IOperationBehavior to supply a WCF parameter

    - by Chris Kemp
    This is my first step into the world of stackoverflow, so apologies if I cock anything up. I'm trying to create a WCF Operation which has a parameter that is not exposed to the outside world, but is instead automatically passed into the function. So the world sees this: int Add(int a, int b) But it is implemented as: int Add(object context, int a, int b) Then, the context gets supplied by the system at run-time. The example I'm working with is completely artificial, but mimics something that I'm looking into in a real-world scenario. I'm able to get close, but not quite the whole way there. First off, I created a simple method and wrote an application to confirm it works. It does. It returns a + b and writes the context as a string to my debug. Yay. [OperationContract] int Add(object context, int a, int b); I then wrote the following code: public class SupplyContextAttribute : Attribute, IOperationBehavior { public void Validate(OperationDescription operationDescription) { if (!operationDescription.Messages.Any(m => m.Body.Parts.First().Name == "context")) throw new FaultException("Parameter 'context' is missing."); } public void ApplyDispatchBehavior(OperationDescription operationDescription, DispatchOperation dispatchOperation) { dispatchOperation.Invoker = new SupplyContextInvoker(dispatchOperation.Invoker); } public void ApplyClientBehavior(OperationDescription operationDescription, ClientOperation clientOperation) { } public void AddBindingParameters(OperationDescription operationDescription, BindingParameterCollection bindingParameters) { // Remove the 'context' parameter from the inbound message operationDescription.Messages[0].Body.Parts.RemoveAt(0); } } public class SupplyContextInvoker : IOperationInvoker { readonly IOperationInvoker _invoker; public SupplyContextInvoker(IOperationInvoker invoker) { _invoker = invoker; } public object[] AllocateInputs() { return _invoker.AllocateInputs().Skip(1).ToArray(); } private object[] IntroduceContext(object[] inputs) { return new[] { "MyContext" }.Concat(inputs).ToArray(); } public object Invoke(object instance, object[] inputs, out object[] outputs) { return _invoker.Invoke(instance, IntroduceContext(inputs), out outputs); } public IAsyncResult InvokeBegin(object instance, object[] inputs, AsyncCallback callback, object state) { return _invoker.InvokeBegin(instance, IntroduceContext(inputs), callback, state); } public object InvokeEnd(object instance, out object[] outputs, IAsyncResult result) { return _invoker.InvokeEnd(instance, out outputs, result); } public bool IsSynchronous { get { return _invoker.IsSynchronous; } } } And my WCF operation now looks like this: [OperationContract, SupplyContext] int Amend(object context, int a, int b); My updated references no longer show the 'context' parameter, which is exactly what I want. The trouble is that whenver I run the code, it gets past the AllocateInputs and then throws an Index was outside the bounds of the Array. error somewhere in the WCF guts. I've tried other things, and I find that I can successfully change the type of the parameter and rename it and have my code work. But the moment I remove the parameter it falls over. Can anyone give me some idea of how to get this to work (or if it can be done at all).

    Read the article

  • How do I create a simple seach box with a submit button to bring back a result set in MVC?

    - by RJ
    I am very new to MVC and just learning the basics. I have been following along in Nerd Dinner and used the demo as a way to create my own app. I have created a page that lists out some food items with calories, fat, protein,etc... (http://rjsfitness.net/CalorieList) This is one of my own personal sites that I set up to test out MVC. I got a lot of it working but I am stuck on the textbox with a search button. My view page has this code for the search: <form action="/CalorieList/Search" method="post" id="searchForm"> <input type="text" name="searchTerm" id="searchTerm" value="" size="10" maxlength ="30" /> <input type ="submit" value="Search" /> </form> My global.asax has this code for the routing: routes.MapRoute( "Search", // Route name "CalorieList/Search/{searchTerm}", // URL with parameters new { controller = "CalorieList", action = "Search", search = "" } // Parameter defaults ); My Controller has this code: public ActionResult Index(int? page) { const int pageSize = 10; //load a list with the calorie list var calorieLists = calorieListRepository.GetAllCalorieLists(); //var paginatedCalorieLists = calorieLists.Skip((page ?? 0) * pageSize).Take(pageSize).ToList(); var paginatedCalorieLists = new PaginatedList<CalorieList>(calorieLists, page ?? 0, pageSize); return View("Index", paginatedCalorieLists); } public ActionResult Search(String searchTerm) { const int pageSize = 100; int? page = 0; var calorieLists = calorieListRepository.GetCalorieListsBySearch(searchTerm); var paginatedCalorieLists = new PaginatedList<CalorieList>(calorieLists, page ?? 0, pageSize); return View("Index", paginatedCalorieLists); } return View("Index", paginatedCalorieLists); } When I enter a value and click the button, the Index method fires instead of the Seach method in the controller and I get the full list again. If I manually type the url (http://rjsfitness.net/CalorieList/Search/choc) I get the right listing. Why isn't my button click using the right routing and giving me the search results?

    Read the article

  • invite friends in a dialog in a Facebook application

    - by Shani1351
    I'm trying to create a Facebook application that displays a friend invite dialog within the application using Facebook's Javascript API (FB.ui). To do that I followed this tutorial I have two problems : The action url I've put in the request-form is "http://apps.facebook.com/appname/post_invite.php" but I see that the iframe source after the post is "http://mydomain.com/post_invite.php" and when this iframe tries to do : parent.closeInviteWidget(); I get an error saying : "Permission denied for < http: //mydomain.com (document.domain has not been set) to get property Window.closeInviteWidget from < http:// apps.facebook.com (document.domain=< http:// facebook.com)." The skip button inside the request-form opens the action url in a new window (new browser tab) and not post to itself like the invite button. How can I fix those problems? -------------------- UPDATE : -------------------------------- I've tried to do what ifaour said and changed the code to : function inviteFriends(user_name, category_id, category_name) { url = appBaseUrl + "/index.php?category_id=" + category_id; req = "<fb:req-choice url='" + url + "' label='Authorize My Application' />"; content = user_name + " opened a new category called " + category_name + ". " + req; action = 'post_invite.php'; fbmi_text = '<fb:request-form action="' + action + '" target="_self" method="post" invite="true" type="Invite" content="' + content + '" <fb:multi-friend-selector showborder="false" actiontext="Invite yor friends" email_invite="false" import_external_friends="false" /> </fb:request-form>'; FB.ui({ method:'fbml.dialog', width:'750px', fbml:fbmi_text }); } When I use FireBug and look at the invite form it looks like this: <form id="req_form_4d20682f73ddb6e71722794" content="I've opened a new category called dsfsd. <fb:req-choice url='http://apps.facebook.com/appname/index.php?category_id=60' label='Authorize My Application' /> type="Invite" invite="true" method="post" target="_self" action="http://apps.facebook.com/appname/post_invite.php"> ... </form> But I still get the same error : Permission denied for <http://mydomain.com> (document.domain has not been set) to get property Window.closeInviteWidget from <http://apps.facebook.com> (document.domain=<http://facebook.com>)...

    Read the article

  • vim plugin to show current Perl subroutine

    - by Andrew
    I'm trying to make a vim plugin that will split the window on load and simulate a info bar at the top of my terminal. I've got it sorta working but I think I've either reached limits of my knowledge of vim syntax or there's a logic problem in my code. The desired effect would be to do a reverse search for any declaration of a Perl subroutine form my current location in the active buffer and display the line in the top buffer. I'm also trying to make it skip that buffer when I switch buffers with <C-R>. My attempt at that so far can be seen in the mess of nested if statements. Anyway, here's the code. I would greatly appreciate feedback from anyone. (pastebin pastebin.com/8cuMPn1Q) let s:current_function_bufname = 'Current\ Function\/Subroutine' function! s:get_current_function_name(no_echo) let lnum = line(".") let col = col(".") if a:no_echo let s:current_function_name = getline(search("^[^s]sub .$", 'bW')) else echohl ModeMsg echo getline(search("^[^s]sub .$", 'bW')) "echo getline(search("^[^ \t#/]\{2}.[^:]\s$", 'bW')) echohl None endif endfunction let s:previous_winbufnr = 1 let s:current_function_name = '' let s:current_function_buffer_created = 0 let s:current_function_bufnr = 2 function! s:show_current_function() let total_buffers = winnr('$') let current_winbufnr = winnr() if s:previous_winbufnr != current_winbufnr if bufname(current_winbufnr) == s:current_function_bufname if s:previous_winbufnr < current_winbufnr let i = current_winbufnr + 1 if i total_buffers let i = 1 endif if i == s:current_function_bufnr let i = i + 1 endif if i total buffers let i = 1 endif exec i.'wincmd w' else let i = current_winbufnr - 1 if i < 1 let i = total_buffers endif if i == s:current_function_bufnr let i = i - 1 endif if i < 1 let i = total_buffers endif try exec i.'wincmd w' finally exec total_buffers.'wincmd w' endtry endif endif let s:previous_winbufnr = current_winbufnr return 1 endif if s:current_function_buffer_created == 0 exec 'top 1 split '.s:current_function_bufname call s:set_as_scratch_buffer() let s:current_function_buffer_created = 1 let s:current_function_bufnr = winnr() endif call s:activate_buffer_by_name(s:current_function_bufname) setlocal modifiable call s:get_current_function_name(1) call setline(1, s:current_function_name) setlocal nomodifiable call s:activate_buffer_by_name(bufname(current_winbufnr)) endfunction function! s:set_as_scratch_buffer() setlocal noswapfile setlocal nomodifiable setlocal bufhidden=delete setlocal buftype=nofile setlocal nobuflisted setlocal nonumber setlocal nowrap setlocal cursorline endfunction function! s:activate_buffer_by_name(name) for i in range(1, winnr('$')) let name = bufname(winbufnr(i)) let full_name = fnamemodify(bufname(winbufnr(i)), ':p') if name == a:name || full_name == a:name exec i.'wincmd w' return 1 endif endfor return 0 endfunction set laststatus=2 autocmd! CursorMoved,CursorMovedI,BufWinEnter * call s:show_current_function() (pastebin pastebin.com/8cuMPn1Q) similar to VIM: display custom reference bar on top of window and http://vim.wikia.com/wiki/Show_current_function_name_in_C_programs

    Read the article

  • Slow MySQL query....only sometimes

    - by Shane N
    I have a query that's used in a reporting system of ours that sometimes runs quicker than a second, and other times takes 1 to 10 minutes to run. Here's the entry from the slow query log: # Query_time: 543 Lock_time: 0 Rows_sent: 0 Rows_examined: 124948974 use statsdb; SELECT count(distinct Visits.visitorid) as 'uniques' FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime>=1275721200 and visittime<=1275807599 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9 AND Visits.visitorid NOT IN (SELECT Visits.visitorid FROM Visits,Visitors WHERE Visits.visitorid=Visitors.visitorid and candidateid in (32) and visittime<1275721200 and (omit=0 or omit>=1275807599) AND Visitors.segmentid=9); It's basically counting unique visitors, and it's doing that by counting the visitors for today and then substracting those that have been here before. If you know of a better way to do this, let me know. I just don't understand why sometimes it can be so quick, and other times takes so long - even with the same exact query under the same server load. Here's the EXPLAIN on this query. As you can see it's using the indexes I've set up: id select_type table type possible_keys key key_len ref rows Extra 1 PRIMARY Visits range visittime_visitorid,visitorid visittime_visitorid 4 NULL 82500 Using where; Using index 1 PRIMARY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where 2 DEPENDENT SUBQUERY Visits ref visittime_visitorid,visitorid visitorid 8 func 1 Using where 2 DEPENDENT SUBQUERY Visitors eq_ref PRIMARY,cand_visitor_omit PRIMARY 8 statsdb.Visits.visitorid 1 Using where I tried to optimize the query a few weeks ago and came up with a variation that consistently took about 2 seconds, but in practice it ended up taking more time since 90% of the time the old query returned much quicker. Two seconds per query is too long because we are calling the query up to 50 times per page load, with different time periods. Could the quick behavior be due to the query being saved in the query cache? I tried running 'RESET QUERY CACHE' and 'FLUSH TABLES' between my benchmark tests and I was still getting quick results most of the time. Note: last night while running the query I got an error: Unable to save result set. My initial research shows that may be due to a corrupt table that needs repair. Could this be the reason for the behavior I'm seeing? In case you want server info: Accessing via PHP 4.4.4 MySQL 4.1.22 All tables are InnoDB We run optimize table on all tables weekly The sum of both the tables used in the query is 500 MB MySQL config: key_buffer = 350M max_allowed_packet = 16M thread_stack = 128K sort_buffer = 14M read_buffer = 1M bulk_insert_buffer_size = 400M set-variable = max_connections=150 query_cache_limit = 1048576 query_cache_size = 50777216 query_cache_type = 1 tmp_table_size = 203554432 table_cache = 120 thread_cache_size = 4 wait_timeout = 28800 skip-external-locking innodb_file_per_table innodb_buffer_pool_size = 3512M innodb_log_file_size=100M innodb_log_buffer_size=4M

    Read the article

  • how to remove empty tags in input xml

    - by SGB
    My java module gets a huge input xml from a mainframe. Unfortunately, the mainframe is unable to skip optional elements when it is not a leaf node, with the result that I get a LOT of empty tags in my input : So, <pre><code><SSN>111111111</SSN> <Employment> <Current> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Current> <Previous> <Address> <line1/> <line2/> <line3/> <city/> <state/> <country/> </Address> <Phone> <phonenumber/> <countryCode/> </Phone> </Previous> </Employment> <MaritalStatus>Single</MaritalStatus> </code></pre> should be <SSN>111111111</SSN> <MaritalStatus>Single</MaritalStatus> I use jaxb to unmarshall the input xml string that the mainframe sends it. Is there a clean/ easy way to remove all the empty group tags, or do I have to do this manuall in the code for each element. I have over 35 elements in my input xml, so I would love to it if jaxb itself had a way of doing this automatically? Thanks, SGB

    Read the article

  • mysql: can't set max_allowed_package to anything grater than 16MB

    - by sas
    I'm not sure if this is the right place to post these kind of questions, if it's not so, please (politely) let me know... :-) I need to save files greater than 16MB on a mysql database from a php site... I've already changed the c:\xampp\mysql\bin\my.cnf and set max_allowed_packet to 16 MB, and everything worked fine then I set it to 32 MB but there´s no way I can handle a file bigger than 16 MB I get the following error: 'MySQL server has gone away' (the same error I had when max_allowed_packet was set to 1MB) there must be some other setting that doesn´t allow me to handle files bigger than 16MB maybe the php client, I guess, but I don't know where to edit it this is the code I'm running when file.txt is smaller than 16.776.192 bytes long, it works fine, but if file.txt has 16.777.216 bytes i get the aforementioned error oh, and the field download.content is a longblob... $file = 'file.txt'; $file_handle = fopen( $file, 'r' ); $content = fread( $file_handle, filesize( $file ) ); fclose( $file_handle ); db_execute( 'truncate table download', true ); $sql = "insert into download( code, title, name, description, original_name, mime_type, size, content, user_insert_id, date_insert, user_update_id, date_update ) values ( 'new file', 'new file', 'sas.jpg', 'new file', '$file', 'mime', " . filesize( $file ) . ", '" . addslashes( $content ) . "', 0, " . db_char_to_sql( now_char(), 'datetime' ) . ", 0, " . db_char_to_sql( now_char(), 'datetime' ) . " )"; db_execute( $sql, true ); (the db_execute funcion just opens the connections and executes the sql stuff) running on windows XP sp2 server version: 5.0.67-community PHP Version 4.4.9 mysql client API version: 3.23.49 using: ApacheFriends XAMPP (Basispaket) version 1.6.8 that comes with + Apache 2.2.9 + MySQL 5.0.67 (Community Server) + PHP 5.2.6 + PHP 4.4.9 + PEAR + phpMyAdmin 2.11.9.2 ... this is part of the content of c:\xampp\mysql\bin\my.cnf # The MySQL server [mysqld] port= 3306 socket= "C:/xampp/mysql/mysql.sock" basedir="C:/xampp/mysql" tmpdir="C:/xampp/tmp" datadir="C:/xampp/mysql/data" skip-locking key_buffer = 16M # max_allowed_packet = 1M max_allowed_packet = 32M table_cache = 128 sort_buffer_size = 512K net_buffer_length = 8K read_buffer_size = 256K read_rnd_buffer_size = 512K myisam_sort_buffer_size = 8M

    Read the article

  • Can I avoid a threaded UDP socket in Python dropping data?

    - by 666craig
    First off, I'm new to Python and learning on the job, so be gentle! I'm trying to write a threaded Python app for Windows that reads data from a UDP socket (thread-1), writes it to file (thread-2), and displays the live data (thread-3) to a widget (gtk.Image using a gtk.gdk.pixbuf). I'm using queues for communicating data between threads. My problem is that if I start only threads 1 and 3 (so skip the file writing for now), it seems that I lose some data after the first few samples. After this drop it looks fine. Even by letting thread 1 complete before running thread 3, this apparent drop is still there. Apologies for the length of code snippet (I've removed the thread that writes to file), but I felt removing code would just prompt questions. Hope someone can shed some light :-) import socket import threading import Queue import numpy import gtk gtk.gdk.threads_init() import gtk.glade import pygtk class readFromUDPSocket(threading.Thread): def __init__(self, socketUDP, readDataQueue, packetSize, numScans): threading.Thread.__init__(self) self.socketUDP = socketUDP self.readDataQueue = readDataQueue self.packetSize = packetSize self.numScans = numScans def run(self): for scan in range(1, self.numScans + 1): buffer = self.socketUDP.recv(self.packetSize) self.readDataQueue.put(buffer) self.socketUDP.close() print 'myServer finished!' class displayWithGTK(threading.Thread): def __init__(self, displayDataQueue, image, viewArea): threading.Thread.__init__(self) self.displayDataQueue = displayDataQueue self.image = image self.viewWidth = viewArea[0] self.viewHeight = viewArea[1] self.displayData = numpy.zeros((self.viewHeight, self.viewWidth, 3), dtype=numpy.uint16) def run(self): scan = 0 try: while True: if not scan % self.viewWidth: scan = 0 buffer = self.displayDataQueue.get(timeout=0.1) self.displayData[:, scan, 0] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 1] = numpy.fromstring(buffer, dtype=numpy.uint16) self.displayData[:, scan, 2] = numpy.fromstring(buffer, dtype=numpy.uint16) gtk.gdk.threads_enter() self.myPixbuf = gtk.gdk.pixbuf_new_from_data(self.displayData.tostring(), gtk.gdk.COLORSPACE_RGB, False, 8, self.viewWidth, self.viewHeight, self.viewWidth * 3) self.image.set_from_pixbuf(self.myPixbuf) self.image.show() gtk.gdk.threads_leave() scan += 1 except Queue.Empty: print 'myDisplay finished!' pass def quitGUI(obj): print 'Currently active threads: %s' % threading.enumerate() gtk.main_quit() if __name__ == '__main__': # Create socket (IPv4 protocol, datagram (UDP)) and bind to address socketUDP = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) host = '192.168.1.5' port = 1024 socketUDP.bind((host, port)) # Data parameters samplesPerScan = 256 packetsPerSecond = 1200 packetSize = 512 duration = 1 # For now, set a fixed duration to log data numScans = int(packetsPerSecond * duration) # Create array to store data data = numpy.zeros((samplesPerScan, numScans), dtype=numpy.uint16) # Create queue for displaying from readDataQueue = Queue.Queue(numScans) # Build GUI from Glade XML file builder = gtk.Builder() builder.add_from_file('GroundVue.glade') window = builder.get_object('mainwindow') window.connect('destroy', quitGUI) view = builder.get_object('viewport') image = gtk.Image() view.add(image) viewArea = (1200, samplesPerScan) # Instantiate & start threads myServer = readFromUDPSocket(socketUDP, readDataQueue, packetSize, numScans) myDisplay = displayWithGTK(readDataQueue, image, viewArea) myServer.start() myDisplay.start() gtk.gdk.threads_enter() gtk.main() gtk.gdk.threads_leave() print 'gtk.main finished!'

    Read the article

  • Primary language - C++/Qt, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Import? Initialize? what do to?

    - by Jeremy B
    I'm working on homework and I'm close but I am having an issue. I just learned how to work with packages in eclipse so I have a class that is importing another class from a package (I think I said that right) The main prompts the user to enter an integer between -100 and 100 and I am having an issue with validating it. I know the issue is where I'm importing I'm just unsure the direction I need to go to fix it. This is a section of my main code. (my issue starts with the last couple lines if you want to skip ahead) import myUtils.util.Console; public class ConsoleTestApp { public static void main(String args[]) { // create the Console object Console c = new Console(); // display a welcome message c.println("Welcome to the Console Tester application"); c.println(); // int c.println("Int Test"); int i = c.getIntWithinRange("Enter an integer between -100 and 100: ", -101, 101); c.println(); I have a class called Console that is located in another package that I believe I have properly imported. here is the code I am stuck on in my console class. public int getIntWithinRange(String prompt, int min, int max) { int i = 0; boolean isValid = false; while (isValid == false) { System.out.println(prompt); if (sc.hasNextInt()) { //if user chooses menu option less than 1 the program will print an error message i = sc.nextInt(); if (i < min) { System.out.println("Error! Please enter an int greater than -100"); } else if (i > max) { System.out.println("Error! Please enter an int less than 100"); } else isValid = true; } else System.out.println("Error! Invalid number value"); sc.nextLine(); } // return the int return i; } when I run this I keep getting my last print which is an invalid number value. am I not importing the code from the main method in the other console properly?

    Read the article

  • Do you use an exception class in your Perl programs? Why or why not?

    - by daotoad
    I've got a bunch of questions about how people use exceptions in Perl. I've included some background notes on exceptions, skip this if you want, but please take a moment to read the questions and respond to them. Thanks. Background on Perl Exceptions Perl has a very basic built-in exception system that provides a spring-board for more sophisticated usage. For example die "I ate a bug.\n"; throws an exception with a string assigned to $@. You can also throw an object, instead of a string: die BadBug->new('I ate a bug.'); You can even install a signal handler to catch the SIGDIE psuedo-signal. Here's a handler that rethrows exceptions as objects if they aren't already. $SIG{__DIE__} = sub { my $e = shift; $e = ExceptionObject->new( $e ) unless blessed $e; die $e; } This pattern is used in a number of CPAN modules. but perlvar says: Due to an implementation glitch, the $SIG{DIE} hook is called even inside an eval(). Do not use this to rewrite a pending exception in $@ , or as a bizarre substitute for overriding CORE::GLOBAL::die() . This strange action at a distance may be fixed in a future release so that $SIG{DIE} is only called if your program is about to exit, as was the original intent. Any other use is deprecated. So now I wonder if objectifying exceptions in sigdie is evil. The Questions Do you use exception objects? If so, which one and why? If not, why not? If you don't use exception objects, what would entice you to use them? If you do use exception objects, what do you hate about them, and what could be better? Is objectifying exceptions in the DIE handler a bad idea? Where should I objectify my exceptions? In my eval{} wrapper? In a sigdie handler? Are there any papers, articles or other resources on exceptions in general and in Perl that you find useful or enlightening.

    Read the article

  • Linking to a section of a site that is hidden by a hide/show JavaScript function

    - by hollyb
    I am using a bit of JavaScript to show/hide sections of a site when a tab is clicked. I'm trying to figure out if there is a way I can link back to the page and have a certain tab open based on that link. Here is the JS: var ids=new Array('section1','section2','section3','section4'); function switchid(id, el){ hideallids(); showdiv(id); var li = el.parentNode.parentNode.childNodes[0]; while (li) { if (!li.tagName || li.tagName.toLowerCase() != "li") li = li.nextSibling; // skip the text node if (li) { li.className = ""; li = li.nextSibling; } } el.parentNode.className = "active"; } function hideallids(){ //loop through the array and hide each element by id for (var i=0;i<ids.length;i++){ hidediv(ids[i]); } } function hidediv(id) { //safe function to hide an element with a specified id document.getElementById(id).style.display = 'none'; } function showdiv(id) { //safe function to show an element with a specified id document.getElementById(id).style.display = 'block'; } And the HTML <ul> <li class="active"><a onclick="switchid('section1', this);return false;">One</a></li> <li><a onclick="switchid('section2', this);return false;">Two</a></li> <li><a onclick="switchid('section3', this);return false;">Three</a></li> <li><a onclick="switchid('section4', this);return false;">Four</a></li> </ul> <div id="section1" style="display:block;"> <div id="section2" style="display:none;"> <div id="section3" style="display:none;"> <div id="section4" style="display:none;"> I haven't been able to come up with a way to link back to a specific section. Is it even possible with this method? Thanks!

    Read the article

  • Primary language - QtC++, C#, Java?

    - by Airjoe
    I'm looking for some input, but let me start with a bit of background (for tl;dr skip to end). I'm an IT major with a concentration in networking. While I'm not a CS major nor do I want to program as a vocation, I do consider myself a programmer and do pretty well with the concepts involved. I've been programming since about 6th grade, started out with a proprietary game creation language that made my transition into C++ at college pretty easy. I like to make programs for myself and friends, and have been paid to program for local businesses. A bit about that- I wrote some programs for a couple local businesses in my senior year in high school. I wrote management systems for local shops (inventory, phone/pos orders, timeclock, customer info, and more stuff I can't remember). It definitely turned out to be over my head, as I had never had any formal programming education. It was a great learning experience, but damn was it crappy code. Oh yeah, by the way, it was all vb6. So, I've used vb6 pretty extensively, I've used c++ in my classes (intro to programming up to algorithms), used Java a little bit in another class (had to write a ping client program, pretty easy) and used Java for some simple Project Euler problems to help learn syntax and such when writing the program for the class. I've also used C# a bit for my own simple personal projects (simple programs, one which would just generate an HTTP request on a list of websites and notify if one responded unexpectedly or not at all, and another which just held a list of things to do and periodically reminded me to do them), things I would've written in vb6 a year or two ago. I've just started using Qt C++ for some undergrad research I'm working on. Now I've had some formal education, I [think I] understand organization in programming a lot better (I didn't even use classes in my vb6 programs where I really should have), how it's important to structure code, split into functions where appropriate, document properly, efficiency both in memory and speed, dynamic and modular programming etc. I was looking for some input on which language to pick up as my "primary". As I'm not a "real programmer", it will be mostly hobby projects, but will include some 'real' projects I'm sure. From my perspective: QtC++ and Java are cross platform, which is cool. Java and C# run in a virtual machine, but I'm not sure if that's a big deal (something extra to distribute, possibly a bit slower? I think Qt would require additional distributables too, right?). I don't really know too much more than this, so I appreciate any help, thanks! TL;DR Am an avocational programmer looking for a language, want quick and straight forward development, liked vb6, will be working with database driven GUI apps- should I go with QtC++, Java, C#, or perhaps something else?

    Read the article

  • Searching for duplicate records within a text file where the duplicate is determined by only two fie

    - by plg
    First, Python Newbie; be patient/kind. Next, once a month I receive a large text file (think 7 Million records) to test for duplicate values. This is catalog information. I get 7 fields, but the two I'm interested in are a supplier code and a full orderable part number. To determine if the record is dupliacted, I compress all special characters from the part number (except . and #) and create a compressed part number. The test for duplicates becomes the supplier code and compressed part number combination. This part is fairly straight forward. Currently, I am just copying the original file with 2 new columns (compressed part and duplicate indicator). If the part is a duplicate, I put a "YES" in the last field. Now that this is done, I want to be able to go back (or better yet, at the same time) to get the previous record where there was a supplier code/compressed part number match. So far, my code looks like this: Compress Full Part to a Compressed Part and Check for Duplicates on Supplier Code and Compressed Part combination import sys import re import time ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ start=time.time() try: file1 = open("C:\Accounting\May Accounting\May.txt", "r") except IOError: print sys.stderr, "Cannot Open Read File" sys.exit(1) try: file2 = open(file1.name[0:len(file1.name)-4] + "_" + "COMPRESSPN.txt", "a") except IOError: print sys.stderr, "Cannot Open Write File" sys.exit(1) hdrList="CIGSUPPLIER|FULL_PART|PART_STATUS|ALIAS_FLAG|ACQUISITION_FLAG|COMPRESSED_PART|DUPLICATE_INDICATOR" file2.write(hdrList+chr(10)) lines_seen=set() affirm="YES" records = file1.readlines() for record in records: fields = record.split(chr(124)) if fields[0]=="CIGSupplier": continue #If incoming file has a header line, skip it file2.write(fields[0]+"|"), #Supplier Code file2.write(fields[1]+"|"), #Full_Part file2.write(fields[2]+"|"), #Part Status file2.write(fields[3]+"|"), #Alias Flag file2.write(re.sub("[$\r\n]", "", fields[4])+"|"), #Acquisition Flag file2.write(re.sub("[^0-9a-zA-Z.#]", "", fields[1])+"|"), #Compressed_Part dupechk=fields[0]+"|"+re.sub("[^0-9a-zA-Z.#]", "", fields[1]) if dupechk not in lines_seen: file2.write(chr(10)) lines_seen.add(dupechk) else: file2.write(affirm+chr(10)) print "it took", time.time() - start, "seconds." ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ file2.close() file1.close() It runs in less than 6 minutes, so I am happy with this part, even if it is not elegant. Right now, when I get my results, I import the results into Access and do a self join to locate the duplicates. Loading/querying/exporting results in Access a file this size takes around an hour, so I would like to be able to export the matched duplicates to another text file or an Excel file. Confusing enough? Thanks.

    Read the article

  • How can I store large amount of data from a database to XML (speed problem, part three)?

    - by Andrija
    After getting some responses, the current situation is that I'm using this tip: http://www.ibm.com/developerworks/xml/library/x-tipbigdoc5.html (Listing 1. Turning ResultSets into XML), and XMLWriter for Java from http://www.megginson.com/downloads/ . Basically, it reads date from the database and writes them to a file as characters, using column names to create opening and closing tags. While doing so, I need to make two changes to the input stream, namely to the dates and numbers. // Iterate over the set while (rs.next()) { w.startElement("row"); for (int i = 0; i < count; i++) { Object ob = rs.getObject(i + 1); if (rs.wasNull()) { ob = null; } String colName = meta.getColumnLabel(i + 1); if (ob != null ) { if (ob instanceof Timestamp) { w.dataElement(colName, Util.formatDate((Timestamp)ob, dateFormat)); } else if (ob instanceof BigDecimal){ w.dataElement(colName, Util.transformToHTML(new Integer(((BigDecimal)ob).intValue()))); } else { w.dataElement(colName, ob.toString()); } } else { w.emptyElement(colName); } } w.endElement("row"); } The SQL that gets the results has the to_number command (e.g. to_number(sif.ID) ID ) and the to_date command (e.g. TO_DATE (sif.datum_do, 'DD.MM.RRRR') datum_do). The problems are that the returning date is a timestamp, meaning I don't get 14.02.2010 but rather 14.02.2010 00:00:000 so I have to format it to the dd.mm.yyyy format. The second problem are the numbers; for some reason, they are in database as varchar2 and can have leading zeroes that need to be stripped; I'm guessing I could do that in my SQL with the trim function so the Util.transformToHTML is unnecessary (for clarification, here's the method): public static String transformToHTML(Integer number) { String result = ""; try { result = number.toString(); } catch (Exception e) {} return result; } What I'd like to know is a) Can I get the date in the format I want and skip additional processing thus shortening the processing time? b) Is there a better way to do this? We're talking about XML files that are in the 50 MB - 250 MB filesize category.

    Read the article

  • Defined variables and arrays vs functions in php

    - by Frank Presencia Fandos
    Introduction I have some sort of values that I might want to access several times each page is loaded. I can take two different approaches for accessing them but I'm not sure which one is 'better'. Three already implemented examples are several options for the Language, URI and displaying text that I describe here: Language Right now it is configured in this way: lang() is a function that returns different values depending on the argument. Example: lang("full") returns the current language, "English", while lang() returns the abbreviation of the current language, "en". There are many more options, like lang("select"), lang("selectact"), etc that return different things. The code is too long and irrelevant for the case so if anyone wants it just ask for it. Url The $Url array also returns different values depending on the request. The whole array is fully defined in the beginning of the page and used to get shorter but accurate links of the current page. Example: $Url['full'] would return "http://mypage.org/path/to/file.php?page=1" and $Url['file'] would return "file.php". It's useful for action="" within the forms and many other things. There are more values for $Url['folder'], $Url['file'], etc. Same thing about the code, if wanted, just request it. Text [You can skip this section] There's another array called $Text that is defined in the same way than $Url. The whole array is defined at the beginning, making a mysql call and defining all $Text[$i] for current page with a while loop. I'm not sure if this is more efficient than multiple calls for a single mysql cell. Example: $Text['54'] returns "This is just a test array!" which this could perfectly be implemented with a function like text(54). Question With the 3 examples you can see that I use different methods to do almost the same function (no pun intended), but I'm not sure which one should become the standard one for my code. I could create a function called url() and other called text() to output what I want. I think that working with functions in those cases is better, but I'm not sure why. So I'd really appreciate your opinions and advice. Should I mix arrays and functions in the way I described or should I just use funcions? Please, base your answer in this: The source needs to be readable and reusable by other developers Resource consumption (processing, time and memory). The shorter the code the better. The more you explain the reasons the better. Thank you PS, now I know the differences between $Url and $Uri.

    Read the article

  • ob_start() -> ob_flush() doesn't work

    - by MB34
    I am using ob_start()/ob_flush() to, hopefully, give me some progress during a long import operation. Here is a simple outline of what I'm doing: <?php ob_start (); echo "Connecting to download Inventory file.<br>"; $conn = ftp_connect($ftp_site) or die("Could not connect"); echo "Logging into site download Inventory file.<br>"; ftp_login($conn,$ftp_username,$ftp_password) or die("Bad login credentials for ". $ftp_site); echo "Changing directory on download Inventory file.<br>"; ftp_chdir($conn,"INV") or die("could not change directory to INV"); // connection, local, remote, type, resume $localname = "INV"."_".date("m")."_".date('d').".csv"; echo "Downloading Inventory file to:".$localname."<br>"; ob_flush(); flush(); sleep(5); if (ftp_get($conn,$localname,"INV.csv",FTP_ASCII)) { echo "New Inventory File Downloaded<br>"; $datapath = $localname; ftp_close($conn); } else { ftp_close($conn); die("There was a problem downloading the Inventory file."); } ob_flush(); flush(); sleep(5); $csvfile = fopen($datapath, "r"); // open csv file $x = 1; // skip the header line $line = fgetcsv($csvfile); $y = (feof($csvfile) ? 2 : 5); while ((!$debug) ? (!feof($csvfile)) : $x <= $y) { $x++; $line = fgetcsv($csvfile); // do a lot of import stuff here with $line ob_flush(); flush(); sleep(1); } fclose($csvfile); // important: close the file ob_end_clean(); However, nothing is being output to the screen at all. I know the data file is getting downloaded because I watch the directory where it is being placed. I also know that the import is happening, meaning that it is in the while loop, because I can monitor the DB and records are being inserted. Any ideas as to why I am not getting output to the screen?

    Read the article

  • How to find same-value rectangular areas of a given size in a matrix most efficiently?

    - by neo
    My problem is very simple but I haven't found an efficient implementation yet. Suppose there is a matrix A like this: 0 0 0 0 0 0 0 4 4 2 2 2 0 0 4 4 2 2 2 0 0 0 0 2 2 2 1 1 0 0 0 0 0 1 1 Now I want to find all starting positions of rectangular areas in this matrix which have a given size. An area is a subset of A where all numbers are the same. Let's say width=2 and height=3. There are 3 areas which have this size: 2 2 2 2 0 0 2 2 2 2 0 0 2 2 2 2 0 0 The result of the function call would be a list of starting positions (x,y starting with 0) of those areas. List((2,1),(3,1),(5,0)) The following is my current implementation. "Areas" are called "surfaces" here. case class Dimension2D(width: Int, height: Int) case class Position2D(x: Int, y: Int) def findFlatSurfaces(matrix: Array[Array[Int]], surfaceSize: Dimension2D): List[Position2D] = { val matrixWidth = matrix.length val matrixHeight = matrix(0).length var resultPositions: List[Position2D] = Nil for (y <- 0 to matrixHeight - surfaceSize.height) { var x = 0 while (x <= matrixWidth - surfaceSize.width) { val topLeft = matrix(x)(y) val topRight = matrix(x + surfaceSize.width - 1)(y) val bottomLeft = matrix(x)(y + surfaceSize.height - 1) val bottomRight = matrix(x + surfaceSize.width - 1)(y + surfaceSize.height - 1) // investigate further if corners are equal if (topLeft == bottomLeft && topLeft == topRight && topLeft == bottomRight) { breakable { for (sx <- x until x + surfaceSize.width; sy <- y until y + surfaceSize.height) { if (matrix(sx)(sy) != topLeft) { x = if (x == sx) sx + 1 else sx break } } // found one! resultPositions ::= Position2D(x, y) x += 1 } } else if (topRight != bottomRight) { // can skip x a bit as there won't be a valid match in current row in this area x += surfaceSize.width } else { x += 1 } } } return resultPositions } I already tried to include some optimizations in it but I am sure that there are far better solutions. Is there a matlab function existing for it which I could port? I'm also wondering whether this problem has its own name as I didn't exactly know what to google for. Thanks for thinking about it! I'm excited to see your proposals or solutions :)

    Read the article

< Previous Page | 57 58 59 60 61 62 63 64 65 66 67 68  | Next Page >