Search Results

Search found 17734 results on 710 pages for 'values'.

Page 658/710 | < Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >

• Passing password value through URL

  - by Steven Wright

  OK I see a lot of people asking about passing other values, URLS, random stuff through a URL, but don't find anything about sending a password to a password field. Here is my situation: I have a ton of sites I use on a daily basis with my work and oh about 90% require logins. Obviously remembering 80 bajillion logins for each site is dumb, especially when there are more than one user name I use for each site. So to make life easier, I drew up a nifty JSP app that stores all of my logins in a DB table and creates a user interface for the specific page I want to visit. Each page has a button that sends a username, password into the id parameters of the html inputs. Problem: I can get the usernames and other info to show up just dandy, but when I try and send a password to a password field, it seems that nothing gets received by the page I'm trying to hit. Is there some ninja stuff I need to be doing here or is it just not easily possible? Basically this is what I do now: http://addresshere/support?loginname=steveoooo&loginpass=passwordhere and some of my html looks like this: <form name="userform" method="post" action="index.jsp" > <input type="hidden" name="submit_login" value="y"> <table width="100%"> <tr class="main"> <td width="100" nowrap>Username:</td> <td><input type="text" name="loginname" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td>Password: </font></td> <td><input type="password" name="loginpass" value="" size="30" maxlength="64"></td> </tr> <tr class="main"> <td><center><input type="submit" name="submit" value="Login"></center></td> </tr> </table> </form> Any suggestions?

  Read the article

• How to reduce redundant code when adding new c++0x rvalue reference operator overloads

  - by Inverse

  I am adding new operator overloads to take advantage of c++0x rvalue references, and I feel like I'm producing a lot of redundant code. I have a class, tree, that holds a tree of algebraic operations on double values. Here is an example use case: tree x = 1.23; tree y = 8.19; tree z = (x + y)/67.31 - 3.15*y; ... std::cout << z; // prints "(1.23 + 8.19)/67.31 - 3.15*8.19" For each binary operation (like plus), each side can be either an lvalue tree, rvalue tree, or double. This results in 8 overloads for each binary operation: // core rvalue overloads for plus: tree operator +(const tree& a, const tree& b); tree operator +(const tree& a, tree&& b); tree operator +(tree&& a, const tree& b); tree operator +(tree&& a, tree&& b); // cast and forward cases: tree operator +(const tree& a, double b) { return a + tree(b); } tree operator +(double a, const tree& b) { return tree(a) + b; } tree operator +(tree&& a, double b) { return std::move(a) + tree(b); } tree operator +(double a, tree&& b) { return tree(a) + std::move(b); } // 8 more overloads for minus // 8 more overloads for multiply // 8 more overloads for divide // etc which also has to be repeated in a way for each binary operation (minus, multiply, divide, etc). As you can see, there are really only 4 functions I actually need to write; the other 4 can cast and forward to the core cases. Do you have any suggestions for reducing the size of this code? PS: The class is actually more complex than just a tree of doubles. Reducing copies does dramatically improve performance of my project. So, the rvalue overloads are worthwhile for me, even with the extra code. I have a suspicion that there might be a way to template away the "cast and forward" cases above, but I can't seem to think of anything.

  Read the article

• C++ using cdb_read returns extra characters on some reads

  - by Moe Be

  Hi All, I am using the following function to loop through a couple of open CDB hash tables. Sometimes the value for a given key is returned along with an additional character (specifically a CTRL-P (a DLE character/0x16/0o020)). I have checked the cdb key/value pairs with a couple of different utilities and none of them show any additional characters appended to the values. I get the character if I use cdb_read() or cdb_getdata() (the commented out code below). If I had to guess I would say I am doing something wrong with the buffer I create to get the result from the cdb functions. Any advice or assistance is greatly appreciated. char* HashReducer::getValueFromDb(const string &id, vector <struct cdb *> &myHashFiles) { unsigned char hex_value[BUFSIZ]; size_t hex_len; //construct a real hex (not ascii-hex) value to use for database lookups atoh(id,hex_value,&hex_len); char *value = NULL; vector <struct cdb *>::iterator my_iter = myHashFiles.begin(); vector <struct cdb *>::iterator my_end = myHashFiles.end(); try { //while there are more databases to search and we have not found a match for(; my_iter != my_end && !value ; my_iter++) { //cerr << "\n looking for this MD5:" << id << " hex(" << hex_value << ") \n"; if (cdb_find(*my_iter, hex_value, hex_len)){ //cerr << "\n\nI found the key " << id << " and it is " << cdb_datalen(*my_iter) << " long\n\n"; value = (char *)malloc(cdb_datalen(*my_iter)); cdb_read(*my_iter,value,cdb_datalen(*my_iter),cdb_datapos(*my_iter)); //value = (char *)cdb_getdata(*my_iter); //cerr << "\n\nThe value is:" << value << " len is:" << strlen(value)<< "\n\n"; }; } } catch (...){} return value; }

  Read the article

• How do I create a thread-safe write-once read-many value in Java?

  - by Software Monkey

  This is a problem I encounter frequently in working with more complex systems and which I have never figured out a good way to solve. It usually involves variations on the theme of a shared object whose construction and initialization are necessarily two distinct steps. This is generally because of architectural requirements, similar to applets, so answers that suggest I consolidate construction and initialization are not useful. By way of example, let's say I have a class that is structured to fit into an application framework like so: public class MyClass { private /*ideally-final*/ SomeObject someObject; MyClass() { someObject=null; } public void startup() { someObject=new SomeObject(...arguments from environment which are not available until startup is called...); } public void shutdown() { someObject=null; // this is not necessary, I am just expressing the intended scope of someObject explicitly } } I can't make someObject final since it can't be set until startup() is invoked. But I would really like it to reflect it's write-once semantics and be able to directly access it from multiple threads, preferably avoiding synchronization. The idea being to express and enforce a degree of finalness, I conjecture that I could create a generic container, like so: public class WoRmObject<T> { private T object; WoRmObject() { object=null; } public WoRmObject set(T val) { object=val; return this; } public T get() { return object; } } and then in MyClass, above, do: private final WoRmObject<SomeObject> someObject; MyClass() { someObject=new WoRmObject<SomeObject>(); } public void startup() { someObject.set(SomeObject(...arguments from environment which are not available until startup is called...)); } Which raises some questions for me: Is there a better way, or existing Java object (would have to be available in Java 4)? Is this thread-safe provided that no other thread accesses someObject.get() until after it's set() has been called. The other threads will only invoke methods on MyClass between startup() and shutdown() - the framework guarantees this. Given the completely unsynchronized WoRmObject container, it is ever possible under either JMM to see a value of object which is neither null nor a reference to a SomeObject? In other words, does has the JMM always guaranteed that no thread can observe the memory of an object to be whatever values happened to be on the heap when the object was allocated.

  Read the article

• Multi-tier applications using L2S, WCF and Base Class

  - by Gena Verdel

  Hi all. One day I decided to build this nice multi-tier application using L2S and WCF. The simplified model is : DataBase-L2S-Wrapper(DTO)-Client Application. The communication between Client and Database is achieved by using Data Transfer Objects which contain entity objects as their properties. abstract public class BaseObject { public virtual IccSystem.iccObjectTypes ObjectICC_Type { get { return IccSystem.iccObjectTypes.unknownType; } } [global::System.Data.Linq.Mapping.ColumnAttribute(Storage = "_ID", AutoSync = AutoSync.OnInsert, DbType = "BigInt NOT NULL IDENTITY", IsPrimaryKey = true, IsDbGenerated = true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order = 1)] public virtual long ID { //get; //set; get { return _ID; } set { _ID = value; } } } [DataContract] public class BaseObjectWrapper<T> where T : BaseObject { #region Fields private T _DBObject; #endregion #region Properties [DataMember] public T Entity { get { return _DBObject; } set { _DBObject = value; } } #endregion } Pretty simple, isn't it?. Here's the catch. Each one of the mapped classes contains ID property itself so I decided to override it like this [global::System.Data.Linq.Mapping.TableAttribute(Name="dbo.Divisions")] [global::System.Runtime.Serialization.DataContractAttribute()] public partial class Division : INotifyPropertyChanging, INotifyPropertyChanged { [global::System.Data.Linq.Mapping.ColumnAttribute(Storage="_ID", AutoSync=AutoSync.OnInsert, DbType="BigInt NOT NULL IDENTITY", IsPrimaryKey=true, IsDbGenerated=true)] [global::System.Runtime.Serialization.DataMemberAttribute(Order=1)] public override long ID { get { return this._ID; } set { if ((this._ID != value)) { this.OnIDChanging(value); this.SendPropertyChanging(); this._ID = value; this.SendPropertyChanged("ID"); this.OnIDChanged(); } } } } Wrapper for division is pretty straightforward as well: public class DivisionWrapper : BaseObjectWrapper<Division> { } It worked pretty well as long as I kept ID values at mapped class and its BaseObject class the same(that's not very good approach, I know, but still) but then this happened: private CentralDC _dc; public bool UpdateDivision(ref DivisionWrapper division) { DivisionWrapper tempWrapper = division; if (division.Entity == null) { return false; } try { Table<Division> table = _dc.Divisions; var q = table.Where(o => o.ID == tempWrapper.Entity.ID); if (q.Count() == 0) { division.Entity._errorMessage = "Unable to locate entity with id " + division.Entity.ID.ToString(); return false; } var realEntity = q.First(); realEntity = division.Entity; _dc.SubmitChanges(); return true; } catch (Exception ex) { division.Entity._errorMessage = ex.Message; return false; } } When trying to enumerate over the in-memory query the following exception occurred: Class member BaseObject.ID is unmapped. Although I'm stating the type and overriding the ID property L2S fails to work. Any suggestions?

  Read the article

• How do I write sql data into a textbox after a submit type event

  - by Matt

  Finishing up some homework and Im having trouble with figuring out how to take information generated in sql column(a primary key set up to assign a record number to a customer example 1046) at submit and writing it to my redirected recipt page. I call it recipt.aspx. Any takers Professor says to use a datareader...but things go bad after that. public partial class _Default : System.Web.UI.Page { String cnStr = "EDITED FOR THE PURPOSE OF NOT DISPLAYED SQL SERVERta Source=111.11.111.11; uid=xxxxxxx; password=xxxx; database=xxxxxx; "; String insertStr; SqlDataReader reader; SqlConnection myConnection = new SqlConnection(); protected void submitbutton_Click(object sender, EventArgs e) { myConnection.ConnectionString = cnStr; try { //more magic happens as myConnection opens myConnection.Open(); insertStr = "insert into connectAssignment values ('" + TextBox2.Text + "','" + TextBox3.Text + "','" + TextBox4.Text + "','" + TextBox5.Text + "','" + bigtextthing.Text + "','" + DropDownList1.SelectedItem.Value + "')"; //magic happens as Connection string is assigned to connection object and passes in the SQL statment //associate the command to the the myConnection connection object SqlCommand cmd = new SqlCommand(insertStr, myConnection); cmd.ExecuteNonQuery(); Session["passmyvalue1"] = TextBox2.Text; Session["passmyvalue2"] = TextBox3.Text; Session["passmyvalue3"] = TextBox4.Text; Session["passmyvalue4"] = TextBox5.Text; Session["passmyvalue5"] = bigtextthing.Text; Session["I NEED SOME HELP RIGHT HERE"] =Textbox6.Text; Response.Redirect("receipt.aspx"); } catch { bigtextthing.Text = "Error submitting" + "Possible casues: Internet is down,server is down, check your settings!"; } finally { myConnection.Close(); TextBox2.Text = ""; TextBox3.Text = ""; TextBox4.Text = ""; TextBox5.Text = ""; bigtextthing.Text = ""; } //reset validators? } The recipt page public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { if(Session["passmyvalue1"] != null) { TextBox1.Text = (string)Session["passmyvalue1"]; TextBox2.Text = (string)Session["passmyvalue2"]; TextBox3.Text = (string)Session["passmyvalue3"]; TextBox4.Text = (string)Session["passmyvalue4"]; TextBox5.Text = (string)Session["passmyvalue5"]; TextBox6.Text = I don't know ; } } } THanks for the help

  Read the article

• Java Best Practice for type resolution at runtime.

  - by Brian

  I'm trying to define a class (or set of classes which implement the same interface) that will behave as a loosely typed object (like JavaScript). They can hold any sort of data and operations on them depend on the underlying type. I have it working in three different ways but none seem ideal. These test versions only allow strings and integers and the only operation is add. Adding integers results in the sum of the integer values, adding strings concatenates the strings and adding an integer to a string converts the integer to a string and concatenates it with the string. The final version will have more types (Doubles, Arrays, JavaScript-like objects where new properties can be added dynamically) and more operations. Way 1: public interface DynObject1 { @Override public String toString(); public DynObject1 add(DynObject1 d); public DynObject1 addTo(DynInteger1 d); public DynObject1 addTo(DynString1 d); } public class DynInteger1 implements DynObject1 { private int value; public DynInteger1(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject1 add(DynObject1 d) { return d.addTo(this); } public DynObject1 addTo(DynInteger1 d) { return new DynInteger1(d.value + value); } public DynObject1 addTo(DynString1 d) { return new DynString1(d.toString()+Integer.toString(value)); } } ...and similar for DynString1 Way 2: public interface DynObject2 { @Override public String toString(); public DynObject2 add(DynObject2 d); } public class DynInteger2 implements DynObject2 { private int value; public DynInteger2(int v) { value = v; } @Override public String toString() { return Integer.toString(value); } public DynObject2 add(DynObject2 d) { Class c = d.getClass(); if(c==DynInteger2.class) { return new DynInteger2(value + ((DynInteger2)d).value); } else { return new DynString2(toString() + d.toString()); } } } ...and similar for DynString2 Way 3: public class DynObject3 { private enum ObjectType { Integer, String }; Object value; ObjectType type; public DynObject3(Integer v) { value = v; type = ObjectType.Integer; } public DynObject3(String v) { value = v; type = ObjectType.String; } @Override public String toString() { return value.toString(); } public DynObject3 add(DynObject3 d) { if(type==ObjectType.Integer && d.type==ObjectType.Integer) { return new DynObject3(Integer.valueOf(((Integer)value).intValue()+((Integer)value).intValue())); } else { return new DynObject3(value.toString()+d.value.toString()); } } } With the if-else logic I could use value.getClass()==Integer.class instead of storing the type but with more types I'd change this to use a switch statement and Java doesn't allow switch to use Classes. Anyway... My question is what is the best way to go about something thike this?

  Read the article

• Perl: Compare and edit underlying structure in hash

  - by Mahfuzur Rahman Pallab

  I have a hash of complex structure and I want to perform a search and replace. The first hash is like the following: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"], 456 => ["as", "sd", "df"] }, mno => { 987 => ["lk", "dm", "sd"] }, } and I want to iteratively search for all '123'/'456' elements, and if a match is found, I need to do a comparison of the sublayer, i.e. of ['ab','cd','ef'] and ['as','sd','df'] and in this case, keep only the one with ['ab','cd','ef']. So the output will be as follows: $VAR1 = { abc => { 123 => ["xx", "yy", "zy"], 456 => ["ab", "cd", "ef"] }, def => { 659 => ["wx", "yg", "kl"] }, mno => { 987 => ["lk", "dm", "sd"] }, } So the deletion is based on the substructure, and not index. How can it be done? Thanks for the help!! Lets assume that I will declare the values to be kept, i.e. I will keep 456 = ["ab", "cd", "ef"] based on a predeclared value of ["ab", "cd", "ef"] and delete any other instance of 456 anywhere else. The search has to be for every key. so the code will go through the hash, first taking 123 = ["xx", "yy", "zy"] and compare it against itself throughout the rest of the hash, if no match is found, do nothing. If a match is found, like in the case of 456 = ["ab", "cd", "ef"], it will compare the two, and as I have said that in case of a match the one with ["ab", "cd", "ef"] would be kept, it will keep 456 = ["ab", "cd", "ef"] and discard any other instances of 456 anywhere else in the hash, i.e. it will delete 456 = ["as", "sd", "df"] in this case.

  Read the article

• Find a base case for a recursive void method

  - by Evan S

  I am doing homework. I would like to build a base case for a recursion where ordering given numbers (list2) in ascending order. Purpose of writing this codes is that when all numbers are in ascending order then should stop calling a method called ascending(list2, list1); and all values in list2 should be shipped to list1. For instance, list2 = 6,5,4,3,2,1 then list2 becomes empty and list1 should be 1,2,3,4,5,6. I am trying to compare result with previous one and if matches then stop. But I can't find the base case to stop it. In addition, Both ascending() and fixedPoint() are void method. Anybody has idea? lol Took me 3 days... When I run my code then 6,5,4,3,2,1 5,6,4,3,2,1 4,5,6,3,2,1 3,4,5,6,2,1 2,3,4,5,6,1 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 1,2,3,4,5,6 infinite............. public class Flipper { public static void main(String[] args) { Flipper aFlipper = new Flipper(); List<Integer> content = Arrays.asList(6,5,4,3,2,1); ArrayList<Integer> l1 = new ArrayList<Integer>(content); ArrayList<Integer> l2 = new ArrayList<Integer>(); // empty list aFlipper.fixedPoint(l2,l1); System.out.println("fix l1 is "+l1); System.out.println("fix l2 is "+l2); } public void fixedPoint(ArrayList<Integer> list1, ArrayList<Integer> list2) { // data is in list2 ArrayList<Integer> temp1 = new ArrayList<Integer>(); // empty list if (temp1.equals(list2)) { System.out.println("found!!!"); } else { ascending(list2, list1); // data, null temp1 = list1; // store processed value System.out.println("st list1 is "+list1); System.out.println("st list2 is "+list2); } fixedPoint(list2, list1); // null, processed data }

  Read the article

• PHP Session Class and $_SESSION Array

  - by Gianluca Bargelli

  Hello, i've implemented this custom PHP Session Class for storing sessions into a MySQL database: class Session { private $_session; public $maxTime; private $database; public function __construct(mysqli $database) { $this->database=$database; $this->maxTime['access'] = time(); $this->maxTime['gc'] = get_cfg_var('session.gc_maxlifetime'); session_set_save_handler(array($this,'_open'), array($this,'_close'), array($this,'_read'), array($this,'_write'), array($this,'_destroy'), array($this,'_clean') ); register_shutdown_function('session_write_close'); session_start();//SESSION START } public function _open() { return true; } public function _close() { $this->_clean($this->maxTime['gc']); } public function _read($id) { $getData= $this->database->prepare("SELECT data FROM Sessions AS Session WHERE Session.id = ?"); $getData->bind_param('s',$id); $getData->execute(); $allData= $getData->fetch(); $totalData = count($allData); $hasData=(bool) $totalData >=1; return $hasData ? $allData['data'] : ''; } public function _write($id, $data) { $getData = $this->database->prepare("REPLACE INTO Sessions VALUES (?, ?, ?)"); $getData->bind_param('sss', $id, $this->maxTime['access'], $data); return $getData->execute(); } public function _destroy($id) { $getData=$this->database->prepare("DELETE FROM Sessions WHERE id = ?"); $getData->bind_param('S', $id); return $getData->execute(); } public function _clean($max) { $old=($this->maxTime['access'] - $max); $getData = $this->database->prepare("DELETE FROM Sessions WHERE access < ?"); $getData->bind_param('s', $old); return $getData->execute(); } } It works well but i don't really know how to properly access the $_SESSION array: For example: $db=new DBClass();//This is a custom database class $session=new Session($db->getConnection()); if (isset($_SESSION['user'])) { echo($_SESSION['user']);//THIS IS NEVER EXECUTED! } else { $_SESSION['user']="test"; Echo("Session created!"); } At every page refresh it seems that $_SESSION['user'] is somehow "resetted", what methods can i apply to prevent such behaviour?

  Read the article

• Rails send mail with GMail

  - by Danny McClelland

  Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

  Read the article

• Drill down rss reader iphone

  - by bing

  Hi everyone, I have made a simple rss reader. The app loads an xml atom file in an array. Now I have added categories to my atom feed, which are first loaded in the array What is the best way to add drill down functionality programmatically. Now only the categories are loaded into the array and displayed. This is the implementation code ..... loading xml file <snip> ..... - (void)parserDidStartDocument:(NSXMLParser *)parser { NSLog(@"found file and started parsing"); } - (void)parser:(NSXMLParser *)parser parseErrorOccurred:(NSError *)parseError { NSString * errorString = [NSString stringWithFormat:@"Unable to download story feed from web site (Error code %i )", [parseError code]]; NSLog(@"error parsing XML: %@", errorString); UIAlertView * errorAlert = [[UIAlertView alloc] initWithTitle:@"Error loading content" message:errorString delegate:self cancelButtonTitle:@"OK" otherButtonTitles:nil]; [errorAlert show]; } - (void)parser:(NSXMLParser *)parser didStartElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName attributes:(NSDictionary *)attributeDict{ //NSLog(@"found this element: %@", elementName); currentElement = [elementName copy]; if ([elementName isEqualToString:@"entry"]) { // clear out our story item caches... Categoryentry = [[NSMutableDictionary alloc] init]; currentID = [[NSMutableString alloc] init]; currentTitle = [[NSMutableString alloc] init]; currentSummary = [[NSMutableString alloc] init]; currentContent = [[NSMutableString alloc] init]; } } - (void)parser:(NSXMLParser *)parser didEndElement:(NSString *)elementName namespaceURI:(NSString *)namespaceURI qualifiedName:(NSString *)qName{ //NSLog(@"ended element: %@", elementName); if ([elementName isEqualToString:@"entry"]) { // save values to an entry, then store that item into the array... [Categoryentry setObject:currentTitle forKey:@"title"]; [Categoryentry setObject:currentID forKey:@"id"]; [Categoryentry setObject:currentSummary forKey:@"summary"]; [Categoryentry setObject:currentContent forKey:@"content"]; [categories addObject:[Categoryentry copy]]; NSLog(@"adding category: %@", currentTitle); } } - (void)parser:(NSXMLParser *)parser foundCharacters:(NSString *)string{ //NSLog(@"found characters: %@", string); // save the characters for the current item... if ([currentElement isEqualToString:@"title"]) { [currentTitle appendString:string]; } else if ([currentElement isEqualToString:@"id"]) { [currentID appendString:string]; } else if ([currentElement isEqualToString:@"summary"]) { [currentSummary appendString:string]; } else if ([currentElement isEqualToString:@"content"]) { [currentContent appendString:string]; } } - (void)parserDidEndDocument:(NSXMLParser *)parser { [activityIndicator stopAnimating]; [activityIndicator removeFromSuperview]; NSLog(@"all done!"); NSLog(@"categories array has %d entries", [categories count]); [newsTable reloadData]; }

  Read the article

• Killing Mysql processes staying in sleep command.

  - by Shino88

  Hey I am connecting a MYSQL database through hibernate and i seem to have processes that are not being killed after they are finished in the session. I have called flush and close on each session but when i check the server the last processes are still there with a sleep command. This is a new problem which i am having and was not the case yesterday. Is there any way i can ensure the killng of theses processes when i am done with a session. Below is an example of one of my classes. public JSONObject check() { //creates a new session needed to add elements to a database Session session = null; //holds the result of the check in the database JSONObject check = new JSONObject(); try{ //creates a new session needed to add elements to a database SessionFactory sessionFactory = new Configuration().configure().buildSessionFactory(); session = sessionFactory.openSession(); if (justusername){ //query created to select a username from user table String hquery = "Select username from User user Where username = ? "; //query created Query query = session.createQuery(hquery); //sets the username of the query the values JSONObject contents query.setString(0, username); // executes query and adds username string variable String user = (String) query.uniqueResult(); //checks to see if result is found (null if not found) if (user == null) { //adds false to Jobject if not found check.put("indatabase", "false"); } else { check.put("indatabase", "true"); } //adds check to Jobject to say just to check username check.put("justusername", true); } else { //query created to select a username and password from user table String hquery = "Select username from User user Where username = :user and password = :pass "; Query query = session.createQuery(hquery); query.setString("user", username); query.setString("pass", password); String user = (String) query.uniqueResult(); if(user ==null) { check.put("indatabase", false); } else { check.put("indatabase", true); } check.put("justusername", false); } }catch(Exception e){ System.out.println(e.getMessage()); //logg.log(Level.WARNING, " Exception", e.getMessage()); }finally{ // Actual contact insertion will happen at this step session.flush(); session.close(); } //returns Jobject return check; }

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Solving a cyclical dependency in Ninject (Compact Framework)

  - by Alex

  I'm trying to use Ninject for dependency injection in my MVP application. However, I have a problem because I have two types that depend on each other, thus creating a cyclic dependency. At first, I understand that it was a problem, because I had both types require each other in their constructors. Therefore, I moved one of the dependencies to a property injection instead, but I'm still getting the error message. What am I doing wrong? This is the presenter: public class LoginPresenter : Presenter<ILoginView>, ILoginPresenter { public LoginPresenter( ILoginView view ) : base( view ) { } } and this is the view: public partial class LoginForm : Form, ILoginView { [Inject] public ILoginPresenter Presenter { private get; set; } public LoginForm() { InitializeComponent(); } } And here's the code that causes the exception: static class Program { /// <summary> /// The main entry point for the application. /// </summary> [MTAThread] static void Main() { // Show the login form Views.LoginForm loginForm = Kernel.Get<Views.Interfaces.ILoginView>() as Views.LoginForm; Application.Run( loginForm ); } } The exception happens on the line with the Kernel.Get<>() call. Here it is: Error activating ILoginPresenter using binding from ILoginPresenter to LoginPresenter A cyclical dependency was detected between the constructors of two services. Activation path: 4) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 3) Injection of dependency ILoginView into parameter view of constructor of type LoginPresenter 2) Injection of dependency ILoginPresenter into property Presenter of type LoginForm 1) Request for ILoginView Suggestions: 1) Ensure that you have not declared a dependency for ILoginPresenter on any implementations of the service. 2) Consider combining the services into a single one to remove the cycle. 3) Use property injection instead of constructor injection, and implement IInitializable if you need initialization logic to be run after property values have been injected. Why doesn't Ninject understand that since one is constructor injection and the other is property injection, this can work just fine? I even read somewhere looking for the solution to this problem that Ninject supposedly gets this right as long as the cyclic dependency isn't both in the constructors. Apparently not, though. Any help resolving this would be much appreciated.

  Read the article

• Problem in suspending 2 threads at the same time in MFC!

  - by kiddo

  I am learning about threading and multithreading..so i just created a small application in which i will update the progressbar and a static text using threading.I vl get two inputs from the user, start and end values for how long the loop should rotate.I have 2threads in my application. Thread1- to update the progressbar(according to the loop) the static text which will show the count(loop count). Thread2 - to update the another static text which will just diplay a name Basically if the user clicks start, the progressbar steps up and at the same time filecount and the name are displayed parallely. There's is another operation where if the user clicks pause it(thread) has to suspend until the user clicks resume. The problem is,the above will not work(will not suspend and resume) for both thread..but works for a singlw thread. Please check the code to get an idea and reply me what can done! on button click start void CThreadingEx3Dlg::OnBnClickedStart() { m_ProgressBar.SetRange(start,end); myThread1 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction1,this); myThread2 = AfxBeginThread((AFX_THREADPROC)MyThreadFunction2,this); } thread1 UINT MyThreadFunction1(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int intvalue =pthis->start;intvalue<=pthis->end; ++intvalue) { pthis->SendMessage(WM_MY_THREAD_MESSAGE1,intvalue); } return 0; } thread1 function LRESULT CThreadingEx3Dlg::OnThreadMessage1(WPARAM wparam,LPARAM lparam) { int nProgress= (int)wparam; m_ProgressBar.SetPos(nProgress); CString strStatus; strStatus.Format(L"Thread1:Processing item: %d", nProgress); m_Static.SetWindowText(strStatus); Sleep(100); return 0; } thread2 UINT MyThreadFunction2(LPARAM lparam) { CThreadingEx3Dlg* pthis = (CThreadingEx3Dlg*)lparam; for(int i =pthis->start;i<=pthis->end;i++) { pthis->SendMessage(WM_MY_THREAD_MESSAGE2,i); } return 0; } thread2 function LRESULT CThreadingEx3Dlg::OnThreadMessage2(WPARAM wparam,LPARAM lparam) { m_Static1.GetDlgItem(IDC_STATIC6); m_Static1.SetWindowTextW(L"Thread2 Running"); Sleep(100); m_Static1.SetWindowTextW(L""); Sleep(100); return TRUE; } void CThreadingEx3Dlg::OnBnClickedPause() { // TODO: Add your control notification handler code here if(!m_Track) { m_Track = TRUE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Resume"); myThread1->SuspendThread(); WaitForSingleObject(myThread1->m_hThread,INFINITE); myThread2->SuspendThread(); m_Static.SetWindowTextW(L"Paused.."); } else { m_Track = FALSE; GetDlgItem(IDCANCEL)->SetWindowTextW(L"Pause"); myThread1->ResumeThread(); myThread2->ResumeThread(); /*myEventHandler.SetEvent(); WaitForSingleObject(myThread1->m_hThread,INFINITE);*/ } }

  Read the article

• C# Serialization Surrogate - Cannot access a disposed object

  - by crushhawk

  I have an image class (VisionImage) that is a black box to me. I'm attempting to serialize the image object to file using Serialization Surrogates as explained on this page. Below is my surrogate code. sealed class VisionImageSerializationSurrogate : ISerializationSurrogate { public void GetObjectData(Object obj, SerializationInfo info, StreamingContext context) { VisionImage image = (VisionImage)obj; byte[,] temp = image.ImageToArray().U8; info.AddValue("width", image.Width); info.AddValue("height", image.Height); info.AddValue("pixelvalues", temp, temp.GetType()); } public Object SetObjectData(Object obj, SerializationInfo info, StreamingContext context, ISurrogateSelector selector) { VisionImage image = (VisionImage)obj; Int32 width = info.GetInt32("width"); Int32 height = info.GetInt32("height"); byte[,] temp = new byte[height, width]; temp = (byte[,])info.GetValue("pixelvalues", temp.GetType()); PixelValue2D tempPixels = new PixelValue2D(temp); image.ArrayToImage(tempPixels); return image; } } I've stepped through it to write to binary. It seems to be working fine (file is getting bigger as the images are captured). I tried to test it read the file back in. The values read back in are correct as far as the "info" object is concerned. When I get to the line image.ArrayToImage(tempPixels); It throws the "Cannot access a disposed object" exception. Upon further inspection, the object and the resulting image are both marked as disposed. My code behind the form spawns an "acquisitionWorker" and runs the following code. void acquisitionWorker_LoadImages(object sender, DoWorkEventArgs e) { // This is the main function of the acquisition background worker thread. // Perform image processing here instead of the UI thread to avoid a // sluggish or unresponsive UI. BackgroundWorker worker = (BackgroundWorker)sender; try { uint bufferNumber = 0; // Loop until we tell the thread to cancel or we get an error. When this // function completes the acquisitionWorker_RunWorkerCompleted method will // be called. while (!worker.CancellationPending) { VisionImage savedImage = (VisionImage) formatter.Deserialize(fs); CommonAlgorithms.Copy(savedImage, imageViewer.Image); // Update the UI by calling ReportProgress on the background worker. // This will call the acquisition_ProgressChanged method in the UI // thread, where it is safe to update UI elements. Do not update UI // elements directly in this thread as doing so could result in a // deadlock. worker.ReportProgress(0, bufferNumber); bufferNumber++; } } catch (ImaqException ex) { // If an error occurs and the background worker thread is not being // cancelled, then pass the exception along in the result so that // it can be handled in the acquisition_RunWorkerCompleted method. if (!worker.CancellationPending) e.Result = ex; } } What am I missing here? Why would the object be immediately disposed?

  Read the article

• UCA + Natural Sorting

  - by Alix Axel

  I recently learnt that PHP already supports the Unicode Collation Algorithm via the intl extension: $array = array ( 'al', 'be', 'Alpha', 'Beta', 'Álpha', 'Àlpha', 'Älpha', '????', 'img10.png', 'img12.png', 'img1.png', 'img2.png', ); if (extension_loaded('intl') === true) { collator_asort(collator_create('root'), $array); } Array ( [0] => al [2] => Alpha [4] => Álpha [5] => Àlpha [6] => Älpha [1] => be [3] => Beta [11] => img1.png [9] => img10.png [8] => img12.png [10] => img2.png [7] => ???? ) As you can see this seems to work perfectly, even with mixed case strings! The only drawback I've encountered so far is that there is no support for natural sorting and I'm wondering what would be the best way to work around that, so that I can merge the best of the two worlds. I've tried to specify the Collator::SORT_NUMERIC sort flag but the result is way messier: collator_asort(collator_create('root'), $array, Collator::SORT_NUMERIC); Array ( [8] => img12.png [7] => ???? [9] => img10.png [10] => img2.png [11] => img1.png [6] => Älpha [5] => Àlpha [1] => be [2] => Alpha [3] => Beta [4] => Álpha [0] => al ) However, if I run the same test with only the img*.png values I get the ideal output: Array ( [3] => img1.png [2] => img2.png [1] => img10.png [0] => img12.png ) Can anyone think of a way to preserve the Unicode sorting while adding natural sorting capabilities?

  Read the article

• CTE Join query issues

  - by Lee_McIntosh

  Hi everyone, this problem has me head going round in circles at the moment and i wondering if anyone could give any pointers as to where im going wrong. Im trying to produce a SPROC that produces a dataset to be called by SSRS for graphs spanning the last 6 months. The data for example purposes uses three tables (theres more but the it wont change the issue at hand) and are as follows: tbl_ReportList: Report Site ---------------- North abc North def East bbb East ccc East ddd South poa South pob South poc South pod West xyz tbl_TicketsRaisedThisMonth: Date Site Type NoOfTickets --------------------------------------------------------- 2010-07-01 00:00:00.000 abc Support 101 2010-07-01 00:00:00.000 abc Complaint 21 2010-07-01 00:00:00.000 def Support 6 ... 2010-12-01 00:00:00.000 abc Support 93 2010-12-01 00:00:00.000 xyz Support 5 tbl_FeedBackRequests: Date Site NoOfFeedBackR ---------------------------------------------------------------- 2010-07-01 00:00:00.000 abc 101 2010-07-01 00:00:00.000 def 11 ... 2010-12-01 00:00:00.000 abc 63 2010-12-01 00:00:00.000 xyz 4 I'm using CTE's to simplify the code, which is as follows: DECLARE @ReportName VarChar(200) SET @ReportName = 'North'; WITH TicketsRaisedThisMonth AS ( SELECT [Date], Site, SUM(NoOfTickets) AS NoOfTickets FROM tbl_TicketsRaisedThisMonth WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), FeedBackRequests AS ( SELECT [Date], Site, SUM(NoOfFeedBackR) AS NoOfFeedBackR FROM tbl_FeedBackRequests WHERE [Date] >= DATEADD(mm, DATEDIFF(m,0,GETDATE())-6,0) GROUP BY [Date], Site ), SELECT trtm.[Date] SUM(trtm.NoOfTickets) AS NoOfTickets, SUM(fbr.NoOfFeedBackR) AS NoOfFeedBackR, FROM Reports rpts LEFT OUTER JOIN TotalIncidentsDuringMonth trtm ON rpts.Site = trtm.Site LEFT OUTER JOIN LoggedComplaints fbr ON rpts.Site = fbr.Site WHERE rpts.report = @ReportName GROUP BY trtm.[Date] And the output when the sproc is pass a parameter such as 'North' to be as follows: Date NoOfTickets NoOfFeedBackR ----------------------------------------------------------------------------------- 2010-07-01 00:00:00.000 128 112 2010-08-01 00:00:00.000 <data for that month> <data for that month> 2010-09-01 00:00:00.000 <data for that month> <data for that month> 2010-10-01 00:00:00.000 <data for that month> <data for that month> 2010-11-01 00:00:00.000 <data for that month> <data for that month> 2010-12-01 00:00:00.000 122 63 The issue I'm having is that when i execute the query I'm given a repeated list of values of each month, such as 128 will repeat 6 times then another value for the next months value repeated 6 times, etc. argh!

  Read the article

• Linking two models in a multi-model form

  - by Elliot

  Hey Guys, I have a nested multimodel form right now, using Users and Profiles. Users has_one profile, and Profile belongs_to Users. When the form is submitted, a new user is created, and a new profile is created, but they are not linked (this is the first obvious issue). The user's model has a profile_id row, and the profile's model has a user_id row. Here is the code for the form: <%= form_for(@user, :url => teams_path) do |f| %> <p><%= f.label :email %><br /> <%= f.text_field :email %></p> <p><%= f.label :password %><br /> <%= f.password_field :password %></p> <p><%= f.label :password_confirmation %><br /> <%= f.password_field :password_confirmation %></p> <%= f.hidden_field :role_id, :value => @role.id %></p> <%= f.hidden_field :company_id, :value => current_user.company_id %></p> <%= fields_for @user.profile do |profile_fields| %> <div class="field"> <%= profile_fields.label :first_name %><br /> <%= profile_fields.text_field :first_name %> </div> <div class="field"> <%= profile_fields.label :last_name %><br /> <%= profile_fields.text_field :last_name %> </div> <% end %> <p><%= f.submit "Sign up" %></p> <% end %> A second issue, is even though the username, and password are successfully created through the form for the user model, the hidden fields (role_id & company_id - which are also links to other models) are not created (even though they are part of the model) - the values are successfully shown in the HTML for those fields however. Any help would be great!

  Read the article

• .NET Extension Objects with XSLT -- how to iterate over a collection?

  - by Pandincus

  Help me, Stackoverflow! I have a simple .NET 3.5 console app that reads some data and sends emails. I'm representing the email format in an XSLT stylesheet so that we can easily change the wording of the email without needing to recompile the app. We're using Extension Objects to pass data to the XSLT when we apply the transformation: <xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:msxsl="urn:schemas-microsoft-com:xslt" exclude-result-prefixes="msxsl" xmlns:EmailNotification="ext:EmailNotification"> -- this way, we can have statements like: <p> Dear <xsl:value-of select="EmailNotification:get_FullName()" />: </p> The above works fine. I pass the object via code like this (some irrelevant code omitted for brevity): // purely an example structure public struct EmailNotification { public string FullName { get; set; } } // Somewhere in some method ... var notification = new Notification("John Smith"); // ... XsltArgumentList xslArgs = new XsltArgumentList(); xslArgs.AddExtensionObject("ext:EmailNotification", notification); // ... // The part where it breaks! (This is where we do the transformation) xslt.Transform(fakeXMLDocument.CreateNavigator(), xslArgs, XmlWriter.Create(transformedXMLString)); So, all of the above code works. However, I wanted to get a little fancy (always my downfall) and pass a collection, so that I could do something like this: <p>The following accounts need to be verified:</p> <xsl:for-each select="EmailNotification:get_SomeCollection()"> <ul> <li> <xsl:value-of select="@SomeAttribute" /> </li> </ul> <xsl:for-each> When I pass the collection in the extension object and attempt to transform, I get the following error: "Extension function parameters or return values which have Clr type 'String[]' are not supported." or List, or IEnumerable, or whatever I try to pass in. So, my questions are: How can I pass in a collection to my XSLT? What do I put for the xsl:value-of select="" inside the xsl:for-each ? Is what I am trying to do impossible?

  Read the article

• Upgrading Entity Framework 1.0 to 4.0 to include foreign keys

  - by duthiega

  Currently I've been working with Entity Framework 1.0 which is located under a service façade. Below is one of the save methods I've created to either update or insert the device in question. This currently works but, I can't help feel that its a bit of a hack having to set the referenced properties to null then re-attach them just to get an insert to work. The changedDevice already holds these values, so why do I need to assign them again. So, I thought I'll update the model to EF4. That way I can just directly access the foreign keys. However, on doing this I've found that there doesn't seem to be an easy way to add the foreign keys except by removing the entity from the diagram and re-adding it. I don't want to do this as I've already been through all the entity properties renaming them from the DB column names. Can anyone help? /// <summary> /// Saves the non network device. /// </summary> /// <param name="nonNetworkDeviceDto">The non network device dto.</param> public void SaveNonNetworkDevice(NonNetworkDeviceDto nonNetworkDeviceDto) { using (var context = new AssetNetworkEntities2()) { var changedDevice = TransformationHelper.ConvertNonNetworkDeviceDtoToEntity(nonNetworkDeviceDto); if (!nonNetworkDeviceDto.DeviceId.Equals(-1)) { var originalDevice = context.NonNetworkDevices.Include("Status").Include("NonNetworkType").FirstOrDefault( d => d.DeviceId.Equals(nonNetworkDeviceDto.DeviceId)); context.ApplyAllReferencedPropertyChanges(originalDevice, changedDevice); context.ApplyCurrentValues(originalDevice.EntityKey.EntitySetName, changedDevice); } else { var maxNetworkDevice = context.NonNetworkDevices.OrderBy("it.DeviceId DESC").First(); changedDevice.DeviceId = maxNetworkDevice.DeviceId + 1; var status = changedDevice.Status; var nonNetworkType = changedDevice.NonNetworkType; changedDevice.Status = null; changedDevice.NonNetworkType = null; context.AttachTo("DeviceStatuses", status); if (nonNetworkType != null) { context.AttachTo("NonNetworkTypes", nonNetworkType); } changedDevice.Status = status; changedDevice.NonNetworkType = nonNetworkType; context.AddToNonNetworkDevices(changedDevice); } context.SaveChanges(); } }

  Read the article

• Using JavaScript to parse an XML file

  - by Chris Clouten

  I am new to Stack OverFlow and coding in general. I am trying to take an XML file and render it in the browser using JavaScript. I have looked around at some sample code of how to do this and came up with the following code: <!DOCTYPE html> <html> <body> <script> if (window.XMLHttpRequest) {// code for IE7+, Firefox, Chrome, Opera, Safari xmlhttp=new XMLHttpRequest(); } else {// code for IE6, IE5 xmlhttp=new ActiveXObject("Microsoft.XMLHTTP"); } xmlhttp.open("GET","social.xml",false); xmlhttp.send(); xmlDoc=xmlhttp.responseXML; document.write("<table border='1'>"); var x=xmlDoc.getElementsByTagName("CD"); for (i=0;i<x.length;i++) { document.write("<tr><td>"); document.write(x[i].getElementsByTagName("c_id")[0].childNodes[0].nodeValue); document.write("</td><td>"); document.write(x[i].getElementsByTagName("facebook_id")[0].childNodes[0].nodeValue); document.write("</td></tr>"); } document.write("</table>"); </script> </body> </html> Anyway, when I run this on my local server none of the data that I am trying to display in the table appears. My .html file and .xml file are in the same folder, so I believe I have the correct file pathway. I could just be making a rookie mistake here, but I can't for the life of me figure out why a table listing the c_id and facebook_id values is not being created. I looked around for answers and haven't been able to find any. Any help would be greatly appreciated. Thanks!

  Read the article

• Effective Data Validation

  - by John Conde

  What's an effective way to handle data validation, say, from a form submission? Originally I had a bunch of if statements that checked each value and collected invalid values in an array for later retrieval (and listing). // Store errors here $errors = array(); // Hypothetical check if a string is alphanumeric if (!preg_match('/^[a-z\d]+$/i', $fieldvalue)) { $errors[$fieldname] = 'Please only use letters and numbers for your street address'; } // etc... What I did next was create a class that handles various data validation scenarios and store the results in an internal array. After data validation was complete I would check to see if any errors occurred and handle accordingly: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more methods here public function creditCard($cardNumber, $field, $msg = '') { // Validate credit card number } // more methods here public function hasErrors() { return count($this->errorList); } } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue1, $fieldname1, 'Please only use letters and numbers for your street address'); $validate->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Naturally it didn't take long before this class became bloated with the virtually unlimited types of data to be validated. What I'm doing now is using decorators to separate the different types of data into their own classes and call them only when needed leaving generic validations (i.e. isAlphaNumeric()) in the base class: class Validation { private $errorList = array(); public function isAlphaNumeric($string, $field, $msg = '') { if (!preg_match('/^[a-z\d]+$/i', $string)) { $this->errorList[$field] = $msg; } } // more generic methods here public function setError($field, $msg = '') { $this->errorList[$field] = $msg; } public function hasErrors() { return count($this->errorList); } } class ValidationCreditCard { protected $validate; public function __construct(Validation $validate) { $this->validate = $validate; } public function creditCard($cardNumber, $field, $msg = '') { // Do validation // ... // if there is an error $this->validate->setError($field, $msg); } // more methods here } /* Client code */ $validate = new Validation(); $validate->isAlphaNumeric($fieldvalue, $fieldname, 'Please only use letters and numbers for your street address'); $validateCC = new ValidationCreditCard($validate); $validateCC->creditCard($fieldvalue2, $fieldname2, 'Please enter a valid credit card number'); if ($validate->hasErrors()) { // Handle as appropriate } Am I on the right track? Or did I just complicate data validation more then I needed to?

  Read the article

• PHP Parse Error unexpected '{'

  - by Laxmidi

  Hi, I'm getting a "Parse error: syntax error, unexpected '{' in line 2". And I don't see the problem. <?php class pointLocation {     var $pointOnVertex = true; // Check if the point sits exactly on one of the vertices     function pointLocation() {     }                   function pointInPolygon($point, $polygon, $pointOnVertex = true) {         $this->pointOnVertex = $pointOnVertex;                  // Transform string coordinates into arrays with x and y values         $point = $this->pointStringToCoordinates($point);         $vertices = array();          foreach ($polygon as $vertex) {             $vertices[] = $this->pointStringToCoordinates($vertex);          }                  // Check if the point sits exactly on a vertex         if ($this->pointOnVertex == true and $this->pointOnVertex($point, $vertices) == true) {             return "vertex";         }                  // Check if the point is inside the polygon or on the boundary         $intersections = 0;          $vertices_count = count($vertices);              for ($i=1; $i < $vertices_count; $i++) {             $vertex1 = $vertices[$i-1];              $vertex2 = $vertices[$i];             if ($vertex1['y'] == $vertex2['y'] and $vertex1['y'] == $point['y'] and $point['x'] > min($vertex1['x'], $vertex2['x']) and $point['x'] < max($vertex1['x'], $vertex2['x'])) { // Check if point is on an horizontal polygon boundary                 return "boundary";             }             if ($point['y'] > min($vertex1['y'], $vertex2['y']) and $point['y'] <= max($vertex1['y'], $vertex2['y']) and $point['x'] <= max($vertex1['x'], $vertex2['x']) and $vertex1['y'] != $vertex2['y']) {                  $xinters = ($point['y'] - $vertex1['y']) * ($vertex2['x'] - $vertex1['x']) / ($vertex2['y'] - $vertex1['y']) + $vertex1['x'];                  if ($xinters == $point['x']) { // Check if point is on the polygon boundary (other than horizontal)                     return "boundary";                 }                 if ($vertex1['x'] == $vertex2['x'] || $point['x'] <= $xinters) {                     $intersections++;                  }             }          }          // If the number of edges we passed through is even, then it's in the polygon.          if ($intersections % 2 != 0) {             return "inside";         } else {             return "outside";         }     }               function pointOnVertex($point, $vertices) {         foreach($vertices as $vertex) {             if ($point == $vertex) {                 return true;             }         }          }                   function pointStringToCoordinates($pointString) {         $coordinates = explode(" ", $pointString);         return array("x" => $coordinates[0], "y" => $coordinates[1]);     }           } $pointLocation = new pointLocation(); $points = array("30 19", "0 0", "10 0", "30 20", "11 0", "0 11", "0 10", "30 22", "20 20"); $polygon = array("10 0", "20 0", "30 10", "30 20", "20 30", "10 30", "0 20", "0 10", "10 0"); foreach($points as $key => $point) { echo "$key ($point) is " . $pointLocation->pointInPolygon($point, $polygon) . "<br>"; } ?> Does anyone see the problem? Thanks, -Laxmidi

  Read the article

< Previous Page | 654 655 656 657 658 659 660 661 662 663 664 665  | Next Page >