Search Results

Search found 14236 results on 570 pages for 'times square'.

Page 62/570 | < Previous Page | 58 59 60 61 62 63 64 65 66 67 68 69  | Next Page >

  • New Oracle BI Applications released

    - by THE
    Oracle has just released two new Applications for Oracle Business Intelligence Analytics with the Normal 0 21 false false false DE X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} 7.9.6.x Extension Pack: Normal 0 21 false false false DE X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} · Oracle Manufacturing Analytics, part of the Oracle BI Applications product family, helps discrete and process manufacturing organizations optimize their supply networks by integrating data from across the enterprise value chain, thereby enabling executives, operations managers, cost accountants and production supervisors to make informed and actionable decisions related to manufacturing execution. Normal 0 21 false false false DE X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} · Oracle Enterprise Asset Management Analytics, part of the Oracle BI Applications product family, offers complete and enhanced visibility to enterprise-wide maintenance information. Pre-built reports covering Maintenance History, Maintenance Cost Analysis and Maintenance Work Orders, provide Maintenance Managers information to maximize performance, identify potential issues much in advance, and address them before they escalate into serious problems.  More Information about the existing Business Intelligence Analytics Applications can be found on this page: http://www.oracle.com/us/solutions/ent-performance-bi/bi-applications-066544.html If you are not familiar with Oracle Manufacturing or Oracle Enterprise Asset Management, these PDFs might get you started: http://www.oracle.com/us/products/applications/060289.pdf http://www.oracle.com/us/products/applications/057127.pdf

    Read the article

  • Are You a WebCenter Innovator?

    - by Michael Snow
    v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Calling all Oracle WebCenter Innovators: Submit your Nomination for the 2012 Innovation Awards Click here, to submit your nomination today Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman","serif";} Call for Nominations: Oracle Fusion Middleware Innovation Awards 2012 Are you doing something unique and innovative with Oracle Fusion Middleware? Submit a nomination today for the Oracle Fusion Middleware Innovation Awards. Winners receive a free pass to Oracle OpenWorld 2012 in San Francisco (September 30 - October 4th) and will be honored during a special event at OpenWorld. Categories include: Oracle Exalogic Cloud Application Foundation Service Integration (SOA) and BPM WebCenter Identity Management Data Integration Application Development Framework and Fusion Development Business Analytics (BI, EPM and Exalytics) To be considered for this award, complete the Oracle Fusion Middleware Innovation Awards nomination form and send to [email protected]. The deadline to submit a nomination is 5pm Pacific on July 17, 2012.

    Read the article

  • Modern Best Practice in the Cloud with Oracle Accelerate for Midsize Companies

    - by Richard Lefebvre
    v\:* {behavior:url(#default#VML);} o\:* {behavior:url(#default#VML);} w\:* {behavior:url(#default#VML);} .shape {behavior:url(#default#VML);} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 See how a modern approach to best practice, enabled by innovative new technologies, can help you increase business agility and accelerate profitable growth: as the only vendor able to deliver Modern Best Practice, Oracle has a new additional competitive advantage. Here's a simple guide to help you challenge your prospects with this innovative approach. Modern Best Practice Explained: Download now! Discover why disruptive technologies are changing the face of business best practice—and how you can harness modern best practice to achieve more than ever before. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:Calibri; mso-fareast-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

    Read the article

  • Collision 2D Quads

    - by Vico Pelaez
    I want to detect collision between two 2D squares, one square is static and the other one moves according to keyboard arrows. I have implemented some code, however nothing happens when they overlap each other and what I tried to achieve in the code was to detect an overlapping between them. I think I am either not understanding the concept really well or that because one of the squares is moving this is not working. Please I would really appreciate your help. Thank you! float x1=0.05 ,Y1=0.05; float x2=0.05 ,Y2=0.05; float posX1 =0.5, posY1 = 0.5; float movX2 = 0.0 , movY2 = 0.0; struct box{ int width=0.1; int heigth=0.1; }; void init(){ glClearColor(0.0, 0.0, 0.0, 0.0); glColor3f(1.0, 1.0, 1.0); } void quad1(){ glTranslatef(posX1, posY1, 0.0); glBegin(GL_POLYGON); glColor3f(0.5, 1.0, 0.5); glVertex2f(-x1, -Y1); glVertex2f(-x1, Y1); glVertex2f(x1,Y1); glVertex2f(x1,-Y1); glEnd(); } void quad2(){ glMatrixMode(GL_PROJECTION); glLoadIdentity(); glPushMatrix(); glTranslatef(movX2, movY2, 0.0); glBegin(GL_POLYGON); glColor3f(1.5, 1.0, 0.5); glVertex2f(-x2, -Y2); glVertex2f(-x2, Y2); glVertex2f(x2,Y2); glVertex2f(x2,-Y2); glEnd(); glPopMatrix(); } void reset(){ //Reset position of square??? movX2 = 0.0; movY2 = 0.0; collisionB = false; } bool collision(box A, box B){ int leftA, leftB; int rightA, rightB; int topA, topB; int bottomA, bottomB; //Calculate the sides of box A leftA = x1; rightA = x1 + A.width; topA = Y1; bottomA = Y1 + A.heigth; //Calculate the sides of box B leftB = x2; rightB = x2 + B.width; topB = Y1; bottomB = Y1+ B.heigth ; if( bottomA <= topB ) return false; if( topA >= bottomB ) return false; if( rightA <= leftB ) return false; if( leftA >= rightB ) return false; return true; } float move_unit = 0.1; void keyboardown(int key, int x, int y) { switch (key){ case GLUT_KEY_UP: movY2 += move_unit; break; case GLUT_KEY_RIGHT: movX2 += move_unit; break; case GLUT_KEY_LEFT: movX2 -= move_unit; break; case GLUT_KEY_DOWN: movY2 -= move_unit; break; default: break; } glutPostRedisplay(); } void display(){ glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT); glMatrixMode(GL_PROJECTION); glLoadIdentity(); cuad1(); if (!collision) { cuad2(); } else{ reset(); } glFlush(); } int main(int argc, char** argv){ glutInit(&argc, argv); glutInitDisplayMode(GLUT_SINGLE | GLUT_RGB); glutInitWindowSize(500,500); glutInitWindowPosition(0, 0); glutCreateWindow("Collision Practice"); glutSpecialFunc(keyboardown); glutDisplayFunc(display); init(); glutMainLoop(); }

    Read the article

  • Introducing the Earthquake Locator – A Bing Maps Silverlight Application, part 1

    - by Bobby Diaz
    Update: Live demo and source code now available!  The recent wave of earthquakes (no pun intended) being reported in the news got me wondering about the frequency and severity of earthquakes around the world. Since I’ve been doing a lot of Silverlight development lately, I decided to scratch my curiosity with a nice little Bing Maps application that will show the location and relative strength of recent seismic activity. Here is a list of technologies this application will utilize, so be sure to have everything downloaded and installed if you plan on following along. Silverlight 3 WCF RIA Services Bing Maps Silverlight Control * Managed Extensibility Framework (optional) MVVM Light Toolkit (optional) log4net (optional) * If you are new to Bing Maps or have not signed up for a Developer Account, you will need to visit www.bingmapsportal.com to request a Bing Maps key for your application. Getting Started We start out by creating a new Silverlight Application called EarthquakeLocator and specify that we want to automatically create the Web Application Project with RIA Services enabled. I cleaned up the web app by removing the Default.aspx and EarthquakeLocatorTestPage.html. Then I renamed the EarthquakeLocatorTestPage.aspx to Default.aspx and set it as my start page. I also set the development server to use a specific port, as shown below. RIA Services Next, I created a Services folder in the EarthquakeLocator.Web project and added a new Domain Service Class called EarthquakeService.cs. This is the RIA Services Domain Service that will provide earthquake data for our client application. I am not using LINQ to SQL or Entity Framework, so I will use the <empty domain service class> option. We will be pulling data from an external Atom feed, but this example could just as easily pull data from a database or another web service. This is an important distinction to point out because each scenario I just mentioned could potentially use a different Domain Service base class (i.e. LinqToSqlDomainService<TDataContext>). Now we can start adding Query methods to our EarthquakeService that pull data from the USGS web site. Here is the complete code for our service class: using System; using System.Collections.Generic; using System.IO; using System.Linq; using System.ServiceModel.Syndication; using System.Web.DomainServices; using System.Web.Ria; using System.Xml; using log4net; using EarthquakeLocator.Web.Model;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// Provides earthquake data to client applications.     /// </summary>     [EnableClientAccess()]     public class EarthquakeService : DomainService     {         private static readonly ILog log = LogManager.GetLogger(typeof(EarthquakeService));           // USGS Data Feeds: http://earthquake.usgs.gov/earthquakes/catalogs/         private const string FeedForPreviousDay =             "http://earthquake.usgs.gov/earthquakes/catalogs/1day-M2.5.xml";         private const string FeedForPreviousWeek =             "http://earthquake.usgs.gov/earthquakes/catalogs/7day-M2.5.xml";           /// <summary>         /// Gets the earthquake data for the previous week.         /// </summary>         /// <returns>A queryable collection of <see cref="Earthquake"/> objects.</returns>         public IQueryable<Earthquake> GetEarthquakes()         {             var feed = GetFeed(FeedForPreviousWeek);             var list = new List<Earthquake>();               if ( feed != null )             {                 foreach ( var entry in feed.Items )                 {                     var quake = CreateEarthquake(entry);                     if ( quake != null )                     {                         list.Add(quake);                     }                 }             }               return list.AsQueryable();         }           /// <summary>         /// Creates an <see cref="Earthquake"/> object for each entry in the Atom feed.         /// </summary>         /// <param name="entry">The Atom entry.</param>         /// <returns></returns>         private Earthquake CreateEarthquake(SyndicationItem entry)         {             Earthquake quake = null;             string title = entry.Title.Text;             string summary = entry.Summary.Text;             string point = GetElementValue<String>(entry, "point");             string depth = GetElementValue<String>(entry, "elev");             string utcTime = null;             string localTime = null;             string depthDesc = null;             double? magnitude = null;             double? latitude = null;             double? longitude = null;             double? depthKm = null;               if ( !String.IsNullOrEmpty(title) && title.StartsWith("M") )             {                 title = title.Substring(2, title.IndexOf(',')-3).Trim();                 magnitude = TryParse(title);             }             if ( !String.IsNullOrEmpty(point) )             {                 var values = point.Split(' ');                 if ( values.Length == 2 )                 {                     latitude = TryParse(values[0]);                     longitude = TryParse(values[1]);                 }             }             if ( !String.IsNullOrEmpty(depth) )             {                 depthKm = TryParse(depth);                 if ( depthKm != null )                 {                     depthKm = Math.Round((-1 * depthKm.Value) / 100, 2);                 }             }             if ( !String.IsNullOrEmpty(summary) )             {                 summary = summary.Replace("</p>", "");                 var values = summary.Split(                     new string[] { "<p>" },                     StringSplitOptions.RemoveEmptyEntries);                   if ( values.Length == 3 )                 {                     var times = values[1].Split(                         new string[] { "<br>" },                         StringSplitOptions.RemoveEmptyEntries);                       if ( times.Length > 0 )                     {                         utcTime = times[0];                     }                     if ( times.Length > 1 )                     {                         localTime = times[1];                     }                       depthDesc = values[2];                     depthDesc = "Depth: " + depthDesc.Substring(depthDesc.IndexOf(":") + 2);                 }             }               if ( latitude != null && longitude != null )             {                 quake = new Earthquake()                 {                     Id = entry.Id,                     Title = entry.Title.Text,                     Summary = entry.Summary.Text,                     Date = entry.LastUpdatedTime.DateTime,                     Url = entry.Links.Select(l => Path.Combine(l.BaseUri.OriginalString,                         l.Uri.OriginalString)).FirstOrDefault(),                     Age = entry.Categories.Where(c => c.Label == "Age")                         .Select(c => c.Name).FirstOrDefault(),                     Magnitude = magnitude.GetValueOrDefault(),                     Latitude = latitude.GetValueOrDefault(),                     Longitude = longitude.GetValueOrDefault(),                     DepthInKm = depthKm.GetValueOrDefault(),                     DepthDesc = depthDesc,                     UtcTime = utcTime,                     LocalTime = localTime                 };             }               return quake;         }           private T GetElementValue<T>(SyndicationItem entry, String name)         {             var el = entry.ElementExtensions.Where(e => e.OuterName == name).FirstOrDefault();             T value = default(T);               if ( el != null )             {                 value = el.GetObject<T>();             }               return value;         }           private double? TryParse(String value)         {             double d;             if ( Double.TryParse(value, out d) )             {                 return d;             }             return null;         }           /// <summary>         /// Gets the feed at the specified URL.         /// </summary>         /// <param name="url">The URL.</param>         /// <returns>A <see cref="SyndicationFeed"/> object.</returns>         public static SyndicationFeed GetFeed(String url)         {             SyndicationFeed feed = null;               try             {                 log.Debug("Loading RSS feed: " + url);                   using ( var reader = XmlReader.Create(url) )                 {                     feed = SyndicationFeed.Load(reader);                 }             }             catch ( Exception ex )             {                 log.Error("Error occurred while loading RSS feed: " + url, ex);             }               return feed;         }     } }   The only method that will be generated in the client side proxy class, EarthquakeContext, will be the GetEarthquakes() method. The reason being that it is the only public instance method and it returns an IQueryable<Earthquake> collection that can be consumed by the client application. GetEarthquakes() calls the static GetFeed(String) method, which utilizes the built in SyndicationFeed API to load the external data feed. You will need to add a reference to the System.ServiceModel.Web library in order to take advantage of the RSS/Atom reader. The API will also allow you to create your own feeds to serve up in your applications. Model I have also created a Model folder and added a new class, Earthquake.cs. The Earthquake object will hold the various properties returned from the Atom feed. Here is a sample of the code for that class. Notice the [Key] attribute on the Id property, which is required by RIA Services to uniquely identify the entity. using System; using System.Collections.Generic; using System.Linq; using System.Runtime.Serialization; using System.ComponentModel.DataAnnotations;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     [DataContract]     public class Earthquake     {         /// <summary>         /// Gets or sets the id.         /// </summary>         /// <value>The id.</value>         [Key]         [DataMember]         public string Id { get; set; }           /// <summary>         /// Gets or sets the title.         /// </summary>         /// <value>The title.</value>         [DataMember]         public string Title { get; set; }           /// <summary>         /// Gets or sets the summary.         /// </summary>         /// <value>The summary.</value>         [DataMember]         public string Summary { get; set; }           // additional properties omitted     } }   View Model The recent trend to use the MVVM pattern for WPF and Silverlight provides a great way to separate the data and behavior logic out of the user interface layer of your client applications. I have chosen to use the MVVM Light Toolkit for the Earthquake Locator, but there are other options out there if you prefer another library. That said, I went ahead and created a ViewModel folder in the Silverlight project and added a EarthquakeViewModel class that derives from ViewModelBase. Here is the code: using System; using System.Collections.ObjectModel; using System.ComponentModel.Composition; using System.ComponentModel.Composition.Hosting; using Microsoft.Maps.MapControl; using GalaSoft.MvvmLight; using EarthquakeLocator.Web.Model; using EarthquakeLocator.Web.Services;   namespace EarthquakeLocator.ViewModel {     /// <summary>     /// Provides data for views displaying earthquake information.     /// </summary>     public class EarthquakeViewModel : ViewModelBase     {         [Import]         public EarthquakeContext Context;           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         public EarthquakeViewModel()         {             var catalog = new AssemblyCatalog(GetType().Assembly);             var container = new CompositionContainer(catalog);             container.ComposeParts(this);             Initialize();         }           /// <summary>         /// Initializes a new instance of the <see cref="EarthquakeViewModel"/> class.         /// </summary>         /// <param name="context">The context.</param>         public EarthquakeViewModel(EarthquakeContext context)         {             Context = context;             Initialize();         }           private void Initialize()         {             MapCenter = new Location(20, -170);             ZoomLevel = 2;         }           #region Private Methods           private void OnAutoLoadDataChanged()         {             LoadEarthquakes();         }           private void LoadEarthquakes()         {             var query = Context.GetEarthquakesQuery();             Context.Earthquakes.Clear();               Context.Load(query, (op) =>             {                 if ( !op.HasError )                 {                     foreach ( var item in op.Entities )                     {                         Earthquakes.Add(item);                     }                 }             }, null);         }           #endregion Private Methods           #region Properties           private bool autoLoadData;         /// <summary>         /// Gets or sets a value indicating whether to auto load data.         /// </summary>         /// <value><c>true</c> if auto loading data; otherwise, <c>false</c>.</value>         public bool AutoLoadData         {             get { return autoLoadData; }             set             {                 if ( autoLoadData != value )                 {                     autoLoadData = value;                     RaisePropertyChanged("AutoLoadData");                     OnAutoLoadDataChanged();                 }             }         }           private ObservableCollection<Earthquake> earthquakes;         /// <summary>         /// Gets the collection of earthquakes to display.         /// </summary>         /// <value>The collection of earthquakes.</value>         public ObservableCollection<Earthquake> Earthquakes         {             get             {                 if ( earthquakes == null )                 {                     earthquakes = new ObservableCollection<Earthquake>();                 }                   return earthquakes;             }         }           private Location mapCenter;         /// <summary>         /// Gets or sets the map center.         /// </summary>         /// <value>The map center.</value>         public Location MapCenter         {             get { return mapCenter; }             set             {                 if ( mapCenter != value )                 {                     mapCenter = value;                     RaisePropertyChanged("MapCenter");                 }             }         }           private double zoomLevel;         /// <summary>         /// Gets or sets the zoom level.         /// </summary>         /// <value>The zoom level.</value>         public double ZoomLevel         {             get { return zoomLevel; }             set             {                 if ( zoomLevel != value )                 {                     zoomLevel = value;                     RaisePropertyChanged("ZoomLevel");                 }             }         }           #endregion Properties     } }   The EarthquakeViewModel class contains all of the properties that will be bound to by the various controls in our views. Be sure to read through the LoadEarthquakes() method, which handles calling the GetEarthquakes() method in our EarthquakeService via the EarthquakeContext proxy, and also transfers the loaded entities into the view model’s Earthquakes collection. Another thing to notice is what’s going on in the default constructor. I chose to use the Managed Extensibility Framework (MEF) for my composition needs, but you can use any dependency injection library or none at all. To allow the EarthquakeContext class to be discoverable by MEF, I added the following partial class so that I could supply the appropriate [Export] attribute: using System; using System.ComponentModel.Composition;   namespace EarthquakeLocator.Web.Services {     /// <summary>     /// The client side proxy for the EarthquakeService class.     /// </summary>     [Export]     public partial class EarthquakeContext     {     } }   One last piece I wanted to point out before moving on to the user interface, I added a client side partial class for the Earthquake entity that contains helper properties that we will bind to later: using System;   namespace EarthquakeLocator.Web.Model {     /// <summary>     /// Represents an earthquake occurrence and related information.     /// </summary>     public partial class Earthquake     {         /// <summary>         /// Gets the location based on the current Latitude/Longitude.         /// </summary>         /// <value>The location.</value>         public string Location         {             get { return String.Format("{0},{1}", Latitude, Longitude); }         }           /// <summary>         /// Gets the size based on the Magnitude.         /// </summary>         /// <value>The size.</value>         public double Size         {             get { return (Magnitude * 3); }         }     } }   View Now the fun part! Usually, I would create a Views folder to place all of my View controls in, but I took the easy way out and added the following XAML code to the default MainPage.xaml file. Be sure to add the bing prefix associating the Microsoft.Maps.MapControl namespace after adding the assembly reference to your project. The MVVM Light Toolkit project templates come with a ViewModelLocator class that you can use via a static resource, but I am instantiating the EarthquakeViewModel directly in my user control. I am setting the AutoLoadData property to true as a way to trigger the LoadEarthquakes() method call. The MapItemsControl found within the <bing:Map> control binds its ItemsSource property to the Earthquakes collection of the view model, and since it is an ObservableCollection<T>, we get the automatic two way data binding via the INotifyCollectionChanged interface. <UserControl x:Class="EarthquakeLocator.MainPage"     xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation"     xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml"     xmlns:d="http://schemas.microsoft.com/expression/blend/2008"     xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006"     xmlns:bing="clr-namespace:Microsoft.Maps.MapControl;assembly=Microsoft.Maps.MapControl"     xmlns:vm="clr-namespace:EarthquakeLocator.ViewModel"     mc:Ignorable="d" d:DesignWidth="640" d:DesignHeight="480" >     <UserControl.Resources>         <DataTemplate x:Key="EarthquakeTemplate">             <Ellipse Fill="Red" Stroke="Black" StrokeThickness="1"                      Width="{Binding Size}" Height="{Binding Size}"                      bing:MapLayer.Position="{Binding Location}"                      bing:MapLayer.PositionOrigin="Center">                 <ToolTipService.ToolTip>                     <StackPanel>                         <TextBlock Text="{Binding Title}" FontSize="14" FontWeight="Bold" />                         <TextBlock Text="{Binding UtcTime}" />                         <TextBlock Text="{Binding LocalTime}" />                         <TextBlock Text="{Binding DepthDesc}" />                     </StackPanel>                 </ToolTipService.ToolTip>             </Ellipse>         </DataTemplate>     </UserControl.Resources>       <UserControl.DataContext>         <vm:EarthquakeViewModel AutoLoadData="True" />     </UserControl.DataContext>       <Grid x:Name="LayoutRoot">           <bing:Map x:Name="map" CredentialsProvider="--Your-Bing-Maps-Key--"                   Center="{Binding MapCenter, Mode=TwoWay}"                   ZoomLevel="{Binding ZoomLevel, Mode=TwoWay}">             <bing:MapItemsControl ItemsSource="{Binding Earthquakes}"                                   ItemTemplate="{StaticResource EarthquakeTemplate}" />         </bing:Map>       </Grid> </UserControl>   The EarthquakeTemplate defines the Ellipse that will represent each earthquake, the Width and Height that are determined by the Magnitude, the Position on the map, and also the tooltip that will appear when we mouse over each data point. Running the application will give us the following result (shown with a tooltip example): That concludes this portion of our show but I plan on implementing additional functionality in later blog posts. Be sure to come back soon to see the next installments in this series. Enjoy!   Additional Resources USGS Earthquake Data Feeds Brad Abrams shows how RIA Services and MVVM can work together

    Read the article

  • Sql Query - Limiting query results

    - by Gublooo
    I am quite certain we cannot use the LIMIT clause for what I want to do - so wanted to find if there are any other ways we can accomplish this. I have a table which captures which user visited which store. Every time a user visits a store, a row is inserted into this table. Some of the fields are shopping_id (primary key) store_id user_id Now what I want is - for a given set of stores, find the top 5 users who have visited the store max number of times. I can do this 1 store at a time as: select store_id,user_id,count(1) as visits from shopping where store_id = 60 group by user_id,store_id order by visits desc Limit 5 This will give me the 5 users who have visited store_id=60 the max times What I want to do is provide a list of 10 store_ids and for each store fetch the 5 users who have visited that store max times select store_id,user_id,count(1) as visits from shopping where store_id in (60,61,62,63,64,65,66) group by user_id,store_id order by visits desc Limit 5 This will not work as the Limit at the end will return only 5 rows rather than 5 rows for each store. Any ideas on how I can achieve this. I can always write a loop and pass 1 store at a time but wanted to know if there is a better way

    Read the article

  • UIImagePickerController dismissModalViewController

    - by Deepak Sharma
    I am trying to invoke UIImagePickerController to select a movie on iPhone 3GS and when the movie is selected, i just dismiss it and present MyViewController modally with a configured delay of 1.0 seconds. What I notice is 10% of the times, presentModalViewController on MyViewController does nothing whereas it works 90% of the times. I want to understand why is this behavior and what is the remedy. Here is the sample code: (void)imagePickerController:(UIImagePickerController *)picker didFinishPickingMediaWithInfo:(NSDictionary *)info { NSURL *videoURL = nil; NSString *mediaType = [info objectForKey:UIImagePickerControllerMediaType]; if ([mediaType isEqualToString:@"public.movie"]) { videoURL = [info objectForKey:UIImagePickerControllerMediaURL]; } picker.delegate = nil; [[picker parentViewController] dismissModalViewControllerAnimated:YES]; [self performSelector:@selector(launchMyViewController:) withObject:nil afterDelay:1.0]; } -(void) launchMyViewController:(id) obj { MyViewController *myCtrl = [[MyViewController alloc] initWithNibName:@"MyViewController" bundle:[NSBundle mainBundle] controller:self]; [self presentModalViewController:myCtrl animated:YES]; [myCtrl release]; NSLog(NSStringFromClass([self.modalViewController class])); [path release]; } I have put NSLog statement to print the self.modalViewController class name and what I notice is that 10% of the times when myCtrl is not fired modally, the self.modalViewController.class is UIImagePickerController. Otherwise, the self.modalViewController.class is MyViewController. I want to know why is the behavior so unpredictable and what is the workaround or other way to achieve the same thing I intend.

    Read the article

  • Android Live Wallpaper: waitForCondition(ReallocateCondition)

    - by jstatz
    I've been developing a live wallpaper using GLWallpaperService, and have gotten good results overall. It runs rock-solid in the emulator and looks good. I've dealt with OpenGL many times before so have a solid command of how to do things... unfortunately I'm having a hell of a time getting this to actually be stable on the actual hardware. The basic symption occurs when you slide the physical keyboard on a Motorola Droid in and out a few times. This causes the wallpaper to get destroyed/recreated several times in quick succession -- which would be fine, as I have my assets clearing in onDestroy and reloading in onSurfaceChanged. The problem is after a few iterations of this, (four or five, maybe) the calls to onSurfaceChanged completely stop, and i get an endless string of this printed to the log: 04-02 00:53:18.088: WARN/SharedBufferStack(1032): waitForCondition(ReallocateCondition) timed out (identity=337, status=0). CPU may be pegged. trying again. Is there something I should be implementing here aside from the Android-typical onSurfaceCreated/onSurfaceChanged/onSurfaceDestroyed triumvirate? Browsing through the WallpaperService and WallpaperRenderer classes doesn't pop up anything obvious to me.

    Read the article

  • JavaScript variable to ColdFusion variable

    - by Alexander
    I have a tricky one. By means of a <cfoutput query="…"> I list some records in the page from a SQL Server database. By the end of each line viewing I try to add this in to a record in a MySQL database. As you see is simple, because I can use the exact variables from the output query in to my new INSERT INTO statement. BUT: the rsPick.name comes from a database with a different character set and the only way to get it right into my new database is to read it from the web page and not from the value came in the output query. So I read this value with that little JavaScript I made and put it in the myValue variable and then I want ColdFusion to read that variable in order to place it in my SQL statement. <cfoutput query="rsPick"> <tr> <td>#rsPick.ABBREVIATION#</td> <td id="square"> #rsPick.name# </td> <td>#rsPick.Composition#</td> <td> Transaction done... <script type="text/javascript"> var myvalue = document.getElementById("square").innerHTML </script> </td> <cfquery datasource="#Request.Order#"> INSERT INTO products (iniid, abbreviation, clsid, cllid, dfsid, dflid, szsid, szlid, gross, retail, netvaluebc, composition, name) VALUES ( #rsPick.ID#, '#rsPick.ABBREVIATION#', #rsPick.CLSID#, #rsPick.CLLID#, #rsPick.DFSID#, #rsPick.DFLID#, #rsPick.SZSID#, #rsPick.SZLID#, #rsPick.GROSSPRICE#, #rsPick.RETAILPRICE#, #rsPick.NETVALUEBC#, '#rsPick.COMPOSITION#','#MYVALUE#' ) </cfquery> </tr> </cfoutput>

    Read the article

  • JVM CMS Garbage Collecting Issues

    - by jlintz
    I'm seeing the following symptoms on an application's GC log file with the Concurrent Mark-Sweep collector: 4031.248: [CMS-concurrent-preclean-start] 4031.250: [CMS-concurrent-preclean: 0.002/0.002 secs] [Times: user=0.00 sys=0.00, real=0.00 secs] 4031.250: [CMS-concurrent-abortable-preclean-start] CMS: abort preclean due to time 4036.346: [CMS-concurrent-abortable-preclean: 0.159/5.096 secs] [Times: user=0.00 sys=0.01, real=5.09 secs] 4036.346: [GC[YG occupancy: 55964 K (118016 K)]4036.347: [Rescan (parallel) , 0.0641200 secs]4036.411: [weak refs processing, 0.0001300 secs]4036.411: [class unloading, 0.0041590 secs]4036.415: [scrub symbol & string tables, 0.0053220 secs] [1 CMS-remark: 16015K(393216K)] 71979K(511232K), 0.0746640 secs] [Times: user=0.08 sys=0.00, real=0.08 secs] The preclean process keeps aborting continously. I've tried adjusting CMSMaxAbortablePrecleanTime to 15 seconds, from the default of 5, but that has not helped. The current JVM options are as follows... Djava.awt.headless=true -Xms512m -Xmx512m -Xmn128m -XX:MaxPermSize=128m -XX:+HeapDumpOnOutOfMemoryError -XX:+UseParNewGC -XX:+UseConcMarkSweepGC -XX:BiasedLockingStartupDelay=0 -XX:+DoEscapeAnalysis -XX:+UseBiasedLocking -XX:+EliminateLocks -XX:+CMSParallelRemarkEnabled -verbose:gc -XX:+PrintGCTimeStamps -XX:+PrintGCDetails -XX:+PrintHeapAtGC -Xloggc:gc.log -XX:+CMSClassUnloadingEnabled -XX:+CMSPermGenPrecleaningEnabled -XX:CMSInitiatingOccupancyFraction=50 -XX:ReservedCodeCacheSize=64m -Dnetworkaddress.cache.ttl=30 -Xss128k It appears the concurrent-abortable-preclean never gets a chance to run. I read through http://blogs.sun.com/jonthecollector/entry/did_you_know which had a suggestion of enabling CMSScavengeBeforeRemark, but the side effects of pausing did not seem ideal. Could anyone offer up any suggestions? Also I was wondering if anyone had a good reference for grokking the CMS GC logs, in particular this line: [1 CMS-remark: 16015K(393216K)] 71979K(511232K), 0.0746640 secs] Not clear on what memory regions those numbers are referring to.

    Read the article

  • Android layout with sqare buttons

    - by Mannaz
    I want to make a layout similar to this one: Four square buttons on the screen - each of those using half of the screen with/screen height (whichever is smaler). I already tried to achieve this by using a LinearLayoutbut the buttons are ending up using the correct width, but still having the height of the background (not square any more). <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:orientation="vertical" android:layout_width="fill_parent" android:layout_height="fill_parent"> <LinearLayout android:layout_width="fill_parent" android:layout_height="wrap_content"> <Button android:layout_height="wrap_content" style="@style/CKMainButton" android:layout_width="fill_parent" android:text="@string/sights" android:id="@+id/ApplicationMainSight" android:layout_toLeftOf="@+id/ApplicationMainEvent"></Button> <Button android:layout_height="wrap_content" style="@style/CKMainButton" android:layout_width="fill_parent" android:text="@string/sights" android:id="@+id/ApplicationMainSight" android:layout_toLeftOf="@+id/ApplicationMainEvent"></Button> </LinearLayout> <LinearLayout android:layout_width="fill_parent" android:layout_height="wrap_content"> <Button android:layout_height="wrap_content" style="@style/CKMainButton" android:layout_weight="1" android:layout_width="fill_parent" android:text="@string/usergenerated" android:id="@+id/ApplicationMainUserGenerated"></Button> <Button android:layout_height="wrap_content" style="@style/CKMainButton" android:layout_weight="1" android:layout_width="fill_parent" android:text="@string/tours" android:id="@+id/ApplicationMainTour"></Button> </LinearLayout> </LinearLayout> It's looking like this: How can i acchieve the Layout to look like the image above?

    Read the article

  • drawing different quartz 2d

    - by Cosizzle
    Hello, I'm trying to make a small application or demo thats a tab bar application. Each bar item loads in a new view. I've created a quartzView class that is called on by the controller: - (void)viewDidLoad { quartzView *drawingView = [[quartzView alloc] initWithFrame:CGRectMake(0,0,320,480)]; [self.view addSubview:drawingView]; [super viewDidLoad]; } From my understanding, the drawRect method must be triggered in order to render the object and to draw it. This is my quartzView class: #import "quartzView.h" @implementation quartzView #pragma mark shapes // Blue Circle - (void)drawRect:(CGRect)rect { NSLog(@"Trying to draw..."); CGContextRef ctx = UIGraphicsGetCurrentContext(); //get the current context CGContextClearRect(ctx, rect); //clear off the screen //draw a red square CGContextSetRGBFillColor(ctx, 255, 0, 0, 1); CGContextFillRect(ctx, CGRectMake(10, 10, 50, 50)); } // ==================================================================================================== #pragma mark - - (id)initWithFrame:(CGRect)frame { if (self = [super initWithFrame:frame]) { // Initialization code } return self; } - (void)dealloc { [super dealloc]; } @end So how would I go about to say, if the view is view one, draw a square if it's view two draw a circle. And so on.

    Read the article

  • Choosing random numbers efficiently

    - by Frederik Wordenskjold
    I have a method, which uses random samples to approximate a calculation. This method is called millions of times, so its very important that the process of choosing the random numbers is efficient. I'm not sure how fast javas Random().nextInt really are, but my program does not seem to benefit as much as I would like it too. When choosing the random numbers, I do the following (in semi pseudo-code): // Repeat this 300000 times Set set = new Set(); while(set.length != 5) set.add(randomNumber(MIN,MAX)); Now, this obviously has a bad worst-case running time, as the random-function in theory can add duplicated numbers for an eternity, thus staying in the while-loop forever. However, the numbers are chosen from {0..45}, so a duplicated value is for the most part unlikely. When I use the above method, its only 40% faster than my other method, which does not approximate, but yields the correct result. This is ran ~ 1 million times, so I was expecting this new method to be at least 50% faster. Do you have any suggestions for a faster method? Or maybe you know of a more efficient way of generation a set of random numbers.

    Read the article

  • Background image in a JFrame.

    - by thepandaatemyface
    Hi, This question has been asked a lot but everywhere the answers fall short. I can get a JFrame to display a background image just fine by extending JPanel and overriding paintComponent, like so: class BackgroundPanel extends JPanel { private ImageIcon imageIcon; public BackgroundPanel() { this.imageIcon = Icons.getIcon("foo"); } @Override protected void paintComponent(Graphics g) { super.paintComponent(g); g.drawImage(imageIcon.getImage(), 0,0,imageIcon.getIconWidth(),imageIcon.getIconHeight(),this); } } But now, how do you add a component on top of that background? When I go JFrame w = new JFrame() ; Container cp = w.getContentPane(); cp.setLayout(null); BackgroundPanel bg = new BackgroundPanel(); cp.add(bg); JPanel b = new JPanel(); b.setSize(new Dimension(30, 40)); b.setBackground(Color.red); cp.add(b); w.pack() w.setVisible(true) It shows the little red square (or any other component) and not the background, but when I remove cp.setLayout(null);, the background shows up but not my other component. I'm guessing this has something to do with the paintComponent not being called by the null LayoutManager, but I'm not at all familiar with how LayoutManagers work (this is a project for college and the assignment specifically says not to use a LayoutManager) When i make the image the background has to display null (and so, transparant (??)) the red square shows up so it might be that the background is actually above my other components) Does anyone anyone have any ideas? Thanks

    Read the article

  • Convert text files to excel files using python

    - by Rahim Jaafar
    I am working on INFORMIX 4GL programs. That programs produce output text files.This is an example of the output: Lot No|Purchaser name|Billing|Payment|Deposit|Balance| J1006|JAUHARI BIN HAMIDI|5285.05|4923.25|0.00|361.80| J1007|LEE, CHIA-JUI AKA LEE, ANDREW J. R.|5366.15|5313.70|0.00|52.45| J1008|NAZRIN ANEEZA BINTI NAZARUDDIN|5669.55|5365.30|0.00|304.25| J1009|YAZID LUTFI BIN AHMAD LUTFI|3180.05|3022.30|0.00|157.75| This text files can manually convert to excel files.But, I wanna ask, is there any script that I can use to convert .txt files to .xls files ? Hi all,now I'm already can convert text files to excell file by python using script that was given from user named Rami Helmy.A big thanks for him.But now,That script will produce more than one excell files depends on the number of '|' from the text files.Beside that,That script also can only convert one text files.I a going to convert all text files without state the name of text files.Therefore,I am looking such a way on how to this script going to: output only one excell file convert all .txt files from the directory that was given from user. output excell's file name are automaticly copied from the file name of text files. I am new in python,hopefully someone can help me to solve my problems.Thank You.. done all the task,but there was something that I'm confused.. that output excell files contains an "square" symbol like this: then, how can I ensure that there is no square symbol like that after I convert from text files to excell? thank you...

    Read the article

  • Two strange efficiency problems in Mathematica

    - by Jess Riedel
    FIRST PROBLEM I have timed how long it takes to compute the following statements (where V[x] is a time-intensive function call): Alice = Table[V[i],{i,1,300},{1000}]; Bob = Table[Table[V[i],{i,1,300}],{1000}]^tr; Chris_pre = Table[V[i],{i,1,300}]; Chris = Table[Chris_pre,{1000}]^tr; Alice, Bob, and Chris are identical matricies computed 3 slightly different ways. I find that Chris is computed 1000 times faster than Alice and Bob. It is not surprising that Alice is computed 1000 times slower because, naively, the function V must be called 1000 more times than when Chris is computed. But it is very surprising that Bob is so slow, since he is computed identically to Chris except that Chris stores the intermediate step Chris_pre. Why does Bob evaluate so slowly? SECOND PROBLEM Suppose I want to compile a function in Mathematica of the form f(x)=x+y where "y" is a constant fixed at compile time (but which I prefer not to directly replace in the code with its numerical because I want to be able to easily change it). If y's actual value is y=7.3, and I define f1=Compile[{x},x+y] f2=Compile[{x},x+7.3] then f1 runs 50% slower than f2. How do I make Mathematica replace "y" with "7.3" when f1 is compiled, so that f1 runs as fast as f2? Many thanks!

    Read the article

  • Collision detection of huge number of circles

    - by Tomek Tarczynski
    What is the best way to check collision of huge number of circles? It's very easy to detect collision between two circles, but if we check every combination then it is O(n^2) which definitely not an optimal solution. We can assume that circle object has following properties: -Coordinates -Radius -Velocity -Direction Velocity is constant, but direction can change. I've come up with two solutions, but maybe there are some better solutions. Solution 1 Divide whole space into overlapping squares and check for collision only with circles that are in the same square. Squares needs to overlap so there won't be a problem when circle moves from one square to another. Solution 2 At the beginning distances between every pair of circles need to be calculated. If the distance is small then these pair is stored in some list, and we need to check for collision in every update. If the distance is big then we store after which update there can be a collision (it can be calculated because we know the distance and velocitites). It needs to be stored in some kind of priority queue. After previously calculated number of updates distance needs to be checked again and then we do the same procedure - put it on the list or again in the priority queue.

    Read the article

  • page wide bread crumb bar as at apple.com/store

    - by punkish
    I want to build a (don't know what to call it other than) bread crumb bar at the top of the page, kinda like at http://store.apple.com/us/browse/home/shop_mac/software, y'know, at the top of the page, the horizontal, light grey bar that looks like so [home icon] | Shop Mac | Mac Software Help | Account | Cart Actually, I've got that bar working, with a curved, square left edge, the intermediate chevrons, and the curved, square right edge. So, my bar looks like so [ Home > Foo > Bar > Baz ] I have little graphics fragments that make up the [ and the and the ] and the middle parts. The only problem is, I want the right edge to be at the right edge of my page. So, the above bar should look like so [ Home > Foo > Bar > Baz ] I want to have a variable number of entries in my bread crumb bar... so, I could have "Home, Foo, Bar, Baz" or I could have "Home, Foo" or "Home, Foo, Bar, Baz, Qux" and so on. In other words, I want the right edge of my bar to be dynamically long enough to extend to the edge of my web page. Suggestions?

    Read the article

  • Simple Select Statement on MySQL Database Hanging

    - by AlishahNovin
    I have a very simple sql select statement on a very large table, that is non-normalized. (Not my design at all, I'm just trying to optimize while simultaneously trying to convince the owners of a redesign) Basically, the statement is like this: SELECT FirstName, LastName, FullName, State FROM Activity Where (FirstName=@name OR LastName=@name OR FullName=@name) AND State=@state; Now, FirstName, LastName, FullName and State are all indexed as BTrees, but without prefix - the whole column is indexed. State column is a 2 letter state code. What I'm finding is this: When @name = 'John Smith', and @state = '%' the search is really fast and yields results immediately. When @name = 'John Smith', and @state = 'FL' the search takes 5 minutes (and usually this means the web service times out...) When I remove the FirstName and LastName comparisons, and only use the FullName and State, both cases above work very quickly. When I replace FirstName, LastName, FullName, and State searches, but use LIKE for each search, it works fast for @name='John Smith%' and @state='%', but slow for @name='John Smith%' and @state='FL' When I search against 'John Sm%' and @state='FL' the search finds results immediately When I search against 'John Smi%' and @state='FL' the search takes 5 minutes. Now, just to reiterate - the table is not normalized. The John Smith appears many many times, as do many other users, because there is no reference to some form of users/people table. I'm not sure how many times a single user may appear, but the table itself has 90 Million records. Again, not my design... What I'm wondering is - though there are many many problems with this design, what is causing this specific problem. My guess is that the index trees are just too large that it just takes a very long time traversing the them. (FirstName, LastName, FullName) Anyway, I appreciate anyone's help with this. Like I said, I'm working on convincing them of a redesign, but in the meantime, if I someone could help me figure out what the exact problem is, that'd be fantastic.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Javascript redeclared global variable overrides old value

    - by Yousuf Haider
    I ran into an interesting issue the other day and was wondering if someone could shed light on why this is happening. Here is what I am doing (for the purposes of this example I have dumbed down the example somewhat): I am creating a globally scoped variable using the square bracket notation and assigning it a value. Later I declare a var with the same name as the one I just created above. Note I am not assigning a value. Since this is a redeclaration of the same variable the old value should not be overriden as described here: http://www.w3schools.com/js/js_variables.asp //create global variable with square bracket notation window['y'] = 'old'; //redeclaration of the same variable var y; if (!y) y = 'new'; alert(y); //shows New instead of Old The problem is that the old value actually does get overriden and in the above eg. the alert shows 'new' instead of 'old'. Why ? I guess another way to state my question is how is the above code different in terms of semantics from the code below: //create global variable var y = 'old'; //redeclaration of the same variable var y; if (!y) y = 'new'; alert(y); //shows Old

    Read the article

  • How can I implement a proper counter bean with EJB 3.0?

    - by Aaron Digulla
    I have this entity bean: import javax.persistence.*; @Entity public class CounterTest { private int id; private int counter; @Id public int getId() { return id; } public void setId(int id) { this.id = id; } public int getCounter() { return counter; } public void setCounter(int counter) { this.counter = counter; } } and this stateful bean to increment a counter: import java.rmi.RemoteException; import javax.ejb.*; import javax.persistence.*; @Stateful public class CounterTestBean implements CounterTestRemote { @PersistenceContext(unitName = "JavaEE") EntityManager manager; public void initDB() { CounterTest ct = new CounterTest(); ct.setNr(1); ct.setWert(1); manager.persist(ct); } public boolean testCounterWithLock() { try { CounterTest ct = manager.find(CounterTest.class, 1); manager.lock(ct, LockModeType.WRITE); int wert = ct.getWert(); ct.setWert(wert + 1); manager.flush(); return true; } catch (Throwable t) { return false; } } } When I call testCounterWithLock() from three threads 500 times each, the counter gets incremented between 13 and 1279 times. How do I fix this code so that it is incremented 1500 times?

    Read the article

  • php get, random records, and the back button

    - by Andrew Heath
    My site has a library full of games, nations, game scenarios, etc. library.php is given a type=___ & id=___ for example library.php?type=scenario&id=ABCD001 library.php saves the id to a session variable and loads an include appropriate for the type This all works just dandy. Now, I wanted to give my users the option of pulling up a random scenario. To do that, I added a special id to the logic within lib-scenario.php (the include) such that if given library.php?type=scenario&id=random the include knows to run an alternate query for a random record rather than for the actual id This also works just dandy... unless someone hits the Random Scenario button two+ times in a row, and decides that the previous random scenario was way cooler, I want to go back to that. Because the http address is always directory/library.php?type=scenario&id=random no matter how many times you click Random Scenario, as soon as you click back you'll be taken to the last page with an alternate address you visited. So, if you start at the Home page, and hit Random Scenario 35 times, then decide the 34th one was what you wanted and click BACK, you'll be put back onto the Home page. I must admit this was not a problem I had anticipated. One of my testers was the first to have the urge to back-up in the random scenario stream and here we are. How can I add back-up functionality to my script?

    Read the article

  • How to create a column containing a string of stars to inidcate levels of a factor in a data frame i

    - by PaulHurleyuk
    (second question today - must be a bad day) I have a dataframe with various columns, inculding a concentration column (numeric), a flag highlighting invalid results (boolean) and a description of the problem (character) dput(df) structure(list(x = c(1, 2, 3, 4, 5, 6, 7, 8, 9, 10), rawconc = c(77.4, 52.6, 86.5, 44.5, 167, 16.2, 59.3, 123, 1.95, 181), reason = structure(c(NA, NA, 2L, NA, NA, NA, 2L, 1L, NA, NA), .Label = c("Fails Acceptance Criteria", "Poor Injection"), class = "factor"), flag = c("False", "False", "True", "False", "False", "False", "True", "True", "False", "False" )), .Names = c("x", "rawconc", "reason", "flag"), row.names = c(NA, -10L), class = "data.frame") I can create a column with the numeric level of the reason column df$level<-as.numeric(df$reason) df x rawconc reason flag level 1 1 77.40 <NA> False NA 2 2 52.60 <NA> False NA 3 3 86.50 Poor Injection True 2 4 4 44.50 <NA> False NA 5 5 167.00 <NA> False NA 6 6 16.20 <NA> False NA 7 7 59.30 Poor Injection True 2 8 8 123.00 Fails Acceptance Criteria True 1 9 9 1.95 <NA> False NA 10 10 181.00 <NA> False NA and here's what I want to do to create a column with 'level' many stars, but it fails df$stars<-paste(rep("*",df$level)sep="",collapse="") Error: unexpected symbol in "df$stars<-paste(rep("*",df$level)sep" df$stars<-paste(rep("*",df$level),sep="",collapse="") Error in rep("*", df$level) : invalid 'times' argument rep("*",df$level) Error in rep("*", df$level) : invalid 'times' argument df$stars<-paste(rep("*",pmax(df$level,0,na.rm=TRUE)),sep="",collapse="") Error in rep("*", pmax(df$level, 0, na.rm = TRUE)) : invalid 'times' argument It seems that rep needs to be fed one value at a time. I feel that this should be possible (and my gut says 'use lapply' but my apply fu is v. poor) ANy one want to try ?

    Read the article

  • Foreach is crashing script, but no errors reported.

    - by ILMV
    So I've created this smarty function to get images from my flickr photostream using SimplePie... simple really, or so it should be. The problem I'm having is the foreach will crash the script, this doesn't happen if I put an exit after the closing foreach, of course because of this the rest of my script doesn't execute. The problem also completely subsides if I remove the foreach, I've tested it and it's not the contents of the foreach, but the loop itself. Error reporting is turned on but I don't get any, I also tried messing with the memory_limit, with no luck. Anyone know why this foreach is killing my script? Thanks! function smarty_function_flickr ($params, &$smarty) { require_once('system/library/SimplePie/simplepie.inc'); require_once('system/library/SimplePie/idn/idna_convert.class.php'); $flickr=new flickr(); /** * Set up SimplePie with all default values using shorthand syntax. */ $feed = new SimplePie($params['feed'], 'system/library/SimplePie/cache', '600'); $feed->handle_content_type(); /** * What sizes should we use? * Choices: square, thumb, small, medium, large. */ $thumb = 'square'; $full = 'medium'; $output = array(); $counter=0; // If I comment this foreach out the problem subsides, I know it is not the code within the foreach foreach ($feed->get_items() as $item) { $url = $flickr->image_from_description($item->get_description()); $output[$counter]['title'] = $item->get_title(); $output[$counter]['image'] = $flickr->select_image($url, $full); $output[$counter]['thumb'] = $flickr->select_image($url, $thumb); $counter++; } // Set template variables and template $smarty->assign('flickr',$output); $smarty->display('forms/'.$params['template'].'.tpl'); }

    Read the article

< Previous Page | 58 59 60 61 62 63 64 65 66 67 68 69  | Next Page >