Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 650/776 | < Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >

  • Designing a chain of states

    - by devoured elysium
    I want to model a kind of FSM(Finite State Machine). I have a sequence of states (let's say, from StateA to StateZ). This sequence is called a Chain and is implemented internally as a List. I will add states by the order I want them to run. My purpose is to be able to make a sequence of actions in my computer (for example, mouse clicks). (I know this has been done a zillion times). So a state is defined as a: boolean Precondition() <- Checks to see if for this state, some condition is true. For example, if I want to click in the Record button of a program, in this method I would check if the program's process is running or not. If it is, go to the next state in the chain list, otherwise, go to what was defined as the fail state (generally is the first state of them all). IState GetNextState() <- Returns the next state to evaluate. If Precondition() was sucessful, it should yield the next state in the chain otherwise it should yield the fail state. Run() Simply checks the Precondition() and sets the internal data so GetNextState() works as expected. So, a naive approach to this would be something like this: Chain chain = new Chain(); //chain.AddState(new State(Precondition, FailState, NextState) <- Method structure chain.AddState(new State(new WinampIsOpenCondition(), null, new <problem here, I want to referr to a state that still wasn't defined!>); The big problem is that I want to make a reference to a State that at this point still wasn't defined. I could circumvent the problem by using strings when refrering to states and using an internal hashtable, but isn't there a clearer alternative? I could just pass only the pre-condition and failure states in the constructor, having the chain just before execution put in each state the correct next state in a public property but that seems kind of awkward.

    Read the article

  • How can I manage building library projects that produce both a static lib and a dll?

    - by Scott Langham
    I've got a large visual studio solution with ~50 projects. There are configurations for StaticDebug, StaticRelease, Debug and Release. Some libraries are needed in both dll and static lib form. To get them, we rebuild the solution with a different configuration. The Configuration Manager window is used to setup which projects need to build in which flavours, static lib, dynamic dll or both. This can by quite tricky to manage and it's a bit annoying to have to build the solution multiple times and select the configurations in the right order. Static versions need building before non-static versions. I'm wondering, instead of this current scheme, might it be simpler to manage if, for the projects I needed to produce both a static lib and dynamc dll, I created two projects. Eg: CoreLib CoreDll I could either make both of these projects reference all the same files and build them twice, or I'm wondering, would it be possible to build CoreLib and then get CoreDll to link it to generate the dll? I guess my question is, do you have any advice on how to structure your projects in this kind of situation? Thanks.

    Read the article

  • Eclipse BIRT - Unnecessary inline style with external CSS when rendering HTML

    - by Etienne
    Hello! I am designing a report using external CSS with BIRT 2.5. When BIRT renders the html report, it creates copies of each external style to inline styles (name style_x) in the resulting html. The report.design contains: <list-property name="cssStyleSheets"> <structure> <property name="fileName">… mycss.css</property> <property name="externalCssURI"> http://.../mycss.css </property> </structure> </list-property> The resulting html contains: <style type="text/css"> .style_0 {…} .style_1 {…} …. </style> <link rel="stylesheet" type="text/css" href="http://.../mycss.css"></link> For each reference of my styles, the rendered html elements use both styles usually like this: <div class="style_x myclass" …. > …. </div> Is there any way to get rid of the useless inline styles when rendering html?

    Read the article

  • Symbols (pdb) for native dll are not loaded due to post build step

    - by sean e
    I have a native release dll that is built with symbols. There is a post build step that modifies the dll. The post build step does some compression and probably appends some data. The pdb file is still valid however neither WinDbg nor Visual Studio 2008 will load the symbols for the dll after the post build step. What bits in either the pdb file or the dll do we need to modify to get either WinDbg or Visual Studio to load the symbols when it loads a dump in which our release dll is referenced? Is it filesize that matters? A checksum or hash? A timestamp? Modify the dump? or modify the pdb? modify the dll before it is shipped? (We know the pdb is valid because we are able to use it to manually get symbol names for addresses in dump callstacks that reference the released dll. It's just a total pain in the *ss do it by hand for every address in a callstack in all the threads.)

    Read the article

  • unexpected behaviour of object stored in web service Session

    - by draconis
    Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

    Read the article

  • Cant access NString after callback in [NSURLConnection sendSynchronousRequest]

    - by John ClearZ
    Hi I am trying to get a cookie from a site which I can do no problem. The problem arises when I try and save the cookie to a NSString in a holder class or anywhere else for that matter and try and access it outside the delegate method where it is first created. - (void)connection:(NSURLConnection *)connection didReceiveResponse:(NSURLResponse *)response { int i; NSString* c; NSArray* all = [NSHTTPCookie cookiesWithResponseHeaderFields:[response allHeaderFields] forURL:[NSURL URLWithString:@"http://johncleary.net"]]; //NSLog(@"RESPONSE HEADERS: \n%@", [response allHeaderFields]); for (i=0;i<[all count];i++) { NSHTTPCookie* cc = [all objectAtIndex: i]; c = [NSString stringWithFormat: @"%@=%@", [cc name], [cc value]]; [Cookie setCookie: c]; NSLog([Cookie cookie]) // Prints the cookie fine. } [receivedData setLength:0]; } I can see and print the cookie when I am in the method but I cant when trying to access it form anywhere else even though it gets stored in the holder class @interface Cookie : NSObject { NSString* cookie; } + (NSString*) cookie; + (void) setCookie: (NSString*) cookieValue; @end int main (void) { NSAutoreleasePool * pool = [[NSAutoreleasePool alloc] init]; JCLogin* login; login = [JCLogin new]; [login DoLogin]; NSLog([Cookie cookie]); // Crashes the program [pool drain]; return 0; }

    Read the article

  • A little confused about MVC and where to put a database query

    - by jax
    OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

    Read the article

  • C#: Non-constructed generics as properties (eg. List<T>)

    - by Dav
    The Problem It's something I came across a while back and was able to work around it somehow. But now it came back, feeding on my curiosity - and I'd love to have a definite answer. Basically, I have a generic dgv BaseGridView<T> : DataGridView where T : class. Constructed types based on the BaseGridView (such as InvoiceGridView : BaseGridView<Invoice>) are later used in the application to display different business objects using the shared functionality provided by BaseGridView (like virtual mode, buttons, etc.). It now became necessary to create a user control that references those constructed types to control some of the shared functionality (eg. filtering) from BaseGridView. I was therefore hoping to create a public property on the user control that would enable me to attach it to any BaseGridView in Designer/code: public BaseGridView<T> MyGridView { get; set; }. The trouble is, it doesn't work :-) When compiled, I get the following message: The type or namespace name 'T' could not be found (are you missing a using directive or an assembly reference?) Solutions? I realise I could extract the shared functionality to an interface, mark BaseGridView as implementing that interface, and then refer to the created interface in my uesr control. But I'm curious if there exists some arcane C# command/syntax that would help me achieve what I want - without polluting my solution with an interface I don't really need :-)

    Read the article

  • Android - Adding external library to project

    - by mmontalbo
    Hi, I am having a lot of trouble adding the WEKA library to a project I am working on. I have followed several tutorials that explain how to do this including the Android Developers guide: http://developer.android.com/guide/appendix/faq/commontasks.html#addexternallibrary and several of the postings on SO. I have created a folder in my project with the weka.jar file, created a new library (adding the weka.jar file to the library) and included this library in my build path. I have also added the library under the "Order and Export" tab in the project properties. I have also tried importing the jar file so that the actual contents of the jar are extracted into a directory in my project. The end result of all of this is that my project is able to build correctly and without error, but when it comes time to run my code on the emulator I get the following exception: 04-10 22:52:21.051: ERROR/dalvikvm(582): Could not find class 'weka.classifiers.trees.J48', referenced from method edu.usc.student.composure.classifier.GaitClassifierImpl. with J48 being the class I reference in my code. Does anyone have any additional suggestions that I may have overlooked? Thanks!

    Read the article

  • PHP Function parameters - problem with var not being set

    - by Marty
    So I am obviously not a very good programmer. I have written this small function: function dispAdjuggler($atts) { extract(shortcode_atts(array( 'slot' => '' ), $atts)); $adspot = ''; $adtype = ''; // Get blog # we're on global $blog_id; switch ($blog_id) { case 1: // root blog HOME page if (is_home()) { switch ($slot) { case 'top_leaderboard': $adspot = '855525'; $adtype = '608934'; break; case 'right_halfpage': $adspot = '855216'; $adtype = '855220'; break; case 'right_med-rectangle': $adspot = '858222'; $adtype = '613526'; break; default: throw new Exception("Ad slot is not defined"); break; } When I reference the function on a page like so: <?php dispAdjuggler("top_leaderboard"); ?> The switch is throwing the default exception. What am I doing wrong here? Thanks!!

    Read the article

  • IIS 6.0 Rewrite rules for Wordpress (Forward slash not working and other things)

    - by DigitalBlade
    Hi, I am using Wordpress 3.0.4 on IIS 6.0 and Windows Server 2003, hosted by a company. I was having lots of issues using permalinks. I have fixed most, but now I have an issue with a forward-slash not being added to the address. This would be fine on most websites, but not on IIS for some reason. Specifically, if I go to "mysite.com/wp-admin" I can log-in and get to the dashboard, but as soon as I click anything there i am redirected to a broken link. For example: "mysite.com/post-new.php". If I add the slash at the end it's fine. So I tried to have a rewrite rule to automatically add the slash to such address: RewriteRule /wp-admin /wp-admin/ [L] But it still doesn't work. For your reference, here's the complete file: [ISAPI_Rewrite] RewriteBase / RewriteCond ${REQUEST_FILENAME} !-f RewriteCond ${REQUEST_FILENAME} !-d # For special WordPress folders (e.g. theme, admin, etc.) RewriteRule /wp-admin /wp-admin/ [L] RewriteRule /wp-(.*) /wp-$1 [L] RewriteRule /(.*\.(?:jpg|jpeg|gif|css|txt|xml|html|png|js)) /$1 [I,L] # Rules to ensure that normal content gets through RewriteRule /images/(.*) /images/$1 [L] RewriteRule /favicon.ico /favicon.ico [L] RewriteRule /robots.txt /robots.txt [L] RewriteRule /phpmyadmin/(.*) /phpmyadmin/$1 [L] RewriteRule /phpmyadmin /phpmyadmin/ [L] # For all WordPress pages RewriteRule ^/$ /index.php [L] RewriteRule /(.*) /index.php/$1 [L] Any ideas? Thanks in advance

    Read the article

  • Listview not being populated

    - by Luke
    I have put some console.writeline code in to test, but they arent appearing in the output box? public static ArrayList myDeliveries = new ArrayList(); public mainForm() { InitializeComponent(); } private void mainForm_Load(object sender, EventArgs e) { if (!File.Exists("../../MealDeliveries.txt")) { MessageBox.Show("File not found!"); return; } using (StreamReader sr = new StreamReader("../../MealDeliveries.txt")) { //first line is delivery name string strDeliveryName = sr.ReadLine(); Console.WriteLine("some tetttttttttt23423423423423423ttttttttttttttttttttttt"); while (strDeliveryName != null) { //other lines Delivery d = new Delivery(strDeliveryName, sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine()); mainForm.myDeliveries.Add(d); //check for further values strDeliveryName = sr.ReadLine(); } } displayDeliveries(); } private void displayDeliveries() { lstDeliveryDetails.Items.Clear(); Console.WriteLine("some tettttttttttttttttttttttttttttttttt"); Console.WriteLine(mainForm.myDeliveries.Count); foreach (Delivery d in mainForm.myDeliveries) { lstDeliveryDetails.Items.Add(d.DeliveryName); } } Can anyone help??

    Read the article

  • Generated images fail to load in browser

    - by notJim
    I've got a page on a webapp that has about 13 images that are generated by my application, which is written in the Kohana PHP framework. The images are actually graphs. They are cached so they are only generated once, but the first time the user visits the page, and the images all have to be generated, about half of the images don't load in the browser. Once the page has been requested once and images are cached, they all load successfully. Doing some ad-hoc testing, if I load an individual image in the browser, it takes from 450-700 ms to load with an empty cache (I checked this using Google Chrome's resource tracking feature). For reference, it takes around 90-150 ms to load a cached image. Even if the image cache is empty, I have the data and some of the application's startup tasks cached, so that after the first request, none of that data needs to be fetched. My questions are: Why are the images failing to load? It seems like the browser just decides not to download the image after a certain point, rather than waiting for them all to finish loading. What can I do to get them to load the first time, with an empty cache? Obviously one option is to decrease the load times, and I could figure out how to do that by profiling the app, but are there other options? As I mentioned, the app is in the Kohana PHP framework, and it's running on Apache. As an aside, I've solved this problem for now by fetching the page as soon as the data is available (it comes from a batch process), so that the images are always cached by the time the user sees them. That feels like a kludgey solution to me, though, and I'm curious about what's actually going on.

    Read the article

  • Why am I getting a EXC_BAD_ACCESS in a NSTimer selector?

    - by AngeDeLaMort
    I've got quite a weird problem. To make it short, i'll write some pseudo-code: init: create a dictionary and insert n elements. create a "repeat timer" and add it to the currentRunLoop using the timerRefresh selector. timerRefresh: using a list of keys, find the items in the dictionary if the item exists -> call a function So, for an unknown reason, I get an EXC_BAD_ACCESS when I do: [item function]; But I traced the address I got from the dictionary items and it's ok. The ref count of the items in the dictionary is still 1. The {release, dealloc} of the items in the dictionary aren't called. Everything seems fine. Also, to make it worst, it works for some items. So, I'm wondering if there is a threading problem? or something else obscure? The callstack is quite simple: #0 0x93e0604b in objc_msgSend_fpret #1 0x00f3e6b0 in ?? #2 0x0001cfca in -[myObject functionm:] at myObject.m:000 #3 0x305355cd in __NSFireTimer #4 0x302454a0 in CFRunLoopRunSpecific #5 0x30244628 in CFRunLoopRunInMode #6 0x32044c31 in GSEventRunModal #7 0x32044cf6 in GSEventRun #8 0x309021ee in UIApplicationMain #9 0x000027e0 in main at main.m:14 So, any suggestion where to look would be appreciated.

    Read the article

  • Question about using an access database as a resource file in Visual Studio.

    - by user354303
    Hi I am trying to embed a Microsoft Access database file into my Class assembly DLL. I want my code to reference the resource file and use it with a ADODB.Connection object. Any body know a simpler way, or an easier way? Or what is wrong with my code, when i added the resource file it added me dataset definitions, but i have no idea what to do with those. The connection string I am trying below is from an automatically generated app.config. I did add the item as a resource... using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Data; using ConsoleApplication1.Resources;//SPPrinterLicenses using System.Data.OleDb; using ADODB; using System.Configuration; namespace ConsoleApplication1 { class SharePointPrinterManager { public static bool IsValidLicense(string HardwareID) { OleDbDataAdapter da = new OleDbDataAdapter(); DataSet ds = new DataSet(); ADODB.Connection adoCn = new Connection(); ADODB.Recordset adoRs = new Recordset(); //**open command below fails** adoCn.Open( @"Provider=Microsoft.ACE.OLEDB.12.0;Data Source=|DataDirectory|\Resources\SPPrinterLicenses.accdb;Persist Security Info=True", "", "", 1); adoRs.Open("Select * from AllWorkstationLicenses", adoCn, ADODB.CursorTypeEnum.adOpenForwardOnly, ADODB.LockTypeEnum.adLockReadOnly, 1); da.Fill(ds, adoRs, "AllworkstationLicenses"); adoCn.Close(); DataTable dt = new DataTable(); //ds.Tables. return true; } } }

    Read the article

  • MySQL left outer join is slow

    - by Ryan Doherty
    Hi, hoping to get some help with this query, I've worked at it for a while now and can't get it any faster: SELECT date, count(id) as 'visits' FROM dates LEFT OUTER JOIN visits ON (dates.date = DATE(visits.start) and account_id = 40 ) WHERE date >= '2010-12-13' AND date <= '2011-1-13' GROUP BY date ORDER BY date ASC That query takes about 8 seconds to run. I've added indexes on dates.date, visits.start, visits.account_id and visits.start+visits.account_id and can't get it to run any faster. Table structure (only showing relevant columns in visit table): create table visits ( `id` int(11) NOT NULL AUTO_INCREMENT, `account_id` int(11) NOT NULL, `start` DATETIME NOT NULL, `end` DATETIME NULL, PRIMARY KEY (`id`) ) ENGINE=MyISAM DEFAULT CHARSET=utf8; CREATE TABLE `dates` ( `date` date NOT NULL, PRIMARY KEY (`date`) ) ENGINE=MyISAM DEFAULT CHARSET=latin1; dates table contains all days from 2010-1-1 to 2020-1-1 (~3k rows). visits table contains about 400k rows dating from 2010-6-1 to yesterday. I'm using the date table so the join will return 0 visits for days there were no visits. Results I want for reference: +------------+--------+ | date | visits | +------------+--------+ | 2010-12-13 | 301 | | 2010-12-14 | 356 | | 2010-12-15 | 423 | | 2010-12-16 | 332 | | 2010-12-17 | 346 | | 2010-12-18 | 226 | | 2010-12-19 | 213 | | 2010-12-20 | 311 | | 2010-12-21 | 273 | | 2010-12-22 | 286 | | 2010-12-23 | 241 | | 2010-12-24 | 149 | | 2010-12-25 | 102 | | 2010-12-26 | 174 | | 2010-12-27 | 258 | | 2010-12-28 | 348 | | 2010-12-29 | 392 | | 2010-12-30 | 395 | | 2010-12-31 | 278 | | 2011-01-01 | 241 | | 2011-01-02 | 295 | | 2011-01-03 | 369 | | 2011-01-04 | 438 | | 2011-01-05 | 393 | | 2011-01-06 | 368 | | 2011-01-07 | 435 | | 2011-01-08 | 313 | | 2011-01-09 | 250 | | 2011-01-10 | 345 | | 2011-01-11 | 387 | | 2011-01-12 | 0 | | 2011-01-13 | 0 | +------------+--------+ Thanks in advance for any help!

    Read the article

  • T4 trouble compiling transformation

    - by John Leidegren
    I can't figure this one out. Why doesn't T4 locate the IEnumerable type? I'm using Visual Studio 2010. And I just hope someone knows why? <#@ template debug="true" hostspecific="false" language="C#" #> <#@ assembly name="System.Data, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" #> <#@ import namespace="System" #> <#@ import namespace="System.Data" #> <#@ import namespace="System.Data.SqlClient" #> <#@ output extension=".cs" #> public static class Tables { <# var q = @" SELECT tbl.name 'table', col.name 'column' FROM sys.tables tbl INNER JOIN sys.columns col ON col.object_id = tbl.object_id "; // var source = Execute(q); #> } <#+ static IEnumerable Execute(string cmdText) { using (var conn = new SqlConnection(@"Data Source=.\SQLEXPRESS;Initial Catalog=t4build;Integrated Security=True;")) { conn.Open(); var cmd = new SqlCommand(cmdText, conn); using (var reader = cmd.ExecuteReader()) { while (reader.Read()) { } } } } #> Error 2 Compiling transformation: The type or namespace name 'IEnumerable' could not be found (are you missing a using directive or an assembly reference?) c:\Projects\T4BuildApp\T4BuildApp\TextTemplate1.tt 26 9

    Read the article

  • Multiple generic types in one container

    - by Lirik
    I was looking at the answer of this question regarding multiple generic types in one container and I can't really get it to work: the properties of the Metadata class are not visible, since the abstract class doesn't have them. Here is a slightly modified version of the code in the original question: public abstract class Metadata { } public class Metadata<T> : Metadata { // ... some other meta data public T Function{ get; set; } } List<Metadata> metadataObjects; metadataObjects.Add(new Metadata<Func<double,double>>()); metadataObjects.Add(new Metadata<Func<int,double>>()); metadataObjects.Add(new Metadata<Func<double,int>>()); foreach( Metadata md in metadataObjects) { var tmp = md.Function; // <-- Error: does not contain a definition for Function } The exact error is: error CS1061: 'Metadata' does not contain a definition for 'Function' and no extension method 'Function' accepting a first argument of type 'Metadata' could be found (are you missing a using directive or an assembly reference?) I believe it's because the abstract class does not define the property Function, thus the whole effort is completely useless. Is there a way that we can get the properties?

    Read the article

  • structDelete doesn't effect the shallow copy?

    - by Travis
    I was playing around onError so I tried to create an error using a large xml document object. <cfset variables.XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset variables.startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset variables.stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

    Read the article

  • itearation through gridview

    - by user1405508
    I want to get cell value from gridview,but empty string is returned .I am implemented code in selectedindexchanged event of radiobuttonlist .I iterate through gridview and access cell by code .but problem is stll remaining.I used three itemtemplate ,each has one elemnt so that each element get its own coulmn .aspx <asp:GridView ID="GridView2" runat="server" AutoGenerateColumns="false" > <Columns> <asp:Label ID="Label2" runat="server" Text='<%# Eval("qno") %>'> </asp:Label> </ItemTemplate> </asp:TemplateField> <asp:TemplateField> <ItemTemplate> <asp:Label ID="Label3" runat="server" Text='<%# Eval("description") %>'> </ItemTemplate> </asp:TemplateField> <asp:RadioButtonList ID="RadioButtonList1" RepeatDirection="Horizontal" runat="server" OnSelectedIndexChanged="changed" AutoPostBack="true" > <asp:ListItem Value="agree" Selected="True" > </asp:ListItem> <asp:ListItem Value="disagree"> </asp:ListItem> <asp:ListItem Value="strongagree"> </asp:ListItem> <asp:ListItem Value="strondisagree"> </asp:ListItem> </asp:RadioButtonList> </Columns> </asp:GridView> <asp:Label ID="Labe11" runat="server" ></asp:Label> Code behind: public void changed(object sender, EventArgs e) { for(int i=0;i<GridView2.Rows.Count;i++) { string labtext; RadioButtonList list = GridView2.Rows[i].Cells[2].FindControl("RadioButtonList1") as RadioButtonList; labtext= GridView2.Rows[i].Cells[0].Text; Label1.Text = labtext; } }

    Read the article

  • WPF & Linq To SQL binding ComboBox to foreign key

    - by ZeroDelta
    I'm having trouble binding a ComboBox to a foreign key in WPF using Linq To SQL. It works fine when displaying records, but if I change the selection on the ComboBox, that change does not seem to affect the property to which it is bound. My SQL Server Compact file has three tables: Players (PK is PlayerID), Events (PK is EventID), and Matches (PK is MatchID). Matches has FKs for the the other two, so that a match is associated with a player and an event. My window for editing a match uses a ComboBox to select the Event, and the ItemsSource is set to the result of a LINQ query to pull all of the Events. And of course the user should be able to select the Event based on EventName, not EventID. Here's the XAML: <ComboBox x:Name="cboEvent" DisplayMemberPath="EventName" SelectedValuePath="EventID" SelectedValue="{Binding Path=EventID, UpdateSourceTrigger=PropertyChanged}" /> And some code-behind from the Loaded event handler: var evt = from ev in db.Events orderby ev.EventName select ev; cboEvent.ItemsSource = evt.ToList(); var mtch = from m in db.Matches where m.PlayerID == ((Player)playerView.CurrentItem).PlayerID select m; matchView = (CollectionView)CollectionViewSource.GetDefaultView(mtch); this.DataContext = matchView; When displaying matches, this works fine--I can navigate from one match to the next and the EventName is shown correctly. However, if I select a new Event via this ComboBox, the CurrentItem of the CollectionView doesn't seem to change. I feel like I'm missing something stupid! Note: the Player is selected via a ListBox, and that selection filters the matches displayed--this seems to be working fine, so I didn't include that code. That is the reason for the "PlayerID" reference in the LINQ query

    Read the article

  • Should I use early returns in C#?

    - by Bobby
    I've learned Visual Basic and was always taught to keep the flow of the program without interruptions, like Goto, Exit and Return. Using nested ifs instead of one return statement seems very natural to me. Now that I'm partly migrating towards C#, I wonder what the best practice is for C-like languages. I've been working on a C# project for some time, and of course discover more code of ExampleB and it's hurting my mind somehow. But what is the best practice for this, what is more often used and are there any reasons against one of the styles? public void ExampleA() { if (a != b) { if (a != c) { bool foundIt; for (int i = 0; i < d.Count && !foundIt; i++) { if (element == f) foundIt = true; } } } } public void ExampleB() { if (a == b) return; if (a == c) return; foreach (object element in d) { if (element == f) break; } }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Python coin-toss

    - by Andy
    i am new to Python, and i can't wrap my head around this. I have following function defined: def FlipCoins(num_flips): heads_rounds_won = 0 for i in range(10000): heads = 0 tails = 0 for j in range(num_flips): dice = random.randint(0,1) if dice==1: heads += 1 else: tails += 1 if heads > tails: heads_rounds_won += 1 return heads_rounds_won Here is what it should do (but apparently doesn't): flip a coin num_flip times, count heads and tails, and see if there are more heads than tails. If yes, increment head_rounds_won by 1. Repeat 10000 times. I would assume that head_rounds_won will approximate 5000 (50%). And it does that for odd numbers as input. For example, 3, 5 or 7 will produce about 50%. However, even numbers will produce much lower results, more like 34%. Small numbers especially, with higher even numbers, like for example 800, the difference to 50% is much narrower. Why is this the case? Shouldn't any input produce about 50% heads/tails?

    Read the article

  • LINQ to SQL Converter

    - by user609511
    How can I convert My LINQ to SQL ? i have this LINQ statement: int LimCol = Convert.ToInt32(LimitColis); result = oListTUP .GroupBy(x => new { x.Item1, x.Item2, x.Item3, x.Item4, x.Item5 }) .Select(g => new { Key = g.Key, Sum = g.Sum(x => x.Item6), Poids = g.Sum(x => x.Item7), }) .Select(p => new { Key = p.Key, Items = Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, p.Sum % LimCol > 0 ? 1 : 0)), CalculPoids = p.Poids / Enumerable.Repeat(LimCol, p.Sum / LimCol).Concat(Enumerable.Repeat(p.Sum % LimCol, p.Sum % LimCol > 0 ? 1 : 0)).Count() }) .SelectMany(p => p.Items.Select(i => Tuple.Create(p.Key.Item1, p.Key.Item2, p.Key.Item3, p.Key.Item4, p.Key.Item5, i, p.CalculPoids))) .ToList(); } It works well, but somehow want to push it and it become too complicated, so I want to convert it into Pure SQL. I have tried SQL Profiler and LinqPad, but neither shows me the SQL. How can I see the SQL code from My LINQ ? Thank you in advance.

    Read the article

< Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >