Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 650/776 | < Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >

• SIlverlight Navigate: how does it work? How would you implement in f# w/o VS wizards and helpers?

  - by akaphenom

  After a nights sleep the problem can be stated more accurately as I have a 100% f# / silverlight implementation and am looking to use the built in Navigation components. C# creates page.xaml and page.xaml.cs um - ok; but what is the relationship at a fundamental level? How would I go about doing this in f#? The applcuation is loaded in the default module, and I pull the XAML in and reference it from the application object. Do I need to create instances / references to the pages from within the application object? Or set up some other page management object with the proper name value pairs? When all the Help of VS is stripped away - what are we left with? original post (for those who may be reading replies) I have a 100% silverlight 3.0 / f# 2.0 application I am wrapping my brain around. I have the base application loading correctly - and now I want to add the naigation controls to it. My page is stored as an embedded resource - but the Frame.Navigate takes a URI. I know what I have is wrong but here it is: let nav : Frame = mainGrid ? mainFrame let url = "/page1.xaml" let uri = new System.Uri(url, System.UriKind.Relative) ; nav.Navigate uri Any thoughts?

  Read the article

• performing more than one Where in query return null!!! why? how to fix this?

  - by Sadegh

  hi, i have wrote a method that filters output with provided query and return it. when one Where excuted; it return correct output but when more than one Where excuted; output is null and Exception occured with message "Enumeration yielded no results". why? how i can fix it? public IQueryable<SearchResult> PerformSearch(string query, int skip = 0, int take = 5) { if (!string.IsNullOrEmpty(query)) { var queryList = query.Split('+').ToList(); var results = GENERATERESULTS(); string key; foreach (string _q in queryList) { if (_q.StartsWith("(") && _q.EndsWith(")")) { key = _q.Replace("(", "").Replace(")", ""); results = results.Where(q => q.Title.Contains(key, StringComparison.CurrentCultureIgnoreCase)); } else if (_q.StartsWith("\"") && _q.EndsWith("\"")) { key = _q.Replace("\"", "").Replace("\"", ""); results = results.Where(q => q.Title.Contains(key, StringComparison.CurrentCulture)); } else if (_q.StartsWith("-(") && _q.EndsWith(")")) { key = _q.Replace("-(", "").Replace(")", ""); results = results.Where(q=> !q.Title.Contains(key, StringComparison.CurrentCultureIgnoreCase)); } else { key = _q; results = results.Where(q => q.Title.Contains(key, StringComparison.CurrentCulture)); } } this._Count = results.Count(); results = results.Skip(skip).Take(take); this._EndOn = DateTime.Now; this.ExecutionTime(); return results; } else return null; } thanks in advance ;)

  Read the article

• public class ImageHandler : IHttpHandler

  - by Ken

  cmd.Parameters.AddWithValue("@id", new system.Guid (imageid)); What using System reference would this require? Here is the handler: using System; using System.Collections.Specialized; using System.Web; using System.Web.Configuration; using System.Web.Security; using System.Globalization; using System.Configuration; using System.Data.SqlClient; using System.Data; using System.IO; using System.Web.Profile; using System.Drawing; public class ImageHandler : IHttpHandler { public void ProcessRequest(HttpContext context) { string imageid; if (context.Request.QueryString["id"] != null) imageid = (context.Request.QueryString["id"]); else throw new ArgumentException("No parameter specified"); context.Response.ContentType = "image/jpeg"; Stream strm = ShowProfileImage(imageid.ToString()); byte[] buffer = new byte[8192]; int byteSeq = strm.Read(buffer, 0, 8192); while (byteSeq > 0) { context.Response.OutputStream.Write(buffer, 0, byteSeq); byteSeq = strm.Read(buffer, 0, 8192); } //context.Response.BinaryWrite(buffer); } public Stream ShowProfileImage(String imageid) { string conn = ConfigurationManager.ConnectionStrings["MyConnectionString1"].ConnectionString; SqlConnection connection = new SqlConnection(conn); string sql = "SELECT image FROM Profile WHERE UserId = @id"; SqlCommand cmd = new SqlCommand(sql, connection); cmd.CommandType = CommandType.Text; cmd.Parameters.AddWithValue("@id", new system.Guid (imageid));//Failing Here!!!! connection.Open(); object img = cmd.ExecuteScalar(); try { return new MemoryStream((byte[])img); } catch { return null; } finally { connection.Close(); } } public bool IsReusable { get { return false; } } }

  Read the article

• How to find whole graph coverage path in dynamic state-flow diagram?

  - by joseph

  Hello, As I've been researching algorithms for path finding in graph, I found interesting problem. Definition of situation: 1)State diagram can have p states, and s Boolean Fields, and z Int Fields 2)Every state can have q ingoing and r outgoing transitions, and h Int fields (h belongs to z - see above) 3)Every transition can have only 1 event, and only 1 action 4)every action can change n Boolean Fields, and x Int Fields 5)every event can have one trigger from combination of any count of Boolean Fields in diagram 6)Transition can be in OPEN/CLOSED form. If the transition is open/closed depends on trigger2 compounded from 0..c Boolean fields. 7) I KNOW algorithm for finding shortest paths from state A to state B. 8) I KNOW algorithm for finding path that covers all states and transitions of whole state diagram, if all transitions are OPEN. Now, what is the goal: I need to find shortest path that covers all states and transitions in dynamically changing state diagram described above. When an action changes some int field, the algorithm should go through all states that have changed int field. The algorithm should also be able to open and close transition (by going through transitions that open and close another transitions by action) in the way that the founded path will be shortest and covers all transitions and states. Any idea how to solve it? I will be really pleased for ANY idea. Thanks for answers.

  Read the article

• Why does my simple event handling example not work?

  - by njreed

  I am trying to make a simple event handler. (Note, I'm not trying to implement a full-blown publish/subscribe model; I'm just interested in why my example doesn't work as I think it should) var myObj = (function () { var private = "X"; function triggerEvent(eventName) { if (this[eventName]) { this[eventName](); } } // Setter / Getter function getProp() { return private; } function setProp(value) { private = value; triggerEvent("onPropChange"); } // Public API return { // Events "onPropChange": null, // Fires when prop value is changed // Methods "getProp": getProp, "setProp": setProp }; })(); // Now set event handler myObj.onPropChange = function () { alert("You changed the property!"); }; myObj.setProp("Z"); // --> Nothing happens. Wrong // Why doesn't my alert show? I set the onPropChange property of my object to a simpler handler function but it is not being fired. I have debugged this and it seems that in triggerEvent the variable this is referencing the global window object. I thought it should reference myObj (which is what I need). Can someone explain the error in my thinking and how I correct this? Help much appreciated. jsFiddle here

  Read the article

• Include php code within echo from a random text

  - by lisa

  I want to display a php code at random and so for I have <?php // load the file that contain thecode $adfile = "code.txt"; $ads = array(); // one line per code $fh = fopen($adfile, "r"); while(!feof($fh)) { $line = fgets($fh, 10240); $line = trim($line); if($line != "") { $ads[] = $line; } } // randomly pick an code $num = count($ads); $idx = rand(0, $num-1); echo $ads[$idx]; ?> The code.txt has lines like <?php print insert_proplayer( array( "width" => "600", "height" => "400" ), "http://www.youtube.com/watch?v=xnPCpCVepCg"); ?> Proplayer is a wordpress plugin that displays a video. The codes in code.txt work well, but not when I use the pick line from code.txt. Instead of the full php line I get: "width" => "600", "height" => "400" ), "http://www.youtube.com/watch?v=xnPCpCVepCg"); ?> How can I make the echo show the php code, rather than a txt version of the php code?

  Read the article

• Should we point to an NSManagedObject entity with weak instead of strong pointer?

  - by Jim Thio

  I think because NSManagedObject is managed by the managedObject context the pointer should be weak. Yet it often goes back to 0 in my cases. for (CategoryNearby * CN in sorted) { //[arrayOfItems addObject:[NSString stringWithFormat:@"%@ - %d",CN.name,[CN.order intValue]]]; NearbyShortcutTVC * tvc=[[NearbyShortcutTVC alloc]init]; tvc.categoryNearby =CN; // tvc.titleString=[NSString stringWithFormat:@"%@",CN.name]; // tvc.displayed=CN.displayed; [arrayOfItemsLocal addObject:tvc]; //CN PO(tvc); PO(tvc.categoryNearby); while (false); } self.arrayOfItems = arrayOfItemsLocal; PO(self.categoriesNearbyInArrayOfItems); [self.tableViewa reloadData]; ... Yet somewhere down the line: tvc.categoryNearby becomes nil. I do not know how or when or where it become nil. How do I debug this? Or should the reference be strong instead? This is the interface of NearbyShortcutTVC by the way @interface NearbyShortcutTVC : BGBaseTableViewCell{ } @property (weak, nonatomic) CategoryNearby * categoryNearby; @end To make sure that we're talking about the same object I print all the memory addresses of the NSArray They're both the exact same object. But somehow the categoryNearby property of the object is magically set to null somewhere. self.categoriesNearbyInArrayOfItems: ( 0x883bfe0, 0x8b6d420, 0x8b6f9f0, 0x8b71de0, 0xb073f90, 0xb061a10, 0xb06a880, 0x8b74940, 0x8b77110, 0x8b794e0, 0x8b7bf40, 0x8b7cef0, 0x8b7f4b0, 0x8b81a30, 0x88622d0, 0x8864e60, 0xb05c9a0 ) self.categoriesNearbyInArrayOfItems: ( 0x883bfe0, 0x8b6d420, 0x8b6f9f0, 0x8b71de0, 0xb073f90, 0xb061a10, 0xb06a880, 0x8b74940, 0x8b77110, 0x8b794e0, 0x8b7bf40, 0x8b7cef0, 0x8b7f4b0, 0x8b81a30, 0x88622d0, 0x8864e60, 0xb05c9a0 )

  Read the article

• Clearing Session in Global Application_Error

  - by Zarigani

  Whenever an unhandled exception occurs on our site, I want to: Send a notification email Clear the user's session Send the user to a error page ("Sorry, a problem occurred...") The first and last I've had working for a long time but the second is causing me some issues. My Global.asax.vb includes: Sub Application_Error(ByVal sender As Object, ByVal e As EventArgs) ' Send exception report Dim ex As System.Exception = Nothing If HttpContext.Current IsNot Nothing AndAlso HttpContext.Current.Server IsNot Nothing Then ex = HttpContext.Current.Server.GetLastError End If Dim eh As New ErrorHandling(ex) eh.SendError() ' Clear session If HttpContext.Current IsNot Nothing AndAlso HttpContext.Current.Session IsNot Nothing Then HttpContext.Current.Session.Clear() End If ' User will now be sent to the 500 error page (by the CustomError setting in web.config) End Sub When I run a debug, I can see the session being cleared, but then on the next page the session is back again! I eventually found a reference that suggests that changes to session will not be saved unless Server.ClearError is called. Unfortunately, if I add this (just below the line that sets "ex") then the CustomErrors redirect doesn't seem to kick in and I'm left with a blank page? Is there a way around this?

  Read the article

• Batch insert mode with hibernate and oracle: seems to be dropping back to slow mode silently

  - by Chris

  I'm trying to get a batch insert working with Hibernate into Oracle, according to what i've read here: http://docs.jboss.org/hibernate/core/3.3/reference/en/html/batch.html , but with my benchmarking it doesn't seem any faster than before. Can anyone suggest a way to prove whether hibernate is using batch mode or not? I hear that there are numerous reasons why it may silently drop into normal mode (eg associations and generated ids) so is there some way to find out why it has gone non-batch? My hibernate.cfg.xml contains this line which i believe is all i need to enable batch mode: <property name="jdbc.batch_size">50</property> My insert code looks like this: List<LogEntry> entries = ..a list of 100 LogEntry data classes... Session sess = sessionFactory.getCurrentSession(); for(LogEntry e : entries) { sess.save(e); } sess.flush(); sess.clear(); My 'logentry' class has no associations, the only interesting field is the id: @Entity @Table(name="log_entries") public class LogEntry { @Id @GeneratedValue public Long id; ..other fields - strings and ints... However, since it is oracle, i believe the @GeneratedValue will use the sequence generator. And i believe that only the 'identity' generator will stop bulk inserts. So if anyone can explain why it isn't running in batch mode, or how i can find out for sure if it is or isn't in batch mode, or find out why hibernate is silently dropping back to slow mode, i'd be most grateful. Thanks

  Read the article

• cellForRowAtIndexPath not called for all sections

  - by Wynn

  I have a UITableView that has five sections. Just as the title describes cellForRowAtIndexPath is only being called for the first four. All connections have been made concerning the datasource and delegate. Also, my numberOfSectionsInTableView clearly returns 5. Printing out the number of sections from within cellForRowAtIndexPath shows the correct number, thus confirming that cellForRowAtIndexPath is simply not being called for all sections. What on earth is going on? I looked pretty hard for an answer to this question but could't find one. If this has already been answered please forgive me and point me in the correct direction. My cellForRowAtIndexPath: - (UITableViewCell *)tableView:(UITableView *)theTableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; UITableViewCell *cell = [theTableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[UITableViewCell alloc] initWithStyle:UITableViewCellStyleDefault reuseIdentifier:CellIdentifier]; } switch (indexPath.section) { case 0: cell.textLabel.text = ticket.description; break; case 1: cell.textLabel.text = ticket.ticketStatus; break; case 2: cell.textLabel.text = ticket.priority; break; case 3: cell.textLabel.text = ticket.customerOfficePhone; break; case 4: { //This never ever gets executed Comment *comment = [ticket.comments objectAtIndex:indexPath.row]; cell.textLabel.text = comment.commentContent; break; } } return cell; } My numberOfSectionsInTableView: - (NSInteger)numberOfSectionsInTableView:(UITableView *)tableView { return 5; } My numberOfRowsInSection: - (NSInteger)tableView:(UITableView *)tableView numberOfRowsInSection:(NSInteger)section { NSInteger numberOfRows; if (section == 4) { numberOfRows = [ticket.comments count]; } else { numberOfRows = 1; } return numberOfRows; } Any suggestions are appreciated. Thanks in advance.

  Read the article

• IIS 6.0 Rewrite rules for Wordpress (Forward slash not working and other things)

  - by DigitalBlade

  Hi, I am using Wordpress 3.0.4 on IIS 6.0 and Windows Server 2003, hosted by a company. I was having lots of issues using permalinks. I have fixed most, but now I have an issue with a forward-slash not being added to the address. This would be fine on most websites, but not on IIS for some reason. Specifically, if I go to "mysite.com/wp-admin" I can log-in and get to the dashboard, but as soon as I click anything there i am redirected to a broken link. For example: "mysite.com/post-new.php". If I add the slash at the end it's fine. So I tried to have a rewrite rule to automatically add the slash to such address: RewriteRule /wp-admin /wp-admin/ [L] But it still doesn't work. For your reference, here's the complete file: [ISAPI_Rewrite] RewriteBase / RewriteCond ${REQUEST_FILENAME} !-f RewriteCond ${REQUEST_FILENAME} !-d # For special WordPress folders (e.g. theme, admin, etc.) RewriteRule /wp-admin /wp-admin/ [L] RewriteRule /wp-(.*) /wp-$1 [L] RewriteRule /(.*\.(?:jpg|jpeg|gif|css|txt|xml|html|png|js)) /$1 [I,L] # Rules to ensure that normal content gets through RewriteRule /images/(.*) /images/$1 [L] RewriteRule /favicon.ico /favicon.ico [L] RewriteRule /robots.txt /robots.txt [L] RewriteRule /phpmyadmin/(.*) /phpmyadmin/$1 [L] RewriteRule /phpmyadmin /phpmyadmin/ [L] # For all WordPress pages RewriteRule ^/$ /index.php [L] RewriteRule /(.*) /index.php/$1 [L] Any ideas? Thanks in advance

  Read the article

• unexpected behaviour of object stored in web service Session

  - by draconis

  Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

  Read the article

• Use a foreign key mapping to get data from the other table using Python and SQLAlchemy.

  - by Az

  Hmm, the title was harder to formulate than I thought. Basically, I've got these simple classes mapped to tables, using SQLAlchemy. I know they're missing a few items but those aren't essential for highlighting the problem. class Customer(object): def __init__(self, uid, name, email): self.uid = uid self.name = name self.email = email def __repr__(self): return str(self) def __str__(self): return "Cust: %s, Name: %s (Email: %s)" %(self.uid, self.name, self.email) The above is basically a simple customer with an id, name and an email address. class Order(object): def __init__(self, item_id, item_name, customer): self.item_id = item_id self.item_name = item_name self.customer = None def __repr__(self): return str(self) def __str__(self): return "Item ID %s: %s, has been ordered by customer no. %s" %(self.item_id, self.item_name, self.customer) This is the Orders class that just holds the order information: an id, a name and a reference to a customer. It's initialised to None to indicate that this item doesn't have a customer yet. The code's job will assign the item a customer. The following code maps these classes to respective database tables. # SQLAlchemy database transmutation engine = create_engine('sqlite:///:memory:', echo=False) metadata = MetaData() customers_table = Table('customers', metadata, Column('uid', Integer, primary_key=True), Column('name', String), Column('email', String) ) orders_table = Table('orders', metadata, Column('item_id', Integer, primary_key=True), Column('item_name', String), Column('customer', Integer, ForeignKey('customers.uid')) ) metadata.create_all(engine) mapper(Customer, customers_table) mapper(Orders, orders_table) Now if I do something like: for order in session.query(Order): print order I can get a list of orders in this form: Item ID 1001: MX4000 Laser Mouse, has been ordered by customer no. 12 What I want to do is find out customer 12's name and email address (which is why I used the ForeignKey into the Customer table). How would I go about it?

  Read the article

• Stored Procedure: Reducing Table Data

  - by SumGuy

  Hi Guys, A simple question about Stored Procedures. I have one stored procedure collecting a whole bunch of data in a table. I then call this procedure from within another stored procedure. I can copy the data into a new table created in the calling procedure but as far as I can see the tables have to be identical. Is this right? Or is there a way to insert only the data I want? For example.... I have one procedure which returns this: SELECT @batch as Batch, @Count as Qty, pd.Location, cast(pd.GL as decimal(10,3)) as [Length], cast(pd.GW as decimal(10,3)) as Width, cast(pd.GT as decimal(10,3)) as Thickness FROM propertydata pd GROUP BY pd.Location, pd.GL, pd.GW, pd.GT I then call this procedure but only want the following data: DECLARE @BatchTable TABLE ( Batch varchar(50), [Length] decimal(10,3), Width decimal(10,3), Thickness decimal(10,3), ) INSERT @BatchTable (Batch, [Length], Width, Thickness) EXEC dbo.batch_drawings_NEW @batch So in the second command I don't want the Qty and Location values. However the code above keeps returning the error: "Insert Error: Column name or number of supplied values does not match table"

  Read the article

• ListView - Index and Position Behavior upon restart()

  - by tunneling

  I am using a ListView with an ArrayAdapter that holds objects. When I select an item, I am capturing the position and index of the selected item. If I scroll down prior to selection, the position and index represent the location of the item in the list. Selecting that items takes me to another activity. When I use the back button to return to the list, it seems that the ListView get's a new position and index for the visible items. As a result, I can't figure out how to reference the selected item during the restart() of the ListView Activity. I have tried to caputure position and index, but as I've said, they change upon returning to the Activity. Is my understanding of the ListView "redraw" correct? Does it renumber my items based on what's visible? -When in the life cycle is getView() called? Is there a way to force an update to the ListView so that my caputured index still points to the same object? Thanks, Jason

  Read the article

• Run code before class instanciation in ActionScript 3

  - by soow.fr

  I need to run code in a class declaration before its instanciation. This would be especially useful to automatically register classes in a factory. See: // Main.as public class Main extends Sprite { public function Main() : void { var o : Object = Factory.make(42); } } // Factory.as public class Factory { private static var _factory : Array = new Array(); public static function registerClass(id : uint, c : Class) : void { _factory[id] = function () : Object { return new c(); }; } public static function make(id : uint) : Object { return _factory[id](); } } // Foo.as public class Foo { // Run this code before instanciating Foo! Factory.registerClass(42, Foo); } AFAIK, the JIT machine for the ActionScript language won't let me do that since no reference to Foo is made in the Main method. The Foo class being generated, I can't (and don't want to) register the classes in Main: I'd like to register all the exported classes in a specific package (or library). Ideally, this would be done through package introspection, which doesn't exist in ActionScript 3. Do you know any fix (or other solution) to my design issue?

  Read the article

• Constructor initializer list: code from the C++ Primer, chapter 16

  - by Alexandros Gezerlis

  Toward the end of Chapter 16 of the "C++ Primer" I encountered the following code (I've removed a bunch of lines): class Sales_item { public: // default constructor: unbound handle Sales_item(): h() { } private: Handle<Item_base> h; // use-counted handle }; My problem is with the Sales_item(): h() { } line. For the sake of completeness, let me also quote the parts of the Handle class template that I think are relevant to my question (I think I don't need to show the Item_base class): template <class T> class Handle { public: // unbound handle Handle(T *p = 0): ptr(p), use(new size_t(1)) { } private: T* ptr; // shared object size_t *use; // count of how many Handles point to *ptr }; I would have expected something like either: a) Sales_item(): h(0) { } which is a convention the authors have used repeatedly in earlier chapters, or b) Handle<Item_base>() if the intention was to invoke the default constructor of the Handle class. Instead, what the book has is Sales_item(): h() { }. My gut reaction is that this is a typo, since h() looks suspiciously similar to a function declaration. On the other hand, I just tried compiling under g++ and running the example code that uses this class and it seems to be working correctly. Any thoughts?

  Read the article

• Click behaviour - Difference in IE and FF ?!

  - by OlliD

  Hey folks, i just came to the conclusion that a project i am currently working on might have a "logical" error in functionality. Currently I'am using server technology with PHP/MySQL and JQuery. Within the page there's a normal link reference with tag <a href="contentpage?page=xxx">next step</a> The pain point now seems to be the given jquery click event on the same element. The intension was to save the (current) content of the page (- form elements) via another php script using the php session command. For any reason, IE can handle the click event of Jquery right before executing the standard html command, that reloads the current page again with the new page parameter. By using FF the behaviour is different. I assume, that FF first execute the html command and afterwards execute the javascript code which handles the click event. Therefore the resultset here is wrong respectivly empty. My question now is whether you made the same experience and how you handled / wordarrounded this problem. I'd be thankful fur any of your tips or further feedback. Maybe you also have a solution on how to rethink about the current architecture. Regards, Oliver

  Read the article

• twitter streaming api instead of search api

  - by user1711576

  I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

  Read the article

• string comparision and counting the key in target [closed]

  - by mesun

  Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

  Read the article

• Application Code Redesign to reduce no. of Database Hits from Performance Perspective

  - by Rachel

  Scenario I want to parse a large CSV file and inserts data into the database, csv file has approximately 100K rows of data. Currently I am using fgetcsv to parse through the file row by row and insert data into Database and so right now I am hitting database for each line of data present in csv file so currently database hit count is 100K which is not good from performance point of view. Current Code: public function initiateInserts() { //Open Large CSV File(min 100K rows) for parsing. $this->fin = fopen($file,'r') or die('Cannot open file'); //Parsing Large CSV file to get data and initiate insertion into schema. while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) { $query = "INSERT INTO dt_table (id, code, connectid, connectcode) VALUES (:id, :code, :connectid, :connectcode)"; $stmt = $this->prepare($query); // Then, for each line : bind the parameters $stmt->bindValue(':id', $data[0], PDO::PARAM_INT); $stmt->bindValue(':code', $data[1], PDO::PARAM_INT); $stmt->bindValue(':connectid', $data[2], PDO::PARAM_INT); $stmt->bindValue(':connectcode', $data[3], PDO::PARAM_INT); // Execute the statement $stmt->execute(); $this->checkForErrors($stmt); } } I am looking for a way wherein instead of hitting Database for every row of data, I can prepare the query and than hit it once and populate Database with the inserts. Any Suggestions !!! Note: This is the exact sample code that I am using but CSV file has more no. of field and not only id, code, connectid and connectcode but I wanted to make sure that I am able to explain the logic and so have used this sample code here. Thanks !!!

  Read the article

• SQL Server 2008 Stored Proc suddenly returns -1

  - by aaginor

  I use the following stored procedure from my SQL Server 2008 database to return a value to my C#-Program ALTER PROCEDURE [dbo].[getArticleBelongsToCatsCount] @id int AS BEGIN SET NOCOUNT ON; DECLARE @result int; set @result = (SELECT COUNT(*) FROM art_in_cat WHERE child_id = @id); return @result; END I use a SQLCommand-Object to call this Stored Procedure public int ExecuteNonQuery() { try { return _command.ExecuteNonQuery(); } catch (Exception e) { Logger.instance.ErrorRoutine(e, "Text: " + _command.CommandText); return -1; } } Till recently, everything works fine. All of a sudden, the stored procedure returned -1. At first, I suspected, that the ExecuteNonQuery-Command would have caused and Exception, but when stepping through the function, it shows that no Exception is thrown and the return value comes directly from return _command.ExecuteNonQuery(); I checked following parameters and they were as expected: - Connection object was set to the correct database with correct access values - the parameter for the SP was there and contained the right type, direction and value Then I checked the SP via SQLManager, I used the same value for the parameter like the one for which my C# brings -1 as result (btw. I checked some more parameter values in my C' program and they ALL returned -1) but in the manager, the SP returns the correct value. It looks like the call from my C# prog is somehow bugged, but as I don't get any error (it's just the -1 from the SP), I have no idea, where to look for a solution.

  Read the article

• Multiple generic types in one container

  - by Lirik

  I was looking at the answer of this question regarding multiple generic types in one container and I can't really get it to work: the properties of the Metadata class are not visible, since the abstract class doesn't have them. Here is a slightly modified version of the code in the original question: public abstract class Metadata { } public class Metadata<T> : Metadata { // ... some other meta data public T Function{ get; set; } } List<Metadata> metadataObjects; metadataObjects.Add(new Metadata<Func<double,double>>()); metadataObjects.Add(new Metadata<Func<int,double>>()); metadataObjects.Add(new Metadata<Func<double,int>>()); foreach( Metadata md in metadataObjects) { var tmp = md.Function; // <-- Error: does not contain a definition for Function } The exact error is: error CS1061: 'Metadata' does not contain a definition for 'Function' and no extension method 'Function' accepting a first argument of type 'Metadata' could be found (are you missing a using directive or an assembly reference?) I believe it's because the abstract class does not define the property Function, thus the whole effort is completely useless. Is there a way that we can get the properties?

  Read the article

• A little confused about MVC and where to put a database query

  - by jax

  OK, so my Joomla app is in MVC format. I am still a little confused about where to put certain operations, in the Controller or in the Model. This function below is in the controller, it gets called when &task=remove. Should the database stuff be in the Model? It does not seem to fit there because I have two models editapp (display a single application) and allapps (display all the applications), now which one would I put the delete operation in? /** * Delete an application */ function remove() { global $mainframe; $cid = JRequest::getVar( 'cid', array(), '', 'array' ); $db =& JFactory::getDBO(); //if there are items to delete if(count($cid)){ $cids = implode( ',', $cid ); $query = "DELETE FROM #__myapp_apps WHERE id IN ( $cids )"; $db->setQuery( $query ); if (!$db->query()){ echo "<script> alert('".$db->getErrorMsg()."');window.history.go(-1); </script>\n"; } } $mainframe->redirect( 'index.php?option=' . $option . '&c=apps'); } I am also confused about how the flow works. For example, there is a display() function in the controller that gets called by default. If I pass a task, does the display() function still run or does it go directly to the function name passed by $task?

  Read the article

• Is there a way to detect Layout or Display changes in WPF?

  Hello! I am trying to check how fast the Frame control can display a FixedPage object when it is assigned to Frame.Content property. I plan to check the tick count before and after the assignment to the Content property. Example: int starttime = Environment.TickCount; frame1.Content = fixedpage; int endtime = Environment.TickCount; The problem is that the assignment to the Content property might be asynchronous and returns immediately therefore i get a zero amount of time. The rendering of the FixedPage however visually has a lag time from assignment of the Content property up to the point where the FixedPage appears on screen. The Frame.ContentChanged() event is no good either because it gets triggered even before the FixedPage appears on screen so it's not accurate. I'm thinking of detecting the change on the window or control's display instead in order to get the time when the FixedPage is actually displayed on screen. Is there a way to do this in WPF? Thanks!

  Read the article

< Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >