Search Results

Search found 19393 results on 776 pages for 'reference count'.

Page 650/776 | < Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >

  • Designing a chain of states

    - by devoured elysium
    I want to model a kind of FSM(Finite State Machine). I have a sequence of states (let's say, from StateA to StateZ). This sequence is called a Chain and is implemented internally as a List. I will add states by the order I want them to run. My purpose is to be able to make a sequence of actions in my computer (for example, mouse clicks). (I know this has been done a zillion times). So a state is defined as a: boolean Precondition() <- Checks to see if for this state, some condition is true. For example, if I want to click in the Record button of a program, in this method I would check if the program's process is running or not. If it is, go to the next state in the chain list, otherwise, go to what was defined as the fail state (generally is the first state of them all). IState GetNextState() <- Returns the next state to evaluate. If Precondition() was sucessful, it should yield the next state in the chain otherwise it should yield the fail state. Run() Simply checks the Precondition() and sets the internal data so GetNextState() works as expected. So, a naive approach to this would be something like this: Chain chain = new Chain(); //chain.AddState(new State(Precondition, FailState, NextState) <- Method structure chain.AddState(new State(new WinampIsOpenCondition(), null, new <problem here, I want to referr to a state that still wasn't defined!>); The big problem is that I want to make a reference to a State that at this point still wasn't defined. I could circumvent the problem by using strings when refrering to states and using an internal hashtable, but isn't there a clearer alternative? I could just pass only the pre-condition and failure states in the constructor, having the chain just before execution put in each state the correct next state in a public property but that seems kind of awkward.

    Read the article

  • PHP Function parameters - problem with var not being set

    - by Marty
    So I am obviously not a very good programmer. I have written this small function: function dispAdjuggler($atts) { extract(shortcode_atts(array( 'slot' => '' ), $atts)); $adspot = ''; $adtype = ''; // Get blog # we're on global $blog_id; switch ($blog_id) { case 1: // root blog HOME page if (is_home()) { switch ($slot) { case 'top_leaderboard': $adspot = '855525'; $adtype = '608934'; break; case 'right_halfpage': $adspot = '855216'; $adtype = '855220'; break; case 'right_med-rectangle': $adspot = '858222'; $adtype = '613526'; break; default: throw new Exception("Ad slot is not defined"); break; } When I reference the function on a page like so: <?php dispAdjuggler("top_leaderboard"); ?> The switch is throwing the default exception. What am I doing wrong here? Thanks!!

    Read the article

  • UIDocumentInteractionController & ARC: [UIPopoverController dealloc] reached while popover is still visible

    - by muffel
    This issue or similar issues have been discussed here before, but I didn't find any working solution for me. I am using the following code to display a UIDocumentInteractionController on an ARC-enabled iOS 7 project: - (void) exportDoc{ // [...] docController = [UIDocumentInteractionController interactionControllerWithURL:[NSURL fileURLWithPath:path]]; docController.delegate = self; [docController presentOpenInMenuFromBarButtonItem:mainMenuButton animated:YES]; } First I didn't want to create a property that holds the controller reference, but as many people said that there are not alternatives to it. It is defined as @property (strong) UIDocumentInteractionController* docController; exportDoc is run in the main thread using NSOperationQueue. Whenever it is executed, I get the following error message: Terminating app due to uncaught exception 'NSGenericException', reason: '-[UIPopoverController dealloc] reached while popover is still visible.' This is what the backtrace says: (lldb) bt * thread #1: tid = 0x1c97d9, 0x000000019a23c1c0 libobjc.A.dylibobjc_exception_throw, queue = 'com.apple.main-thread', stop reason = breakpoint 2.1 frame #0: 0x000000019a23c1c0 libobjc.A.dylibobjc_exception_throw frame #1: 0x000000018d982e90 CoreFoundation+[NSException raise:format:] + 128 frame #2: 0x0000000190bc348c UIKit-[UIPopoverController dealloc] + 96 frame #3: 0x0000000190e18fc8 UIKit-[UIDocumentInteractionController dealloc] + 168 frame #4: 0x000000019a255474 libobjc.A.dylib(anonymous namespace)::AutoreleasePoolPage::pop(void*) + 524 frame #5: 0x000000018d881988 CoreFoundation_CFAutoreleasePoolPop + 28 frame #6: 0x000000018e42cb18 Foundation-[NSOperationInternal _start:] + 892 frame #7: 0x000000018e4eea38 Foundation__NSOQSchedule_f + 76 frame #8: 0x000000019a813fd4 libdispatch.dylib_dispatch_client_callout + 16 frame #9: 0x000000019a8171dc libdispatch.dylib_dispatch_main_queue_callback_4CF + 336 frame #10: 0x000000018d942c2c CoreFoundation__CFRUNLOOP_IS_SERVICING_THE_MAIN_DISPATCH_QUEUE + 12 frame #11: 0x000000018d940f6c CoreFoundation__CFRunLoopRun + 1452 frame #12: 0x000000018d881c20 CoreFoundationCFRunLoopRunSpecific + 452 frame #13: 0x0000000193511c0c GraphicsServicesGSEventRunModal + 168 frame #14: 0x00000001909b2fdc UIKitUIApplicationMain + 1156 * frame #15: 0x000000010000947c MyApplicationmain(argc=1, argv=0x000000016fdfbc80) + 108 at main.m:16 frame #16: 0x000000019a82faa0 libdyld.dylibstart + 4 As far as I understand the autoreleasepool just releases the controller. Shouldn't this be prevented by using a strong property just as I did? Do you have any idea what the problem can be and how I can solve it?

    Read the article

  • Multiple generic types in one container

    - by Lirik
    I was looking at the answer of this question regarding multiple generic types in one container and I can't really get it to work: the properties of the Metadata class are not visible, since the abstract class doesn't have them. Here is a slightly modified version of the code in the original question: public abstract class Metadata { } public class Metadata<T> : Metadata { // ... some other meta data public T Function{ get; set; } } List<Metadata> metadataObjects; metadataObjects.Add(new Metadata<Func<double,double>>()); metadataObjects.Add(new Metadata<Func<int,double>>()); metadataObjects.Add(new Metadata<Func<double,int>>()); foreach( Metadata md in metadataObjects) { var tmp = md.Function; // <-- Error: does not contain a definition for Function } The exact error is: error CS1061: 'Metadata' does not contain a definition for 'Function' and no extension method 'Function' accepting a first argument of type 'Metadata' could be found (are you missing a using directive or an assembly reference?) I believe it's because the abstract class does not define the property Function, thus the whole effort is completely useless. Is there a way that we can get the properties?

    Read the article

  • Android - Adding external library to project

    - by mmontalbo
    Hi, I am having a lot of trouble adding the WEKA library to a project I am working on. I have followed several tutorials that explain how to do this including the Android Developers guide: http://developer.android.com/guide/appendix/faq/commontasks.html#addexternallibrary and several of the postings on SO. I have created a folder in my project with the weka.jar file, created a new library (adding the weka.jar file to the library) and included this library in my build path. I have also added the library under the "Order and Export" tab in the project properties. I have also tried importing the jar file so that the actual contents of the jar are extracted into a directory in my project. The end result of all of this is that my project is able to build correctly and without error, but when it comes time to run my code on the emulator I get the following exception: 04-10 22:52:21.051: ERROR/dalvikvm(582): Could not find class 'weka.classifiers.trees.J48', referenced from method edu.usc.student.composure.classifier.GaitClassifierImpl. with J48 being the class I reference in my code. Does anyone have any additional suggestions that I may have overlooked? Thanks!

    Read the article

  • T4 trouble compiling transformation

    - by John Leidegren
    I can't figure this one out. Why doesn't T4 locate the IEnumerable type? I'm using Visual Studio 2010. And I just hope someone knows why? <#@ template debug="true" hostspecific="false" language="C#" #> <#@ assembly name="System.Data, Version=4.0.0.0, Culture=neutral, PublicKeyToken=b77a5c561934e089" #> <#@ import namespace="System" #> <#@ import namespace="System.Data" #> <#@ import namespace="System.Data.SqlClient" #> <#@ output extension=".cs" #> public static class Tables { <# var q = @" SELECT tbl.name 'table', col.name 'column' FROM sys.tables tbl INNER JOIN sys.columns col ON col.object_id = tbl.object_id "; // var source = Execute(q); #> } <#+ static IEnumerable Execute(string cmdText) { using (var conn = new SqlConnection(@"Data Source=.\SQLEXPRESS;Initial Catalog=t4build;Integrated Security=True;")) { conn.Open(); var cmd = new SqlCommand(cmdText, conn); using (var reader = cmd.ExecuteReader()) { while (reader.Read()) { } } } } #> Error 2 Compiling transformation: The type or namespace name 'IEnumerable' could not be found (are you missing a using directive or an assembly reference?) c:\Projects\T4BuildApp\T4BuildApp\TextTemplate1.tt 26 9

    Read the article

  • C#: Non-constructed generics as properties (eg. List<T>)

    - by Dav
    The Problem It's something I came across a while back and was able to work around it somehow. But now it came back, feeding on my curiosity - and I'd love to have a definite answer. Basically, I have a generic dgv BaseGridView<T> : DataGridView where T : class. Constructed types based on the BaseGridView (such as InvoiceGridView : BaseGridView<Invoice>) are later used in the application to display different business objects using the shared functionality provided by BaseGridView (like virtual mode, buttons, etc.). It now became necessary to create a user control that references those constructed types to control some of the shared functionality (eg. filtering) from BaseGridView. I was therefore hoping to create a public property on the user control that would enable me to attach it to any BaseGridView in Designer/code: public BaseGridView<T> MyGridView { get; set; }. The trouble is, it doesn't work :-) When compiled, I get the following message: The type or namespace name 'T' could not be found (are you missing a using directive or an assembly reference?) Solutions? I realise I could extract the shared functionality to an interface, mark BaseGridView as implementing that interface, and then refer to the created interface in my uesr control. But I'm curious if there exists some arcane C# command/syntax that would help me achieve what I want - without polluting my solution with an interface I don't really need :-)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Generated images fail to load in browser

    - by notJim
    I've got a page on a webapp that has about 13 images that are generated by my application, which is written in the Kohana PHP framework. The images are actually graphs. They are cached so they are only generated once, but the first time the user visits the page, and the images all have to be generated, about half of the images don't load in the browser. Once the page has been requested once and images are cached, they all load successfully. Doing some ad-hoc testing, if I load an individual image in the browser, it takes from 450-700 ms to load with an empty cache (I checked this using Google Chrome's resource tracking feature). For reference, it takes around 90-150 ms to load a cached image. Even if the image cache is empty, I have the data and some of the application's startup tasks cached, so that after the first request, none of that data needs to be fetched. My questions are: Why are the images failing to load? It seems like the browser just decides not to download the image after a certain point, rather than waiting for them all to finish loading. What can I do to get them to load the first time, with an empty cache? Obviously one option is to decrease the load times, and I could figure out how to do that by profiling the app, but are there other options? As I mentioned, the app is in the Kohana PHP framework, and it's running on Apache. As an aside, I've solved this problem for now by fetching the page as soon as the data is available (it comes from a batch process), so that the images are always cached by the time the user sees them. That feels like a kludgey solution to me, though, and I'm curious about what's actually going on.

    Read the article

  • Contrary to Python 3.1 Docs, hash(obj) != id(obj). So which is correct?

    - by Don O'Donnell
    The following is from the Python v3.1.2 documentation: From The Python Language Reference Section 3.3.1 Basic Customization: object.__hash__(self) ... User-defined classes have __eq__() and __hash__() methods by default; with them, all objects compare unequal (except with themselves) and x.__hash__() returns id(x). From The Glossary: hashable ... Objects which are instances of user-defined classes are hashable by default; they all compare unequal, and their hash value is their id(). This is true up through version 2.6.5: Python 2.6.5 (r265:79096, Mar 19 2010 21:48:26) ... ... >>> class C(object): pass ... >>> c = C() >>> id(c) 11335856 >>> hash(c) 11335856 But in version 3.1.2: Python 3.1.2 (r312:79149, Mar 21 2010, 00:41:52) ... ... >>> class C: pass ... >>> c = C() >>> id(c) 11893680 >>> hash(c) 743355 So which is it? Should I report a documentation bug or a program bug? And if it's a documentation bug, and the default hash() value for a user class instance is no longer the same as the id() value, then it would be interesting to know what it is or how it is calculated, and why it was changed in version 3.

    Read the article

  • Listview not being populated

    - by Luke
    I have put some console.writeline code in to test, but they arent appearing in the output box? public static ArrayList myDeliveries = new ArrayList(); public mainForm() { InitializeComponent(); } private void mainForm_Load(object sender, EventArgs e) { if (!File.Exists("../../MealDeliveries.txt")) { MessageBox.Show("File not found!"); return; } using (StreamReader sr = new StreamReader("../../MealDeliveries.txt")) { //first line is delivery name string strDeliveryName = sr.ReadLine(); Console.WriteLine("some tetttttttttt23423423423423423ttttttttttttttttttttttt"); while (strDeliveryName != null) { //other lines Delivery d = new Delivery(strDeliveryName, sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine(), sr.ReadLine()); mainForm.myDeliveries.Add(d); //check for further values strDeliveryName = sr.ReadLine(); } } displayDeliveries(); } private void displayDeliveries() { lstDeliveryDetails.Items.Clear(); Console.WriteLine("some tettttttttttttttttttttttttttttttttt"); Console.WriteLine(mainForm.myDeliveries.Count); foreach (Delivery d in mainForm.myDeliveries) { lstDeliveryDetails.Items.Add(d.DeliveryName); } } Can anyone help??

    Read the article

  • unexpected behaviour of object stored in web service Session

    - by draconis
    Hi. I'm using Session variables inside a web service to maintain state between successive method calls by an external application called QBWC. I set this up by decorating my web service methods with this attribute: [WebMethod(EnableSession = true)] I'm using the Session variable to store an instance of a custom object called QueueManager. The QueueManager has a property called ChangeQueue which looks like this: [Serializable] public class QueueManager { ... public Queue<QBChange> ChangeQueue { get; set; } ... where QBChange is a custom business object belonging to my web service. Now, every time I get a call to a method in my web service, I use this code to retrieve my QueueManager object and access my queue: QueueManager qm = (QueueManager)Session[ticket]; then I remove an object from the queue, using qm.dequeue() and then I save the modified query manager object (modified because it contains one less object in the queue) back to the Session variable, like so: Session[ticket] = qm; ready for the next web service method call using the same ticket. Now here's the thing: if I comment out this last line //Session[ticket] = qm; , then the web service behaves exactly the same way, reducing the size of the queue between method calls. Now why is that? The web service seems to be updating a class contained in serialized form in a Session variable without being asked to. Why would it do that? When I deserialize my Queuemanager object, does the qm variable hold a reference to the serialized object inside the Session[ticket] variable?? This seems very unlikely.

    Read the article

  • Question about using an access database as a resource file in Visual Studio.

    - by user354303
    Hi I am trying to embed a Microsoft Access database file into my Class assembly DLL. I want my code to reference the resource file and use it with a ADODB.Connection object. Any body know a simpler way, or an easier way? Or what is wrong with my code, when i added the resource file it added me dataset definitions, but i have no idea what to do with those. The connection string I am trying below is from an automatically generated app.config. I did add the item as a resource... using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Data; using ConsoleApplication1.Resources;//SPPrinterLicenses using System.Data.OleDb; using ADODB; using System.Configuration; namespace ConsoleApplication1 { class SharePointPrinterManager { public static bool IsValidLicense(string HardwareID) { OleDbDataAdapter da = new OleDbDataAdapter(); DataSet ds = new DataSet(); ADODB.Connection adoCn = new Connection(); ADODB.Recordset adoRs = new Recordset(); //**open command below fails** adoCn.Open( @"Provider=Microsoft.ACE.OLEDB.12.0;Data Source=|DataDirectory|\Resources\SPPrinterLicenses.accdb;Persist Security Info=True", "", "", 1); adoRs.Open("Select * from AllWorkstationLicenses", adoCn, ADODB.CursorTypeEnum.adOpenForwardOnly, ADODB.LockTypeEnum.adLockReadOnly, 1); da.Fill(ds, adoRs, "AllworkstationLicenses"); adoCn.Close(); DataTable dt = new DataTable(); //ds.Tables. return true; } } }

    Read the article

  • Symbols (pdb) for native dll are not loaded due to post build step

    - by sean e
    I have a native release dll that is built with symbols. There is a post build step that modifies the dll. The post build step does some compression and probably appends some data. The pdb file is still valid however neither WinDbg nor Visual Studio 2008 will load the symbols for the dll after the post build step. What bits in either the pdb file or the dll do we need to modify to get either WinDbg or Visual Studio to load the symbols when it loads a dump in which our release dll is referenced? Is it filesize that matters? A checksum or hash? A timestamp? Modify the dump? or modify the pdb? modify the dll before it is shipped? (We know the pdb is valid because we are able to use it to manually get symbol names for addresses in dump callstacks that reference the released dll. It's just a total pain in the *ss do it by hand for every address in a callstack in all the threads.)

    Read the article

  • Why am I getting a EXC_BAD_ACCESS in a NSTimer selector?

    - by AngeDeLaMort
    I've got quite a weird problem. To make it short, i'll write some pseudo-code: init: create a dictionary and insert n elements. create a "repeat timer" and add it to the currentRunLoop using the timerRefresh selector. timerRefresh: using a list of keys, find the items in the dictionary if the item exists -> call a function So, for an unknown reason, I get an EXC_BAD_ACCESS when I do: [item function]; But I traced the address I got from the dictionary items and it's ok. The ref count of the items in the dictionary is still 1. The {release, dealloc} of the items in the dictionary aren't called. Everything seems fine. Also, to make it worst, it works for some items. So, I'm wondering if there is a threading problem? or something else obscure? The callstack is quite simple: #0 0x93e0604b in objc_msgSend_fpret #1 0x00f3e6b0 in ?? #2 0x0001cfca in -[myObject functionm:] at myObject.m:000 #3 0x305355cd in __NSFireTimer #4 0x302454a0 in CFRunLoopRunSpecific #5 0x30244628 in CFRunLoopRunInMode #6 0x32044c31 in GSEventRunModal #7 0x32044cf6 in GSEventRun #8 0x309021ee in UIApplicationMain #9 0x000027e0 in main at main.m:14 So, any suggestion where to look would be appreciated.

    Read the article

  • How can I manage building library projects that produce both a static lib and a dll?

    - by Scott Langham
    I've got a large visual studio solution with ~50 projects. There are configurations for StaticDebug, StaticRelease, Debug and Release. Some libraries are needed in both dll and static lib form. To get them, we rebuild the solution with a different configuration. The Configuration Manager window is used to setup which projects need to build in which flavours, static lib, dynamic dll or both. This can by quite tricky to manage and it's a bit annoying to have to build the solution multiple times and select the configurations in the right order. Static versions need building before non-static versions. I'm wondering, instead of this current scheme, might it be simpler to manage if, for the projects I needed to produce both a static lib and dynamc dll, I created two projects. Eg: CoreLib CoreDll I could either make both of these projects reference all the same files and build them twice, or I'm wondering, would it be possible to build CoreLib and then get CoreDll to link it to generate the dll? I guess my question is, do you have any advice on how to structure your projects in this kind of situation? Thanks.

    Read the article

  • twitter streaming api instead of search api

    - by user1711576
    I am using twitters search API to view all the tweets that use a particular hashtag I want to view. However, I want to use the stream function, so, I only get recent ones, and so, I can then store them. <?php global $total, $hashtag; $hashtag = $_POST['hash']; $total = 0; function getTweets($hash_tag, $page) { global $total, $hashtag; $url = 'http://search.twitter.com/search.json?q='.urlencode($hash_tag).'&'; $url .= 'page='.$page; $ch = curl_init($url); curl_setopt ($ch, CURLOPT_RETURNTRANSFER, TRUE); $json = curl_exec ($ch); curl_close ($ch); echo "<pre>"; $json_decode = json_decode($json); print_r($json_decode->results); $json_decode = json_decode($json); $total += count($json_decode->results); if($json_decode->next_page){ $temp = explode("&",$json_decode->next_page); $p = explode("=",$temp[0]); getTweets($hashtag,$p[1]); } } getTweets($hashtag,1); echo $total; ?> The above code is what I have been using to search for the tweets I want. What do I need to do to change it so I can stream the tweets instead? I know I would have to use the stream url https://api.twitter.com/1.1/search/tweets.json , but what do I need to change after that is where I don't know what to do. Obviously, I know I'll need to write the database sql but I want to just capture the stream first and view it. How would I do this? Is the code I have been using not any good for just capturing the stream?

    Read the article

  • How to validate DataReader is actually closed using FxCop custom rule?

    - by tanmay
    I have written couple of custom rules in for FxCop 1.36. I have written code to find weather an opened DataReader is closed or not. But it does not check which DataReader object is calling the Close() method so I can't be sure if all opened DataReader objects are closed!! 2nd: If I am a DataReader in an 'if/else' like if 1=2 dr = cmd.ExecuteReader(); else dr = cmd2.ExecuteReader(); end if In this case it will search for 2 DataReader objects to be closed. I am putting my code for more clarity. public override ProblemCollection Check(Member member) { Method method = member as Method; int countCatch =0; int countErrLog = 0; Instruction objInstr = null; if (method != null) { for (int i = 0; i < method.Instructions.Count; i++) { objInstr = method.Instructions[i]; if (objInstr.Value != null) { if (objInstr.Value.ToString() .Contains("System.Data.SqlClient.SqlDataReader")) { countCatch += 1; } if (countCatch>0) { if (objInstr.Value.ToString().Contains( "System.Data.SqlClient.SqlDataReader.Close")) { countErrLog += 1; } } } } } if (countErrLog!=countCatch) { Resolution resolu = GetResolution(new string[] { method.ToString() }); Problems.Add(new Problem(resolu)); } return Problems; }

    Read the article

  • Doctrine: Unable to execute either CROSS JOIN or SELECT FROM Table1, Table2?

    - by ropstah
    Using Doctrine I'm trying to execute either a 1. CROSS JOIN statement or 2. a SELECT FROM Table1, Table2 statement. Both seem to fail. The CROSS JOIN does execute, however the results are just wrong compared to executing in Navicat. The multiple table SELECT doesn't event execute because Doctrine automatically tries to LEFT JOIN the second table. The cross join statement (this runs, however it doesn't include the joined records where the refClass User_Setting doesn't have a value): $q = new Doctrine_RawSql(); $q->select('{s.*}, {us.*}') ->from('User u CROSS JOIN Setting s LEFT JOIN User_Setting us ON us.usr_auto_key = u.usr_auto_key AND us.set_auto_key = s.set_auto_key') ->addComponent('u', 'User u') ->addComponent('s', 'Setting s') ->addComponent('us', 'u.User_Setting us') ->where('s.sct_auto_key = ? AND u.usr_auto_key = ?',array(1, $this->usr_auto_key)); And the select from multiple tables (this doesn't event run. It does not spot the many-many relationship between User and Setting in the first ->from() part and throws an exception: "User_Setting" with an alias of "us" in your query does not reference the parent component it is related to.): $q = new Doctrine_RawSql(); $q->select('{s.*}, {us.*}') ->from('User u, Setting s LEFT JOIN User_Setting us ON us.usr_auto_key = u.usr_auto_key AND us.set_auto_key = s.set_auto_key') ->addComponent('u', 'User u') ->addComponent('s', 'Setting s') ->addComponent('us', 'u.User_Setting us') ->where('s.sct_auto_key = ? AND u.usr_auto_key = ?',array(1, $this->usr_auto_key));

    Read the article

  • eclipse error with android: id cannot be resolved or is not a field

    - by Jaynathan Leung
    Hi, I just started playing around with android development, and already with just an attempt at making a button, I have encountered a problem. The error I'm given in the following code is right on "R.id.button1". It says id cannot be resolved or is not a field. Do I need to manually reference every single object I make in the layout xml file? I found that this did work, but it does seem to be a bit much for every button I want to make... package com.example.helloandroid; import android.app.Activity; import android.os.Bundle; import android.view.View; import android.view.View.OnClickListener; import android.widget.Button; public class HelloAndroid extends Activity { /** Called when the activity is first created. */ private Button button1; @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.main); button1 = (Button)findViewById(R.id.button1); button1.setOnClickListener(new OnClickListener() { public void onClick(View v) { finish(); } }); } }

    Read the article

  • Should I use early returns in C#?

    - by Bobby
    I've learned Visual Basic and was always taught to keep the flow of the program without interruptions, like Goto, Exit and Return. Using nested ifs instead of one return statement seems very natural to me. Now that I'm partly migrating towards C#, I wonder what the best practice is for C-like languages. I've been working on a C# project for some time, and of course discover more code of ExampleB and it's hurting my mind somehow. But what is the best practice for this, what is more often used and are there any reasons against one of the styles? public void ExampleA() { if (a != b) { if (a != c) { bool foundIt; for (int i = 0; i < d.Count && !foundIt; i++) { if (element == f) foundIt = true; } } } } public void ExampleB() { if (a == b) return; if (a == c) return; foreach (object element in d) { if (element == f) break; } }

    Read the article

  • How to refer to enum values inside nhibernate formula mapping specification?

    - by mark
    Dear ladies and sirs. I have two entities types: RunContainer parent entity type Run child entity type Run has a property Status, which is of type RunStatus, like so: public enum RunStatus { Created, Starting, // ... } public class Run { public int ContainerId { get; private set; } // ... public RunStatus Status { get; private set; } } RunContainer has a calculated property ActiveRunCount, like so: public class RunContainer { public int Id { get; private set; } // ... public int ActiveRunCount { get; private set; } } In the mapping for the RunContainer.ActiveRunCount property, I use the formula specification like so: <property name="ActiveRunCount" formula="(select count(r.Id) from Run r where r.ContainerId = Id and r.Status = 1)"/> My problem is that I refer to the RunStatus enum values in the formula by their respective numeric value, rather than the appropriate symbolic name. Can anyone tell me how can I use the symbolic name instead? Thanks.

    Read the article

  • Application Code Redesign to reduce no. of Database Hits from Performance Perspective

    - by Rachel
    Scenario I want to parse a large CSV file and inserts data into the database, csv file has approximately 100K rows of data. Currently I am using fgetcsv to parse through the file row by row and insert data into Database and so right now I am hitting database for each line of data present in csv file so currently database hit count is 100K which is not good from performance point of view. Current Code: public function initiateInserts() { //Open Large CSV File(min 100K rows) for parsing. $this->fin = fopen($file,'r') or die('Cannot open file'); //Parsing Large CSV file to get data and initiate insertion into schema. while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) { $query = "INSERT INTO dt_table (id, code, connectid, connectcode) VALUES (:id, :code, :connectid, :connectcode)"; $stmt = $this->prepare($query); // Then, for each line : bind the parameters $stmt->bindValue(':id', $data[0], PDO::PARAM_INT); $stmt->bindValue(':code', $data[1], PDO::PARAM_INT); $stmt->bindValue(':connectid', $data[2], PDO::PARAM_INT); $stmt->bindValue(':connectcode', $data[3], PDO::PARAM_INT); // Execute the statement $stmt->execute(); $this->checkForErrors($stmt); } } I am looking for a way wherein instead of hitting Database for every row of data, I can prepare the query and than hit it once and populate Database with the inserts. Any Suggestions !!! Note: This is the exact sample code that I am using but CSV file has more no. of field and not only id, code, connectid and connectcode but I wanted to make sure that I am able to explain the logic and so have used this sample code here. Thanks !!!

    Read the article

  • WPF & Linq To SQL binding ComboBox to foreign key

    - by ZeroDelta
    I'm having trouble binding a ComboBox to a foreign key in WPF using Linq To SQL. It works fine when displaying records, but if I change the selection on the ComboBox, that change does not seem to affect the property to which it is bound. My SQL Server Compact file has three tables: Players (PK is PlayerID), Events (PK is EventID), and Matches (PK is MatchID). Matches has FKs for the the other two, so that a match is associated with a player and an event. My window for editing a match uses a ComboBox to select the Event, and the ItemsSource is set to the result of a LINQ query to pull all of the Events. And of course the user should be able to select the Event based on EventName, not EventID. Here's the XAML: <ComboBox x:Name="cboEvent" DisplayMemberPath="EventName" SelectedValuePath="EventID" SelectedValue="{Binding Path=EventID, UpdateSourceTrigger=PropertyChanged}" /> And some code-behind from the Loaded event handler: var evt = from ev in db.Events orderby ev.EventName select ev; cboEvent.ItemsSource = evt.ToList(); var mtch = from m in db.Matches where m.PlayerID == ((Player)playerView.CurrentItem).PlayerID select m; matchView = (CollectionView)CollectionViewSource.GetDefaultView(mtch); this.DataContext = matchView; When displaying matches, this works fine--I can navigate from one match to the next and the EventName is shown correctly. However, if I select a new Event via this ComboBox, the CurrentItem of the CollectionView doesn't seem to change. I feel like I'm missing something stupid! Note: the Player is selected via a ListBox, and that selection filters the matches displayed--this seems to be working fine, so I didn't include that code. That is the reason for the "PlayerID" reference in the LINQ query

    Read the article

  • structDelete doesn't effect the shallow copy?

    - by Travis
    I was playing around onError so I tried to create an error using a large xml document object. <cfset variables.XMLByRef = variables.parsedXML.XMLRootElement.XMLChildElement> <cfset structDelete(variables.parsedXML, "XMLRootElement")> <cfset variables.startXMLShortLoop = getTickCount()> <cfloop from = "1" to = "#arrayLen(variables.XMLByRef)#" index = "variables.i"> <cfoutput>#variables.XMLByRef[variables.i].id.xmltext#</cfoutput><br /> </cfloop> <cfset variables.stopXMLShortLoop = getTickCount()> I expected to get an error because I deleted the structure I was referencing. From LiveDocs: Variable Assignment - Creates an additional reference, or alias, to the structure. Any change to the data using one variable name changes the structure that you access using the other variable name. This technique is useful when you want to add a local variable to another scope or otherwise change a variable's scope without deleting the variable from the original scope. instead I got 580df1de-3362-ca9b-b287-47795b6cdc17 25a00498-0f68-6f04-a981-56853c0844ed ... ... ... db49ed8a-0ba6-8644-124a-6d6ebda3aa52 57e57e28-e044-6119-afe2-aebffb549342 Looped 12805 times in 297 milliseconds <cfdump var = "#variables#"> Shows there's nothing in the structure, just parsedXML.xmlRoot.xmlName with the value of XMLRootElement. I also tried <cfset structDelete(variables.parsedXML.XMLRootElement, "XMLChildElement")> as well as structClear for both. More information on deleting from the xml document object. http://help.adobe.com/en_US/ColdFusion/9.0/Developing/WSc3ff6d0ea77859461172e0811cbec22c24-78e3.html Can someone please explain my faulty logic? Thanks.

    Read the article

< Previous Page | 646 647 648 649 650 651 652 653 654 655 656 657  | Next Page >