Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 650/776 | < Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >

• Java, Massive message processing with queue manager (trading)

  - by Ronny

  Hello, I would like to design a simple application (without j2ee and jms) that can process massive amount of messages (like in trading systems) I have created a service that can receive messages and place them in a queue to so that the system won't stuck when overloaded. Then I created a service (QueueService) that wraps the queue and has a pop method that pops out a message from the queue and if there is no messages returns null, this method is marked as "synchronized" for the next step. I have created a class that knows how process the message (MessageHandler) and another class that can "listen" for messages in a new thread (MessageListener). The thread has a "while(true)" and all the time tries to pop a message. If a message was returned, the thread calls the MessageHandler class and when it's done, he will ask for another message. Now, I have configured the application to open 10 MessageListener to allow multi message processing. I have now 10 threads that all time are in a loop. Is that a good design?? Can anyone reference me to some books or sites how to handle such scenario?? Thanks, Ronny

  Read the article

• Designing a chain of states

  - by devoured elysium

  I want to model a kind of FSM(Finite State Machine). I have a sequence of states (let's say, from StateA to StateZ). This sequence is called a Chain and is implemented internally as a List. I will add states by the order I want them to run. My purpose is to be able to make a sequence of actions in my computer (for example, mouse clicks). (I know this has been done a zillion times). So a state is defined as a: boolean Precondition() <- Checks to see if for this state, some condition is true. For example, if I want to click in the Record button of a program, in this method I would check if the program's process is running or not. If it is, go to the next state in the chain list, otherwise, go to what was defined as the fail state (generally is the first state of them all). IState GetNextState() <- Returns the next state to evaluate. If Precondition() was sucessful, it should yield the next state in the chain otherwise it should yield the fail state. Run() Simply checks the Precondition() and sets the internal data so GetNextState() works as expected. So, a naive approach to this would be something like this: Chain chain = new Chain(); //chain.AddState(new State(Precondition, FailState, NextState) <- Method structure chain.AddState(new State(new WinampIsOpenCondition(), null, new <problem here, I want to referr to a state that still wasn't defined!>); The big problem is that I want to make a reference to a State that at this point still wasn't defined. I could circumvent the problem by using strings when refrering to states and using an internal hashtable, but isn't there a clearer alternative? I could just pass only the pre-condition and failure states in the constructor, having the chain just before execution put in each state the correct next state in a public property but that seems kind of awkward.

  Read the article

• Can't add/remove items from a collection while foreach is iterating over it

  - by flockofcode

  If I make my own implementation of IEnumerator interface, then I am able ( inside foreach statement )to add or remove items from a albumsList without generating an exception.But if foreach statement uses IEnumerator supplied by albumsList, then trying to add/delete ( inside the foreach )items from albumsList will result in exception: class Program { static void Main(string[] args) { string[] rockAlbums = { "rock", "roll", "rain dogs" }; ArrayList albumsList = new ArrayList(rockAlbums); AlbumsCollection ac = new AlbumsCollection(albumsList); foreach (string item in ac) { Console.WriteLine(item); albumsList.Remove(item); //works } foreach (string item in albumsList) { albumsList.Remove(item); //exception } } class MyEnumerator : IEnumerator { ArrayList table; int _current = -1; public Object Current { get { return table[_current]; } } public bool MoveNext() { if (_current + 1 < table.Count) { _current++; return true; } else return false; } public void Reset() { _current = -1; } public MyEnumerator(ArrayList albums) { this.table = albums; } } class AlbumsCollection : IEnumerable { public ArrayList albums; public IEnumerator GetEnumerator() { return new MyEnumerator(this.albums); } public AlbumsCollection(ArrayList albums) { this.albums = albums; } } } a) I assume code that throws exception ( when using IEnumerator implementation A supplied by albumsList ) is located inside A? b) If I want to be able to add/remove items from a collection ( while foreach is iterating over it), will I always need to provide my own implementation of IEnumerator interface, or can albumsList be set to allow adding/removing items? thank you

  Read the article

• password is auto-completed despite setting redisplay=false in JSP (Struts)

  - by lmcgowin

  So I have a web application on Tomcat, built on top of Struts 1.1. Here is a snippet of my JSP, it's a login. <html:form action = "LoginAction" focus = "username"> <table> <tr><td align = "right">User name: </td> <td><html:text property = "username"/> </td></tr> <tr><td align = "right">Password: </td><td><html:password property = "password" redisplay = "false"/></td></tr> </table> </html:form> Snippet from struts-html-1.1.tld: <tag> <name>password</name> <tagclass>org.apache.struts.taglib.html.PasswordTag</tagclass> <attribute> <name>redisplay</name> <required>false</required> <rtexprvalue>true</rtexprvalue> </attribute> </tag> Resulting HTML: Having trouble getting this to post as code but the relevant part is an input tag of type 'password' with no reference to redisplay, autocomplete, etc. It is my understanding that the redisplay element should be passed through Struts to appear in the HTML.

  Read the article

• Why doesn't my UIViewController class keep track of an NSArray instance variable.

  - by TaoStoner

  Hey, I am new to Objective-C 2.0 and Xcode, so forgive me if I am missing something elementary here. Anyways, I am trying to make my own UIViewController class called GameView to display a new view. To work the game I need to keep track of an NSArray that I want to load from a plist file. I have made a method 'loadGame' which I want to load the correct NSArray into an instance variable. However it appears that after the method executes the instance variable loses track of the array. Its easier if I just show you the code.... @interface GameView : UIViewController { IBOutlet UIView *view IBOutlet UILabel *label; NSArray *currentGame; } -(IBOutlet)next; -(void)loadDefault; ... @implementation GameView - (IBOutlet)next{ int numElements = [currentGame count]; int r = rand() % numElements; NSString *myString = [currentGame objectAtIndex:(NSUInteger)r]; [label setText: myString]; } - (void)loadDefault { NSDictionary *games; NSString *path = [[NSBundle mainBundle] bundlePath]; NSString *finalPath = [path stringByAppendingPathComponent:@"Games.plist"]; games = [NSDictionary dictionaryWithContentsOfFile:finalPath]; currentGame = [games objectForKey:@"Default"]; } when loadDefault gets called, everything runs perfectly, but when I try to use the currentGame NSArray later in the method call to next, currentGame appears to be nil. I am also aware of the memory management issues with this code. Any help would be appreciated with this problem.

  Read the article

• uploading images with the help of arrays and fetch errors

  - by bonny

  i use a script to upload a couple of images to a directory. the code works great in case of just one picture will be uploaded. if i like to upload two images or more and have an extension that is not accepted, the script will upload the one with the extension that is allowed to upload and shows the errormessage for the one who is not accepted. but the upload takes place. that's my first problem. second problem will be: in case of an errormessage i would like to display a message in which it is said, which of the images will be not allowed. i do not know how to fetch this one that has an unaccepted ending into a variable that i can echo to the errormessage. here is the code i use: if(!empty($_FILES['image']['tmp_name'])){ $allowed_extension = array('jpg', 'jpeg', 'png', 'bmp', 'tiff', 'gif'); foreach($_FILES['image']['name'] as $key => $array_value){ $file_name = $_FILES['image']['name'][$key]; $file_size = $_FILES['image']['size'][$key]; $file_tmp = $_FILES['image']['tmp_name'][$key]; $file_extension = strtolower(end(explode('.', $file_name))); if (in_array($file_extension, $allowed_extension) === false){ $errors[] = 'its an unaccepted format in picture $variable_that_count'; continue; } if ($file_size > 2097152){ $errors[] = 'reached maxsize of 2MB per file in picture $variable_that_count'; } if (count($errors) == 0){ $path = "a/b/c/"; $uploadfile = $path."/".basename($_FILES['image']['name'][$key]); if (move_uploaded_file($_FILES['image']['tmp_name'][$key], $uploadfile)){ echo "success."; } } } } hope it will be clear what i like to approach. if there is someone who could help out i really would appreciate. thanks a lot.

  Read the article

• Should we point to an NSManagedObject entity with weak instead of strong pointer?

  - by Jim Thio

  I think because NSManagedObject is managed by the managedObject context the pointer should be weak. Yet it often goes back to 0 in my cases. for (CategoryNearby * CN in sorted) { //[arrayOfItems addObject:[NSString stringWithFormat:@"%@ - %d",CN.name,[CN.order intValue]]]; NearbyShortcutTVC * tvc=[[NearbyShortcutTVC alloc]init]; tvc.categoryNearby =CN; // tvc.titleString=[NSString stringWithFormat:@"%@",CN.name]; // tvc.displayed=CN.displayed; [arrayOfItemsLocal addObject:tvc]; //CN PO(tvc); PO(tvc.categoryNearby); while (false); } self.arrayOfItems = arrayOfItemsLocal; PO(self.categoriesNearbyInArrayOfItems); [self.tableViewa reloadData]; ... Yet somewhere down the line: tvc.categoryNearby becomes nil. I do not know how or when or where it become nil. How do I debug this? Or should the reference be strong instead? This is the interface of NearbyShortcutTVC by the way @interface NearbyShortcutTVC : BGBaseTableViewCell{ } @property (weak, nonatomic) CategoryNearby * categoryNearby; @end To make sure that we're talking about the same object I print all the memory addresses of the NSArray They're both the exact same object. But somehow the categoryNearby property of the object is magically set to null somewhere. self.categoriesNearbyInArrayOfItems: ( 0x883bfe0, 0x8b6d420, 0x8b6f9f0, 0x8b71de0, 0xb073f90, 0xb061a10, 0xb06a880, 0x8b74940, 0x8b77110, 0x8b794e0, 0x8b7bf40, 0x8b7cef0, 0x8b7f4b0, 0x8b81a30, 0x88622d0, 0x8864e60, 0xb05c9a0 ) self.categoriesNearbyInArrayOfItems: ( 0x883bfe0, 0x8b6d420, 0x8b6f9f0, 0x8b71de0, 0xb073f90, 0xb061a10, 0xb06a880, 0x8b74940, 0x8b77110, 0x8b794e0, 0x8b7bf40, 0x8b7cef0, 0x8b7f4b0, 0x8b81a30, 0x88622d0, 0x8864e60, 0xb05c9a0 )

  Read the article

• How to find whole graph coverage path in dynamic state-flow diagram?

  - by joseph

  Hello, As I've been researching algorithms for path finding in graph, I found interesting problem. Definition of situation: 1)State diagram can have p states, and s Boolean Fields, and z Int Fields 2)Every state can have q ingoing and r outgoing transitions, and h Int fields (h belongs to z - see above) 3)Every transition can have only 1 event, and only 1 action 4)every action can change n Boolean Fields, and x Int Fields 5)every event can have one trigger from combination of any count of Boolean Fields in diagram 6)Transition can be in OPEN/CLOSED form. If the transition is open/closed depends on trigger2 compounded from 0..c Boolean fields. 7) I KNOW algorithm for finding shortest paths from state A to state B. 8) I KNOW algorithm for finding path that covers all states and transitions of whole state diagram, if all transitions are OPEN. Now, what is the goal: I need to find shortest path that covers all states and transitions in dynamically changing state diagram described above. When an action changes some int field, the algorithm should go through all states that have changed int field. The algorithm should also be able to open and close transition (by going through transitions that open and close another transitions by action) in the way that the founded path will be shortest and covers all transitions and states. Any idea how to solve it? I will be really pleased for ANY idea. Thanks for answers.

  Read the article

• performing more than one Where in query return null!!! why? how to fix this?

  - by Sadegh

  hi, i have wrote a method that filters output with provided query and return it. when one Where excuted; it return correct output but when more than one Where excuted; output is null and Exception occured with message "Enumeration yielded no results". why? how i can fix it? public IQueryable<SearchResult> PerformSearch(string query, int skip = 0, int take = 5) { if (!string.IsNullOrEmpty(query)) { var queryList = query.Split('+').ToList(); var results = GENERATERESULTS(); string key; foreach (string _q in queryList) { if (_q.StartsWith("(") && _q.EndsWith(")")) { key = _q.Replace("(", "").Replace(")", ""); results = results.Where(q => q.Title.Contains(key, StringComparison.CurrentCultureIgnoreCase)); } else if (_q.StartsWith("\"") && _q.EndsWith("\"")) { key = _q.Replace("\"", "").Replace("\"", ""); results = results.Where(q => q.Title.Contains(key, StringComparison.CurrentCulture)); } else if (_q.StartsWith("-(") && _q.EndsWith(")")) { key = _q.Replace("-(", "").Replace(")", ""); results = results.Where(q=> !q.Title.Contains(key, StringComparison.CurrentCultureIgnoreCase)); } else { key = _q; results = results.Where(q => q.Title.Contains(key, StringComparison.CurrentCulture)); } } this._Count = results.Count(); results = results.Skip(skip).Take(take); this._EndOn = DateTime.Now; this.ExecutionTime(); return results; } else return null; } thanks in advance ;)

  Read the article

• IIS 6.0 Rewrite rules for Wordpress (Forward slash not working and other things)

  - by DigitalBlade

  Hi, I am using Wordpress 3.0.4 on IIS 6.0 and Windows Server 2003, hosted by a company. I was having lots of issues using permalinks. I have fixed most, but now I have an issue with a forward-slash not being added to the address. This would be fine on most websites, but not on IIS for some reason. Specifically, if I go to "mysite.com/wp-admin" I can log-in and get to the dashboard, but as soon as I click anything there i am redirected to a broken link. For example: "mysite.com/post-new.php". If I add the slash at the end it's fine. So I tried to have a rewrite rule to automatically add the slash to such address: RewriteRule /wp-admin /wp-admin/ [L] But it still doesn't work. For your reference, here's the complete file: [ISAPI_Rewrite] RewriteBase / RewriteCond ${REQUEST_FILENAME} !-f RewriteCond ${REQUEST_FILENAME} !-d # For special WordPress folders (e.g. theme, admin, etc.) RewriteRule /wp-admin /wp-admin/ [L] RewriteRule /wp-(.*) /wp-$1 [L] RewriteRule /(.*\.(?:jpg|jpeg|gif|css|txt|xml|html|png|js)) /$1 [I,L] # Rules to ensure that normal content gets through RewriteRule /images/(.*) /images/$1 [L] RewriteRule /favicon.ico /favicon.ico [L] RewriteRule /robots.txt /robots.txt [L] RewriteRule /phpmyadmin/(.*) /phpmyadmin/$1 [L] RewriteRule /phpmyadmin /phpmyadmin/ [L] # For all WordPress pages RewriteRule ^/$ /index.php [L] RewriteRule /(.*) /index.php/$1 [L] Any ideas? Thanks in advance

  Read the article

• itearation through gridview

  - by user1405508

  I want to get cell value from gridview,but empty string is returned .I am implemented code in selectedindexchanged event of radiobuttonlist .I iterate through gridview and access cell by code .but problem is stll remaining.I used three itemtemplate ,each has one elemnt so that each element get its own coulmn .aspx <asp:GridView ID="GridView2" runat="server" AutoGenerateColumns="false" > <Columns> <asp:Label ID="Label2" runat="server" Text='<%# Eval("qno") %>'> </asp:Label> </ItemTemplate> </asp:TemplateField> <asp:TemplateField> <ItemTemplate> <asp:Label ID="Label3" runat="server" Text='<%# Eval("description") %>'> </ItemTemplate> </asp:TemplateField> <asp:RadioButtonList ID="RadioButtonList1" RepeatDirection="Horizontal" runat="server" OnSelectedIndexChanged="changed" AutoPostBack="true" > <asp:ListItem Value="agree" Selected="True" > </asp:ListItem> <asp:ListItem Value="disagree"> </asp:ListItem> <asp:ListItem Value="strongagree"> </asp:ListItem> <asp:ListItem Value="strondisagree"> </asp:ListItem> </asp:RadioButtonList> </Columns> </asp:GridView> <asp:Label ID="Labe11" runat="server" ></asp:Label> Code behind: public void changed(object sender, EventArgs e) { for(int i=0;i<GridView2.Rows.Count;i++) { string labtext; RadioButtonList list = GridView2.Rows[i].Cells[2].FindControl("RadioButtonList1") as RadioButtonList; labtext= GridView2.Rows[i].Cells[0].Text; Label1.Text = labtext; } }

  Read the article

• cellForRowAtIndexPath not called for all sections

  - by Wynn

  I have a UITableView that has five sections. Just as the title describes cellForRowAtIndexPath is only being called for the first four. All connections have been made concerning the datasource and delegate. Also, my numberOfSectionsInTableView clearly returns 5. Printing out the number of sections from within cellForRowAtIndexPath shows the correct number, thus confirming that cellForRowAtIndexPath is simply not being called for all sections. What on earth is going on? I looked pretty hard for an answer to this question but could't find one. If this has already been answered please forgive me and point me in the correct direction. My cellForRowAtIndexPath: - (UITableViewCell *)tableView:(UITableView *)theTableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [theTableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier]; } switch (indexPath.section) { case 0: cell.textLabel.text = ticket.description; break; case 1: cell.textLabel.text = ticket.ticketStatus; break; case 2: cell.textLabel.text = ticket.priority; break; case 3: cell.textLabel.text = ticket.customerOfficePhone; break; case 4: { //This never ever gets executed Comment *comment = [ticket.comments objectAtIndex:indexPath.row]; cell.textLabel.text = comment.commentContent; break; } } return cell; } My numberOfSectionsInTableView: - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 5; } My numberOfRowsInSection: - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { NSInteger numberOfRows; if (section == 4) { numberOfRows = [ticket.comments count]; } else { numberOfRows = 1; } return numberOfRows; } Any suggestions are appreciated. Thanks in advance.

  Read the article

• Stored Procedure: Reducing Table Data

  - by SumGuy

  Hi Guys, A simple question about Stored Procedures. I have one stored procedure collecting a whole bunch of data in a table. I then call this procedure from within another stored procedure. I can copy the data into a new table created in the calling procedure but as far as I can see the tables have to be identical. Is this right? Or is there a way to insert only the data I want? For example.... I have one procedure which returns this: SELECT @batch as Batch, @Count as Qty, pd.Location, cast(pd.GL as decimal(10,3)) as [Length], cast(pd.GW as decimal(10,3)) as Width, cast(pd.GT as decimal(10,3)) as Thickness FROM propertydata pd GROUP BY pd.Location, pd.GL, pd.GW, pd.GT I then call this procedure but only want the following data: DECLARE @BatchTable TABLE ( Batch varchar(50), [Length] decimal(10,3), Width decimal(10,3), Thickness decimal(10,3), ) INSERT @BatchTable (Batch, [Length], Width, Thickness) EXEC dbo.batch_drawings_NEW @batch So in the second command I don't want the Qty and Location values. However the code above keeps returning the error: "Insert Error: Column name or number of supplied values does not match table"

  Read the article

• How to validate DataReader is actually closed using FxCop custom rule?

  - by tanmay

  I have written couple of custom rules in for FxCop 1.36. I have written code to find weather an opened DataReader is closed or not. But it does not check which DataReader object is calling the Close() method so I can't be sure if all opened DataReader objects are closed!! 2nd: If I am a DataReader in an 'if/else' like if 1=2 dr = cmd.ExecuteReader(); else dr = cmd2.ExecuteReader(); end if In this case it will search for 2 DataReader objects to be closed. I am putting my code for more clarity. public override ProblemCollection Check(Member member) { Method method = member as Method; int countCatch =0; int countErrLog = 0; Instruction objInstr = null; if (method != null) { for (int i = 0; i < method.Instructions.Count; i++) { objInstr = method.Instructions[i]; if (objInstr.Value != null) { if (objInstr.Value.ToString() .Contains("System.Data.SqlClient.SqlDataReader")) { countCatch += 1; } if (countCatch>0) { if (objInstr.Value.ToString().Contains( "System.Data.SqlClient.SqlDataReader.Close")) { countErrLog += 1; } } } } } if (countErrLog!=countCatch) { Resolution resolu = GetResolution(new string[] { method.ToString() }); Problems.Add(new Problem(resolu)); } return Problems; }

  Read the article

• unexpected behaviour of object stored in web service Session

  - by draconis

  Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

  Read the article

• how can access public properties of MasterPage from external Class ?

  - by eugeneK

  Why i can't access MasterPage's public property (MessagePlaceholder) from other Class (Errors) ? Error compiler gives me is "Error 1 The type or namespace name 'MyMasterPage' could not be found (are you missing a using directive or an assembly reference?)" my master page code behind using System; using System.Collections.Generic; using System.Linq; using System.Web; using System.Web.UI; using System.Web.UI.WebControls; public partial class MyMasterPage : System.Web.UI.MasterPage { public string MessagePlaceholder { get { return messagePlaceholder.InnerHtml; } set { messagePlaceholder.InnerHtml = value; } } protected void Page_Load(object sender, EventArgs e) { if (!IsPostBack) { messagePlaceholder.InnerHtml = Errors.getMessage(); } } } my Errors Class public static string getMessage() { HttpContext c = HttpContext.Current; string messageType = ""; if (c.Session["errorMessage"] != null) { messageType = "errorMessage"; } else if (c.Session["successMessage"] != null) { messageType = "successMessage"; } if (!string.IsNullOrEmpty(messageType)) { StringBuilder userMessageSb = new StringBuilder(); userMessageSb.Append(string.Format("<div id=\"{0}\" title=\"{1}\">{2}</div>", messageType, messageType.Replace("Message",string.Empty), c.Session[messageType])); // fix so message will not re-appear c.Session.Remove(messageType); messageType = userMessageSb.ToString(); } return messageType; } public static void setSuccess(string successMessage, bool isRedirect) { HttpContext.Current.Session["successMessage"] = successMessage; } public static void setError(string errorMessage, bool isRedirect) { HttpContext.Current.Session["errorMessage"] = errorMessage; if (!isRedirect) { ((HttpContext.Current.CurrentHandler as System.Web.UI.Page).Master as MyMasterPage).MessagePlaceholder = getMessage(); } } this is how i set error if (true) { Errors.setError("this is an error demo", false); return; } or with redirect after error if (true) { Errors.setError("yet another error", true); Response.Redirect("~/error.aspx"); }

  Read the article

• Include php code within echo from a random text

  - by lisa

  I want to display a php code at random and so for I have <?php // load the file that contain thecode $adfile = "code.txt"; $ads = array(); // one line per code $fh = fopen($adfile, "r"); while(!feof($fh)) { $line = fgets($fh, 10240); $line = trim($line); if($line != "") { $ads[] = $line; } } // randomly pick an code $num = count($ads); $idx = rand(0, $num-1); echo $ads[$idx]; ?> The code.txt has lines like <?php print insert_proplayer( array( "width" => "600", "height" => "400" ), "http://www.youtube.com/watch?v=xnPCpCVepCg"); ?> Proplayer is a wordpress plugin that displays a video. The codes in code.txt work well, but not when I use the pick line from code.txt. Instead of the full php line I get: "width" => "600", "height" => "400" ), "http://www.youtube.com/watch?v=xnPCpCVepCg"); ?> How can I make the echo show the php code, rather than a txt version of the php code?

  Read the article

• `enable_shared_from_this` has a non-virtual destructor

  - by Shtééf

  I have a pet project with which I experiment with new features of the upcoming C++0x standard. While I have experience with C, I'm fairly new to C++. To train myself into best practices, (besides reading a lot), I have enabled some strict compiler parameters (using GCC 4.4.1): -std=c++0x -Werror -Wall -Winline -Weffc++ -pedantic-errors This has worked fine for me. Until now, I have been able to resolve all obstacles. However, I have a need for enable_shared_from_this, and this is causing me problems. I get the following warning (error, in my case) when compiling my code (probably triggered by -Weffc++): base class ‘class std::enable_shared_from_this<Package>’ has a non-virtual destructor So basically, I'm a bit bugged by this implementation of enable_shared_from_this, because: A destructor of a class that is intended for subclassing should always be virtual, IMHO. The destructor is empty, why have it at all? I can't imagine anyone would want to delete their instance by reference to enable_shared_from_this. But I'm looking for ways to deal with this, so my question is really, is there a proper way to deal with this? And: am I correct in thinking that this destructor is bogus, or is there a real purpose to it?

  Read the article

• Application Code Redesign to reduce no. of Database Hits from Performance Perspective

  - by Rachel

  Scenario I want to parse a large CSV file and inserts data into the database, csv file has approximately 100K rows of data. Currently I am using fgetcsv to parse through the file row by row and insert data into Database and so right now I am hitting database for each line of data present in csv file so currently database hit count is 100K which is not good from performance point of view. Current Code: public function initiateInserts() { //Open Large CSV File(min 100K rows) for parsing. $this->fin = fopen($file,'r') or die('Cannot open file'); //Parsing Large CSV file to get data and initiate insertion into schema. while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) { $query = "INSERT INTO dt_table (id, code, connectid, connectcode) VALUES (:id, :code, :connectid, :connectcode)"; $stmt = $this->prepare($query); // Then, for each line : bind the parameters $stmt->bindValue(':id', $data[0], PDO::PARAM_INT); $stmt->bindValue(':code', $data[1], PDO::PARAM_INT); $stmt->bindValue(':connectid', $data[2], PDO::PARAM_INT); $stmt->bindValue(':connectcode', $data[3], PDO::PARAM_INT); // Execute the statement $stmt->execute(); $this->checkForErrors($stmt); } } I am looking for a way wherein instead of hitting Database for every row of data, I can prepare the query and than hit it once and populate Database with the inserts. Any Suggestions !!! Note: This is the exact sample code that I am using but CSV file has more no. of field and not only id, code, connectid and connectcode but I wanted to make sure that I am able to explain the logic and so have used this sample code here. Thanks !!!

  Read the article

• Generated images fail to load in browser

  - by notJim

  I've got a page on a webapp that has about 13 images that are generated by my application, which is written in the Kohana PHP framework. The images are actually graphs. They are cached so they are only generated once, but the first time the user visits the page, and the images all have to be generated, about half of the images don't load in the browser. Once the page has been requested once and images are cached, they all load successfully. Doing some ad-hoc testing, if I load an individual image in the browser, it takes from 450-700 ms to load with an empty cache (I checked this using Google Chrome's resource tracking feature). For reference, it takes around 90-150 ms to load a cached image. Even if the image cache is empty, I have the data and some of the application's startup tasks cached, so that after the first request, none of that data needs to be fetched. My questions are: Why are the images failing to load? It seems like the browser just decides not to download the image after a certain point, rather than waiting for them all to finish loading. What can I do to get them to load the first time, with an empty cache? Obviously one option is to decrease the load times, and I could figure out how to do that by profiling the app, but are there other options? As I mentioned, the app is in the Kohana PHP framework, and it's running on Apache. As an aside, I've solved this problem for now by fetching the page as soon as the data is available (it comes from a batch process), so that the images are always cached by the time the user sees them. That feels like a kludgey solution to me, though, and I'm curious about what's actually going on.

  Read the article

• public class ImageHandler : IHttpHandler

  - by Ken

  cmd.Parameters.AddWithValue("@id", new system.Guid (imageid)); What using System reference would this require? Here is the handler: using System; using System.Collections.Specialized; using System.Web; using System.Web.Configuration; using System.Web.Security; using System.Globalization; using System.Configuration; using System.Data.SqlClient; using System.Data; using System.IO; using System.Web.Profile; using System.Drawing; public class ImageHandler : IHttpHandler { public void ProcessRequest(HttpContext context) { string imageid; if (context.Request.QueryString["id"] != null) imageid = (context.Request.QueryString["id"]); else throw new ArgumentException("No parameter specified"); context.Response.ContentType = "image/jpeg"; Stream strm = ShowProfileImage(imageid.ToString()); byte[] buffer = new byte[8192]; int byteSeq = strm.Read(buffer, 0, 8192); while (byteSeq > 0) { context.Response.OutputStream.Write(buffer, 0, byteSeq); byteSeq = strm.Read(buffer, 0, 8192); } //context.Response.BinaryWrite(buffer); } public Stream ShowProfileImage(String imageid) { string conn = ConfigurationManager.ConnectionStrings["MyConnectionString1"].ConnectionString; SqlConnection connection = new SqlConnection(conn); string sql = "SELECT image FROM Profile WHERE UserId = @id"; SqlCommand cmd = new SqlCommand(sql, connection); cmd.CommandType = CommandType.Text; cmd.Parameters.AddWithValue("@id", new system.Guid (imageid));//Failing Here!!!! connection.Open(); object img = cmd.ExecuteScalar(); try { return new MemoryStream((byte[])img); } catch { return null; } finally { connection.Close(); } } public bool IsReusable { get { return false; } } }

  Read the article

• Use a foreign key mapping to get data from the other table using Python and SQLAlchemy.

  - by Az

  Hmm, the title was harder to formulate than I thought. Basically, I've got these simple classes mapped to tables, using SQLAlchemy. I know they're missing a few items but those aren't essential for highlighting the problem. class Customer(object): def __init__(self, uid, name, email): self.uid = uid self.name = name self.email = email def __repr__(self): return str(self) def __str__(self): return "Cust: %s, Name: %s (Email: %s)" %(self.uid, self.name, self.email) The above is basically a simple customer with an id, name and an email address. class Order(object): def __init__(self, item_id, item_name, customer): self.item_id = item_id self.item_name = item_name self.customer = None def __repr__(self): return str(self) def __str__(self): return "Item ID %s: %s, has been ordered by customer no. %s" %(self.item_id, self.item_name, self.customer) This is the Orders class that just holds the order information: an id, a name and a reference to a customer. It's initialised to None to indicate that this item doesn't have a customer yet. The code's job will assign the item a customer. The following code maps these classes to respective database tables. # SQLAlchemy database transmutation engine = create_engine('sqlite:///:memory:', echo=False) metadata = MetaData() customers_table = Table('customers', metadata, Column('uid', Integer, primary_key=True), Column('name', String), Column('email', String) ) orders_table = Table('orders', metadata, Column('item_id', Integer, primary_key=True), Column('item_name', String), Column('customer', Integer, ForeignKey('customers.uid')) ) metadata.create_all(engine) mapper(Customer, customers_table) mapper(Orders, orders_table) Now if I do something like: for order in session.query(Order): print order I can get a list of orders in this form: Item ID 1001: MX4000 Laser Mouse, has been ordered by customer no. 12 What I want to do is find out customer 12's name and email address (which is why I used the ForeignKey into the Customer table). How would I go about it?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Clearing Session in Global Application_Error

  - by Zarigani

  Whenever an unhandled exception occurs on our site, I want to: Send a notification email Clear the user's session Send the user to a error page ("Sorry, a problem occurred...") The first and last I've had working for a long time but the second is causing me some issues. My Global.asax.vb includes: Sub Application_Error(ByVal sender As Object, ByVal e As EventArgs) ' Send exception report Dim ex As System.Exception = Nothing If HttpContext.Current IsNot Nothing AndAlso HttpContext.Current.Server IsNot Nothing Then ex = HttpContext.Current.Server.GetLastError End If Dim eh As New ErrorHandling(ex) eh.SendError() ' Clear session If HttpContext.Current IsNot Nothing AndAlso HttpContext.Current.Session IsNot Nothing Then HttpContext.Current.Session.Clear() End If ' User will now be sent to the 500 error page (by the CustomError setting in web.config) End Sub When I run a debug, I can see the session being cleared, but then on the next page the session is back again! I eventually found a reference that suggests that changes to session will not be saved unless Server.ClearError is called. Unfortunately, if I add this (just below the line that sets "ex") then the CustomErrors redirect doesn't seem to kick in and I'm left with a blank page? Is there a way around this?

  Read the article

• Is there a way to detect Layout or Display changes in WPF?

  Hello! I am trying to check how fast the Frame control can display a FixedPage object when it is assigned to Frame.Content property. I plan to check the tick count before and after the assignment to the Content property. Example: int starttime = Environment.TickCount; frame1.Content = fixedpage; int endtime = Environment.TickCount; The problem is that the assignment to the Content property might be asynchronous and returns immediately therefore i get a zero amount of time. The rendering of the FixedPage however visually has a lag time from assignment of the Content property up to the point where the FixedPage appears on screen. The Frame.ContentChanged() event is no good either because it gets triggered even before the FixedPage appears on screen so it's not accurate. I'm thinking of detecting the change on the window or control's display instead in order to get the time when the FixedPage is actually displayed on screen. Is there a way to do this in WPF? Thanks!

  Read the article

< Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >