Search Results

Search found 23657 results on 947 pages for 'install sequence'.

Page 67/947 | < Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >

  • BAD ARCHIVE MIRROR using PXE BOOT method

    - by omkar
    i m trying to automatically install UBUNTU on a client PC by using the method of PXE BOOT method....my Objectives are below:- i m following the steps given in this link installation using PXE BOOT INSTALL 1:-the server will have a KICKSTART config file which contains the parameters for the OS installation and the files which are required for the OS installations. 2:-the client will have to detect this configuration along with the setup files and complete the installation without any input from the user. In my server i have installed DHCP3-server,Apache2 and TFTP for helping me with the installation. i have nearly achieved my first objective,i m able to boot my client using the files stored in the server,but during the installation stage it is asking me to "CHOOSE A MIRROR of UBUNTU ARCHIVE".i gave the server's IP address and the path in the server where the files are located but then too its giving me error "BAD ARCHIVE MIRROR". so is it possible that instead of downloading all the files from the internet and storing them on my disk , can i use the files which comes with the UBUNTU-CD, and how to store this files in what format (should i zip them ) on the disk. secondly i am also generating the ks.cfg which i wanted to give to the client for automatic installation of the OS ,so how should the configuration file be given to the installation process.

    Read the article

  • Recent ImageMagick on CentOS 6.3

    - by organicveggie
    I'm having a terrible time trying to get a recent version of ImageMagick installed on a CentOS 6.3 x86_64 server. First, I downloaded the RPM from the ImageMagick site and tried to install it. That failed due to missing dependencies: error: Failed dependencies: libHalf.so.4()(64bit) is needed by ImageMagick-6.8.0-4.x86_64 libIex.so.4()(64bit) is needed by ImageMagick-6.8.0-4.x86_64 libIlmImf.so.4()(64bit) is needed by ImageMagick-6.8.0-4.x86_64 libImath.so.4()(64bit) is needed by ImageMagick-6.8.0-4.x86_64 libltdl.so.3()(64bit) is needed by ImageMagick-6.8.0-4.x86_64 I have libtool-ltdl installed, but that includes libltdl.so.7, not libltdl.so.4. I have a similar problem with libHalf, libIex, libIlmImf and libImath. Typically, you can install OpenEXR to get those dependencies. Unfortunately, CentOS 6.3 includes OpenEXR 1.6.1, which includes ilmbase-devel 1.0.1. And that release of ilmbase-devel includes newer versions of those dependencies: libHalf.so.6 libIex.so.6 libIlmImf.so.6 libImath.so.6 I next tried following the instructions for installing ImageMagick from source. No luck there either. I get a build error: RPM build errors: File not found by glob: /home/sean/rpmbuild/BUILDROOT/ImageMagick-6.8.0-4.x86_64/usr/lib64/ImageMagick-6.8.0/modules-Q16/coders/djvu.* I even re-ran configure to explicitly exclude djvu and I still get the same error. At this point, I'm pulling my hair out. What's the easiest way to get a relatively recent version of ImageMagick ( 6.7) installed on CentOS 6.3? Does someone offer RPMs with dependencies somewhere?

    Read the article

  • Python easy_install confused on Mac OS X

    - by slf
    environment info: $ echo $PATH /opt/local/bin:/opt/local/sbin:/sw/bin:/sw/sbin:/usr/bin:/bin:/usr/sbin:/sbin:/usr/local/bin:/usr/X11/bin:/usr/X11R6/bin:/opt/local/bin:/Developer/Platforms/iPhoneOS.platform/Developer/usr/bin:~/.utility_scripts $ which easy_install /usr/bin/easy_install specifically, let's try the simplejson module (I know it's the same thing as import json in 2.6, but that isn't the point) $ sudo easy_install simplejson Searching for simplejson Reading http://pypi.python.org/simple/simplejson/ Reading http://undefined.org/python/#simplejson Best match: simplejson 2.1.0 Downloading http://pypi.python.org/packages/source/s/simplejson/simplejson-2.1.0.tar.gz#md5=3ea565fd1216462162c6929b264cf365 Processing simplejson-2.1.0.tar.gz Running simplejson-2.1.0/setup.py -q bdist_egg --dist-dir /tmp/easy_install-Ojv_yS/simplejson-2.1.0/egg-dist-tmp-AypFWa The required version of setuptools (>=0.6c11) is not available, and can't be installed while this script is running. Please install a more recent version first, using 'easy_install -U setuptools'. (Currently using setuptools 0.6c9 (/System/Library/Frameworks/Python.framework/Versions/2.6/Extras/lib/python)) error: Setup script exited with 2 ok, so I'll update setuptools... $ sudo easy_install -U setuptools Searching for setuptools Reading http://pypi.python.org/simple/setuptools/ Best match: setuptools 0.6c11 Processing setuptools-0.6c11-py2.6.egg setuptools 0.6c11 is already the active version in easy-install.pth Installing easy_install script to /usr/local/bin Installing easy_install-2.6 script to /usr/local/bin Using /Library/Python/2.6/site-packages/setuptools-0.6c11-py2.6.egg Processing dependencies for setuptools Finished processing dependencies for setuptools I'm not going to speculate, but this could have been caused by any number of environment changes like the Leopard - Snow Leopard upgrade, MacPorts or Fink updates, or multiple Google App Engine updates.

    Read the article

  • Software distribution from web server to client using PHP/FTP

    - by Jenolan
    I develop and maintain a number of add-ons and utilities for various widget (mainly aMember) which generally means I need to install php based codes onto other people's systems. Whilst I have a VPS and have access to rsync and all sorts of yummy tools most of the people I deal with have a basic ftp access and that's all folks. To upload from my local system is also a problem as I am satellite based (two-way) so it is fairly slow and expensive and in any case the files are already on my server. So there is no rsync, fxp, ssh and I can't really install anything as it is obviously not my system, they would be justifiably miffed if I started installing file managers or other things onto their sites. What I have been trying to find is a utility that I can run on my server from the web, preferably php based, that will be like a file manager but a bit different. Two panels. LH-Side the local server .. pretty much like a standard FM application RH-Side ability to login via FTP to the clients system Then I can fiddle as required. The closest thing I have found is net2ftp but it doesn't have the gui interface, at the moment I simply ssh into my server power up ncftp and run that way, but something easier to use would be mucho niceness. Thanks in advance! Larry

    Read the article

  • Windows installation repair option not showing up

    - by Jason
    I'm trying to repair an existing Windows XP installation. Following the instructions from http://www.microsoft.com/windowsxp/using/helpandsupport/learnmore/tips/doug92.mspx this should work: - 1.When the Press any key to boot from CD message is displayed on your screen, press a key to start your computer from the Windows XP CD. - 2.Press ENTER when you see the message To setup Windows XP now, and then press ENTER displayed on the Welcome to Setup screen. - 3.Do not choose the option to press R to use the Recovery Console. - 4.In the Windows XP Licensing Agreement, press F8 to agree to the license agreement. - 5.Make sure that your current installation of Windows XP is selected in the box, and then press R to repair Windows XP. - 6.Follow the instructions on the screen to complete Setup. On step 5 pressing R does nothing and there is nothing on the screen saying it would. When I just select to install I get a message that a previous installation is there and proceeding will destroy it and installed applications, I can optionally select a directory other than c:/windows, and I can optionally format before continuing. I had tried to go from SP2-SP3. It failed, and then I couldn't get to Safe Mode. I put the SP1 disk back in to do a repair, and I don't see that option. (I don't have an SP2 boot/install disk, I just have the non-boot upgrade package.)

    Read the article

  • How do I restart a Windows XP upgrade?

    - by Jason
    Is there a registry tweek to tell Windows Setup to start over? It tries to continue where it left off after I reboot. I can get to the Recovery Console. I tried to go from SP2-SP3. It failed, and I couldn't get to Safe Mode. I put in the SP1 disk (I don't have an SP2 boot disk, just the upgrade package.) It ran a couple minutes then gave me the error "the signature for windows xp professional upgrade is invalid" error code 800b0100. I rebooted to Safe Mode. I get to Safe Mode then say "Window XP Setup can't run under Safe Mode" press ok to restart. I put the SP3 disk back in, trying to get the "repair" option I didn't ever see putting in the SP1 disk, and it tried to continue the SP1 install - on the 4th step, and then gave the same signature error above. I need to get it to start over, so I can get to the repair option, to go back to SP2 (or install SP1 then add SP2 to it). Is there a registry tweek to tell Windows Setup to start over?

    Read the article

  • Easy_install the wrong version of python modules (Mac OS)

    - by user73250
    I installed Python 2.7 on my Mac. When typing "python" in terminal, it shows: $ python Python 2.7 (r27:82508, Jul 3 2010, 20:17:05) [GCC 4.0.1 (Apple Inc. build 5493)] on darwin Type "help", "copyright", "credits" or "license" for more information. The Python version is correct here. But when I try to easy_install some modules. The system will install the modules with python version 2.6 which are not able be imported to Python 2.7. And of course I can not do the functions I need in my code. Here's an example of easy_install graphy: $ easy_install graphy Searching for graphy Reading pypi.python.org/simple/graphy/ Reading http://code.Google.com/p/graphy/ Best match: Graphy 1.0.0 Downloading http://pypi.python.org/packages/source/G/Graphy/Graphy- 1.0.0.tar.gz#md5=390b4f9194d81d0590abac90c8b717e0 Processing Graphy-1.0.0.tar.gz Running Graphy-1.0.0/setup.py -q bdist_egg --dist-dir /var/folders/fH/fHwdy4WtHZOBytkg1nOv9E+++TI/-Tmp-/easy_install-cFL53r/Graphy-1.0.0/egg-dist-tmp-YtDCZU warning: no files found matching '*.tmpl' under directory 'graphy' warning: no files found matching '*.txt' under directory 'graphy' warning: no files found matching '*.h' under directory 'graphy' warning: no previously-included files matching '*.pyc' found under directory '.' warning: no previously-included files matching '*~' found under directory '.' warning: no previously-included files matching '*.aux' found under directory '.' zip_safe flag not set; analyzing archive contents... graphy.all_tests: module references __file__ Adding Graphy 1.0.0 to easy-install.pth file Installed /Library/Python/2.6/site-packages/Graphy-1.0.0-py2.6.egg Processing dependencies for graphy Finished processing dependencies for graphy So it installs graphy for Python 2.6. Can someone help me with it? I just want to set my default easy_install Python version to 2.7.

    Read the article

  • Where is the bare cygwin package list located and how do I manipulate it?

    - by matnagel
    Where is the bare cygwin package list located and how do I manipulate it programmatically or from a shell or with a different method than the gui? I know the gui (setup.exe), and I'd love to go one or more levels deeper. I can retrieve a list of selected/installed packages ( http://serverfault.com/questions/83456/cygwin-package-management ), but how do I write it back or to a different machine? What I have in mind is when I install a new windows I would like to start with my package list in text form, an apply or inject it somehow to the new system. Where is it? In the registry? In a binary file? in a local database? Or has anybody done this, is there a tool, a tutorial? The essence of what I want is to manipulate the selected package list with something else than the gui. It is ok for me to use the gui for the setup process. So I could imagein manipulating the package List and then run setup.exe and just click through it. Note: I do not want to manipulate the list of already installed packages but of packages that "should be installed". But if htis is not possible, maybe there is some workaround. E.g add an outdated version as installed and the installer will then install the new version.

    Read the article

  • Application (was Firefox) crash on first load on Ubuntu Linux on older Dell Laptop

    - by Ira Baxter
    I've had a Dell Latitude laptop since about 2000 without managing to destroy it. A month ago the Windows 2000 system on it did something stupid to its file system and Windows was completely lost. No point in reinstalling Windows 2000, so I installed an Ubuntu Linux on the laptop. Everything seems normal (installed, rebooted, I can log in, run GnuChess, poke about). ... but ... when I attempt to launch Firefox from the top bar menu icon, I get a bunch of disk activity, the whirling cursor icon goes round a bit and then (WAS: everything stops: icon, mouse. Literally nothing happens for 5 minutes. Ubuntu is dead, as far as I can tell. EDIT : on further investigation, spinning icon, mouse operated by touchpad freeze. There's apparantly a little disk activity occuring about every 5 seconds. I wait 5-10 minutes, behavior doesn't change) A reboot, and I can repeat this reliably. So on the face of it, everything works but Firefox. That seems really strange. The only odd thing about this system when Firefox is booting is that while it has an Ethernet port (that worked fine under Windows), it isn't actually plugged into an Ethernet. As this is the first Firefox boot since the Ubuntu install, maybe Firefox mishandles Internet access? Why would that crash Ubuntu? (I need to go try the obvious experiment of plugging it in). EDIT: I tried to run the Disk manager tool, not that I cared what it was, just a menu-available application. It started up like Firefox, I get a little tag in the lower left saying Disk P*** something had started, and then the same behavior as Firefox. At this point, I don't think its the Ethernet. Is it possible that the Ubuntu disk driver can't handle the disk controller in this older laptop? The install seemed to go fine.

    Read the article

  • (help help!!!) Easy_install the wrong version of python modules (Mac OS)

    - by user71415
    I installed Python 2.7 in my mac. When typing "python" in terminal, it shows: Ma-Xiaolongs-MacBook-Pro-2:~ MaXiaolong$ python Python 2.7 (r27:82508, Jul 3 2010, 20:17:05) [GCC 4.0.1 (Apple Inc. build 5493)] on darwin Type "help", "copyright", "credits" or "license" for more information. The Python version is correct here. But when I try to easy_install some modules. The system will install the modules with python version 2.6 which are not able be imported to Python 2.7. And of course I can not do the functions I need in my code. Here's an example of easy_install graphy: Ma-Xiaolongs-MacBook-Pro-2:~ MaXiaolong$ easy_install graphy Searching for graphy Reading pypi.python.org/simple/graphy/ Reading http://code.google.com/p/graphy/ Best match: Graphy 1.0.0 Downloading http://pypi.python.org/packages/source/G/Graphy/Graphy- 1.0.0.tar.gz#md5=390b4f9194d81d0590abac90c8b717e0 Processing Graphy-1.0.0.tar.gz Running Graphy-1.0.0/setup.py -q bdist_egg --dist-dir /var/folders/fH/fHwdy4WtHZOBytkg1nOv9E+++TI/-Tmp-/easy_install-cFL53r/Graphy-1.0.0/egg-dist-tmp-YtDCZU warning: no files found matching '.tmpl' under directory 'graphy' warning: no files found matching '.txt' under directory 'graphy' warning: no files found matching '.h' under directory 'graphy' warning: no previously-included files matching '.pyc' found under directory '.' warning: no previously-included files matching '~' found under directory '.' warning: no previously-included files matching '.aux' found under directory '.' zip_safe flag not set; analyzing archive contents... graphy.all_tests: module references file Adding Graphy 1.0.0 to easy-install.pth file Installed /Library/Python/2.6/site-packages/Graphy-1.0.0-py2.6.egg Processing dependencies for graphy Finished processing dependencies for graphy So it installs graphy for python 2.6. Can someone help me with it? I just want to set my default easy_install version as 2.7... Thank you very much!!!!!!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Replacing unversioned files in WiX major upgrade.

    - by Joshua
    I am still having this problem. This is the closest I have come to a solution that works, and yet it doesn't quite work. Here is (most of) the code: <Product Id='$(var.ProductCode)' UpgradeCode='$(var.UpgradeCode)' Name="Pathways" Version='$(var.ProductVersion)' Manufacturer='$(var.Manufacturer)' Language='1033'> Maximum="$(var.ProductVersion)" IncludeMaximum="no" Language="1033" Property="OLDAPPFOUND" / -- -- -- There is a later version of this program installed. The problem I am having is that I need the two files in the Database component to replace the previous copies. Since these files are unversioned, I have attempted to use the CompanionFile tag set to the PathwaysExe since that is the main executable of the application, and it IS being updated, even if the log says it isn't! The strangest thing about this is that the PathwaysLdf file IS BEING UPDATED CORRECTLY, and the PathwaysMdf file IS NOT. The log seems to indicate that the "Existing file is of an equal version (Checked using version of companion)". This is very strange because that file is being replaced just fine. The only idea I have left is that this problem has to do with the install sequence, and I'm not sure how to proceed! I have the InstallExecuteSequence set like I do because of the SettingsXml file, and my need to NOT overwrite that file, which is actually working now, so whatever solution works for the database files can't break the working settings file! ;) The full log is located at: http://pastebin.com/HFiGKuKN PLEASE AND THANK YOU!

    Read the article

  • rake test not copying development postgres db with sequences

    - by Robert Crida
    I am trying to develop a rails application on postgresql using a sequence to increment a field instead of a default ruby approach based on validates_uniqueness_of. This has proved challenging for a number of reasons: 1. This is a migration of an existing table, not a new table or column 2. Using parameter :default = "nextval('seq')" didn't work because it tries to set it in parenthesis 3. Eventually got migration working in 2 steps: change_column :work_commencement_orders, :wco_number_suffix, :integer, :null => false#, :options => "set default nextval('wco_number_suffix_seq')" execute %{ ALTER TABLE work_commencement_orders ALTER COLUMN wco_number_suffix SET DEFAULT nextval('wco_number_suffix_seq'); } Now this would appear to have done the correct thing in the development database and the schema looks like: wco_number_suffix | integer | not null default nextval('wco_number_suffix_seq'::regclass) However, the tests are failing with PGError: ERROR: null value in column "wco_number_suffix" violates not-null constraint : INSERT INTO "work_commencement_orders" ("expense_account_id", "created_at", "process_id", "vo2_issued_on", "wco_template", "updated_at", "notes", "process_type", "vo_number", "vo_issued_on", "vo2_number", "wco_type_id", "created_by", "contractor_id", "old_wco_type", "master_wco_number", "deadline", "updated_by", "detail", "elective_id", "authorization_batch_id", "delivery_lat", "delivery_long", "operational", "state", "issued_on", "delivery_detail") VALUES(226, '2010-05-31 07:02:16.764215', 728, NULL, E'Default', '2010-05-31 07:02:16.764215', NULL, E'Procurement::Process', NULL, NULL, NULL, 226, NULL, 276, NULL, E'MWCO-213', '2010-06-14 07:02:16.756952', NULL, E'Name 4597', 220, NULL, NULL, NULL, 'f', E'pending', NULL, E'728 Test Road; Test Town; 1234; Test Land') RETURNING "id" The explanation can be found when you inspect the schema of the test database: wco_number_suffix | integer | not null So what happened to the default? I tried adding task: template: smmt_ops_development to the database.yml file which has the effect of issuing create database smmt_ops_test template = "smmt_ops_development" encoding = 'utf8' I have verified that if I issue this then it does in fact copy the default nextval. So clearly rails is doing something after that to suppress it again. Any suggestions as to how to fix this? Thanks Robert

    Read the article

  • Best suited tool to document message processing done in C written program

    - by user3494614
    I am relatively new to UML and it's seems to be very vast I have a small program which basically receives messages on socket and then depending upon message ID embedded as first byte of message it processes the buffer. There are around 5 different message ID which it processes and communicates on another socket and has around 8 major functions. So program in short is like this. I am not pasting entire .c file or main function but just giving some bits and pieces of it so that to get idea of program flow. int main(int argc, char** argv) { register_shared_mem(); listen(); while(get_next_message(buffer)) { switch((msg)(buffer)->id) { case TYPE1: process1(); answer(); ..... } } } I want to document this is pictorial way like for Message type 1 it calls this function which calls another and which calls another. Please let me know any open source tool which will allow me to quickly draw such kind of UML or sequence diagram and will also allow me to write brief description of what each function does? Thanks In Advance

    Read the article

  • PKG can't silent install on Mac Os 10.5

    - by ericdm
    I have made an Installer by PackageMaler3.0.6 on Mac OS 10.8. Also I have add a JavaScript function in Distribution,This function use for detect the certain App is running or not. Some code like this: var allProcess = new Array(); allProcess = system.applications.all(); var allProcessCount = allProcess.length; ... If I normally install (With Installer UI) this pkg on 10.8,10.7,10.5, it's Ok, all function works fine. If i use command line to silent install On 10.8,10.7 it's OK, no error. But if i silent install on 10.5.8, there will be an error in terminal(JavaScript error), can't install. If i remove the code of "var allProcessCount = allProcess.length;" It can silent install on 10.5.8, once if added the code like "allProcess.length" ,there will be an error,it looks like can't use the array property in silent install on 10.5, but 10.7,10.8 it's OK and install with UI it's also Ok on 10.5. Did anyone knows how can i slove this issue? Thanks!!!

    Read the article

  • Is there a single query that can update a "sequence number" across multiple groups?

    - by Drarok
    Given a table like below, is there a single-query way to update the table from this: | id | type_id | created_at | sequence | |----|---------|------------|----------| | 1 | 1 | 2010-04-26 | NULL | | 2 | 1 | 2010-04-27 | NULL | | 3 | 2 | 2010-04-28 | NULL | | 4 | 3 | 2010-04-28 | NULL | To this (note that created_at is used for ordering, and sequence is "grouped" by type_id): | id | type_id | created_at | sequence | |----|---------|------------|----------| | 1 | 1 | 2010-04-26 | 1 | | 2 | 1 | 2010-04-27 | 2 | | 3 | 2 | 2010-04-28 | 1 | | 4 | 3 | 2010-04-28 | 1 | I've seen some code before that used an @ variable like the following, that I thought might work: SET @seq = 0; UPDATE `log` SET `sequence` = @seq := @seq + 1 ORDER BY `created_at`; But that obviously doesn't reset the sequence to 1 for each type_id. If there's no single-query way to do this, what's the most efficient way? Data in this table may be deleted, so I'm planning to run a stored procedure after the user is done editing to re-sequence the table.

    Read the article

  • Failling install Ralink RT5592 driver on Ubuntu 14.04 LTS

    - by atisou
    My problem concerns the installation of a wi-fi driver (RT5592) for my new wi-fi adapter (PCE-N53) on my newly built computer. Basically, I don't manage to get the driver installed and therefore I cannot get the wifi to work. I know I am not the only one having this issue this year, between RT5592 driver and Ubuntu 14.04 LTS, in one way or the other. Is there anybody who has ever been able to fix this problem? It does not look like on all the posts I have been through... Following an answer to a same problem as mine (I was getting the same error message as Christopher Kyle Horton of "incompatible types" etc), I have applied the instructions and done the editings in a script as suggested by Paul B. Unfortunately I still do get error/warnings message (a different one this time) at the end of the make and the wi-fi still does not work. Below is a snapshot of the end of the message: In file included from /home/username/Downloads/PCE-N53/Linux/DPO_GPL_RT5592STA_LinuxSTA_v2.6.0.0_20120326/include/os/rt_linux.h:31:0, from /home/username/Downloads/PCE-N53/Linux/DPO_GPL_RT5592STA_LinuxSTA_v2.6.0.0_20120326/include/rtmp_os.h:44, from /home/username/Downloads/PCE-N53/Linux/DPO_GPL_RT5592STA_LinuxSTA_v2.6.0.0_20120326/include/rtmp_comm.h:69, from /home/username/Downloads/PCE-N53/Linux/DPO_GPL_RT5592STA_LinuxSTA_v2.6.0.0_20120326/os/linux/../../os/linux/pci_main_dev.c:31: include/linux/module.h:88:32: error: ‘__mod_pci_device_table’ aliased to undefined symbol ‘rt2860_pci_tbl’ extern const struct gtype##_id __mod_##gtype##_table \ ^ include/linux/module.h:146:3: note: in expansion of macro ‘MODULE_GENERIC_TABLE’ MODULE_GENERIC_TABLE(type##_device,name) ^ /home/username/Downloads/PCE-N53/Linux/DPO_GPL_RT5592STA_LinuxSTA_v2.6.0.0_20120326/os/linux/../../os/linux/pci_main_dev.c:73:1: note: in expansion of macro ‘MODULE_DEVICE_TABLE’ MODULE_DEVICE_TABLE(pci, rt2860_pci_tbl); ^ cc1: some warnings being treated as errors make[2]: *** [/home/username/Downloads/PCE-N53/Linux/DPO_GPL_RT5592STA_LinuxSTA_v2.6.0.0_20120326/os/linux/../../os/linux/pci_main_dev.o] Error 1 make[1]: *** [_module_/home/username/Downloads/PCE-N53/Linux/DPO_GPL_RT5592STA_LinuxSTA_v2.6.0.0_20120326/os/linux] Error 2 make[1]: Leaving directory `/usr/src/linux-headers-3.13.0-32-generic' make: *** [LINUX] Error 2 The full pastebin data: paste.ubuntu.com/8088834/ It looks from the message that one would need to edit manually some of/other scripts in the driver package, as did Paul B suggest in one case. But I have no idea how to do that. Here is the driver package of the wifi adapter: www.asus.com/uk/Networking/PCEN53/HelpDesk_Download/ My system is as following: OS: ubuntu 14.04 LTS wi-fi card: Asus PCE-N53 motherboard: Asus KCMA-D8 processor: AMD Opteron 4228 HE kernel: 3.13.0-32-generic Following this info from chili555 in here, below are some extra info about my system: lspci -nn | grep 0280 gives 04:00.0 Network controller [0280]: Ralink corp. RT5592 PCI2 Wireless Network Adapater [1814:5592] and sudo apt-get install linux-headers-generic returns linux-headers-generic is already the newest version. 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. If this is a kernel version (I have 3.13.0-32-generic) incompatibility issue with the driver as chilli555 suggests (the README file in the driver package says indeed it is compatible with kernel 2.6), how could one trick this around to make it work? that should be possible right? On ubuntu forums, the patches proposed dont work (leads the computer to freeze). Basically: is there anybody out there who has ever been able to make a PCE-N53 work on Ubuntu 14.04 LTS (kernel 3.13)? how shall I edit the driver package to make it work for my kernel?

    Read the article

  • Things to install on a new machine – revisited

    - by RoyOsherove
    as I prepare to get a new dev machine at work, I write the things I am going to install on it, before writing the first line of code on that machine: Control Freak Tools: Everything Search Engine – a free and amazingly fast search engine for files all over your machine. (just file names, not inside files). This is so fast I use it almost as a replacement for my start menu, but it’s also great for finding those files that get hidden and tucked away in dark places on my system. Ever had a situation where you needed to see exactly how many copies of X.dll were hiding on your machine and where? this tool is perfect for that. Google Chrome. It’s just fast. very fast. and Firefox has become the IE of alternative browsers in terms of speed and memory. Don’t even get me started on IE. TweetDeck – get a complete view of what’s up on twitter Total Commander – my still favorite file manager, over five years now. KatMouse – will scroll any window your hovering on, even if it’s not an active window, when you use scroll the wheel on it. PowerIso or Daemon Tools – for loading up ISO images of discs LogMeIn Ignition – quick access to your LogMeIn computers for online Backup: JungleDisk or BackBlaze KeePass – save important passwords MS Security Essentials – free anti virus that’s quoest and doesn’t make a mess of your system. for home: uTorrent – a torrent client that can read rss feeds (like the ones from ezrss.it ) Camtasia Studio and SnagIt – for recording and capturing the screen, and then adding cool effects on top. Foxit PDF Reader – much faster that adove reader. Toddler Keys (for home) – for when your baby wants to play with your keyboard. Live Writer – for writing blog posts for Lenovo ThinkPads – Lenovo System Update – if you have a “custom” system instead of the one that came built in, this will keep all your lenovo drivers up to date. FileZilla – for FTP stuff All the utils from sysinternals, (or try the live-links) especially: AutoRuns for deciding what’s really going to load at startup, procmon to see what’s really going on with processes in your system   Developer stuff: Reflector. Pure magic. Time saver. See source code of any compiled assembly. Resharper. Great for productivity and navigation across your source code FinalBuilder – a commercial build automation tool. Love it. much better than any xml based time hog out there. TeamCity – a great visual and friendly server to manage continuous integration. powerful features. Test Lint – a free addin for vs 2010 I helped create, that checks your unit tests for possible problems and hints you about it. TestDriven.NET – a great test runner for vs 2008 and 2010 with some powerful features. VisualSVN – a commercial tool if you use subversion. very reliable addin for vs 2008 and 2010 Beyond Compare – a powerful file and directory comparison tool. I love the fact that you can right click in windows exporer on any file and select “select left side to compare”, then right click on another file and select “compare with left side”. Great usability thought! PostSharp 2.0 – for addind system wide concepts into your code (tracing, exception management). Goes great hand in hand with.. SmartInspect – a powerful framework and viewer for tracing for your application. lots of hidden features. Crypto Obfuscator – a relatively new obfuscation tool for .NET that seems to do the job very well. Crypto Licensing – from the same company –finally a licensing solution that seems to really fit what I needed. And it works. Fiddler 2 – great for debugging and tracing http traffic to and from your app. Debugging Tools for Windows and DebugDiag  - great for debugging scenarios. still wanting more? I think this should keep you busy for a while.   Regulator and Regulazy – for testing and generating regular expressions Notepad 2 – for quick editing and viewing with syntax highlighting

    Read the article

  • Cant install software

    - by user53209
    So I just installed the ubuntu 11.10 .. And when i goto software center and try to download any software(use source).. all i get is a window saying that "Failed to download repository information" , "check your internet connection" and W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric_restricted_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric_universe_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric_multiverse_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch htt p ://archive.ubuntu.com/ubuntu/dists/oneiric/main/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric_main_i18n_Index , W:Failed to fetch http ://archive.ubuntu.com/ubuntu/dists/oneiric/multiverse/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric_multiverse_i18n_Index , W:Failed to fetch htt ://archive.ubuntu.com/ubuntu/dists/oneiric/restricted/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric_restricted_i18n_Index , W:Failed to fetch ht tp://archive.ubuntu.com/ubuntu/dists/oneiric/universe/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric_universe_i18n_Index , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_main_source_Sources Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_restricted_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_universe_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_multiverse_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch h tp://archive.ubuntu.com/ubuntu/dists/oneiric-updates/main/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_main_i18n_Index , W:Failed to fetch h ttp://archive.ubuntu.com/ubuntu/dists/oneiric-updates/multiverse/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_multiverse_i18n_Index , W:Failed to fetch ht tp://archive.ubuntu.com/ubuntu/dists/oneiric-updates/restricted/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_restricted_i18n_Index , W:Failed to fetch htt p://archive.ubuntu.com/ubuntu/dists/oneiric-updates/universe/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-updates_universe_i18n_Index , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_main_source_Sources Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_restricted_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_universe_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_multiverse_binary-i386_Packages Hash Sum mismatch , W:Failed to fetch h ttp://archive.ubuntu.com/ubuntu/dists/oneiric-backports/main/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_main_i18n_Index , W:Failed to fetch h ttp://archive.ubuntu.com/ubuntu/dists/oneiric-backports/multiverse/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_multiverse_i18n_Index , W:Failed to fetch ht tp://archive.ubuntu.com/ubuntu/dists/oneiric-backports/restricted/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_restricted_i18n_Index , W:Failed to fetch ht tp://archive.ubuntu.com/ubuntu/dists/oneiric-backports/universe/i18n/Index No Hash entry in Release file /var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-backports_universe_i18n_Index , W:Failed to fetch bzip2:/var/lib/apt/lists/partial/archive.ubuntu.com_ubuntu_dists_oneiric-security_main_source_Sources Hash Sum mismatch , E:Some index files failed to download. They have been ignored, or old ones used instead." Neglect the http typos, its to evade the 2 hyperlink.. I tried making a file in the apt.conf.d folder also, and added proxy entries, also set the system proxy.. and also the "network proxy", but nothing works.. And now I cant install any software!! Help needed

    Read the article

  • Ubuntu 12.04 Install - Black Screen - No Grub - Have run Boot Repair Disk

    - by Pat
    Day 4 of my purgatory. History: Had problems with live CD at first, had to set the "nomodeset" option ... and then it worked fine. Installed Ubuntu "Alongside" Windows XP from live CD (NOT wubi) Upon reboot after installation, I get the BIOS ... and then a black screen. If I hit shift after the BIOS screen I get text that says "loading GRUB ..", but then no GRUB ... just a black screen. What I have tried to do: Total re-installation ... 3 times now. Also tried with wubi, same black screen. Have gone back to the normal (non-wubi) install. After installation, I tried re-booting the live cd ... and trying to change GRUB file using: sudo gedit /etc/default/grub ... to "nomodeset" and "timeout=10" ... but won't let me save my changes because I'm using the live cd "in memory" system and don't have permissions to the disks (I think). I tried logging in ... but it won't let me. I then read many posts on this site. I'm stuck. This morning, I ran the "boot repair disk". Results here: http://paste.ubuntu.com/1132333/ What I think is wrong: Since I can get the live CD to run (perfectly) with the "nomodeset" option, I think all I need to do is get to GRUB to change that ... but I can't get to GRUB. Appreciate any advice. Pat Day 5 ... I downloaded "Super Grub 2 Disk" from: http://www.supergrubdisk.org/super-grub2-disk/ This looks promising. I can boot the disk and it brings me to a GRUB program that allows me to: 1) Boot to Windows ... which works 2) Boot to Ubuntu ... which does NOT work When I choose boot to Ubuntu, I get lines across the screen which is an obvious video card problem. Likely because I need to set the "nomodeset" option. So, I attempted to use super grub2 to edit the grub file ... but it is TOTALLY different than the Ubuntu grub file ... and I don't know where to put the "nomodeset" option. Still stuck ... The bottom line is that: 1) I need to edit /etc/default/grub on sda(1) ... which is my boot drive ... to add the "nomodeset" option 2) To do that I need to get into grub ... but, I can't. Holding down shift just echo's "loading grub .." and then takes me to a black screen 3) I can boot to the live CD by setting nomodeset .... but I cannot access the hard disk as root ... I can't save my changes! Can anyone tell me how to login as root for the filesystem from the live CD ... so I can edit the grub file on the HARD DISK ... and then run update-grub??

    Read the article

  • Install lubuntu 12.04 on an old Dell c600 : Video issues

    - by maniat1k
    I am trying to install lubuntu on an old laptop. I use the 386 alternate instalation of it, because it has only 256mb ... All when ok so when I start up the lubuntu the screen splits between 1024x768 and 800x600... its very horrible to use =). Ok I do this: lspci and found an ATI Rage mobility M3. 01:00.0 VGA compatible controller: ATI Technologies Inc Rage Mobility M3 AGP 2x (rev 02) So I tryied the old xorg way to edit the missing resolution, but it does not work:... Section "Screen" Identifier "Default Screen" Device "ATI Technologies, Inc. Rage Mobility M3 (AGP)" Monitor "Generic Monitor" DefaultDepth 24 SubSection "Display" Depth 1 Modes "1024x768" EndSubSection SubSection "Display" Depth 4 Modes "1024x768" EndSubSection SubSection "Display" Depth 8 Modes "1024x768" EndSubSection SubSection "Display" Depth 15 Modes "1024x768" EndSubSection SubSection "Display" Depth 16 Modes "1024x768" EndSubSection SubSection "Display" Depth 24 Modes "1024x768" EndSubSection EndSection on an brand new xorg.conf... Do an init 6 to see if X take the changes, but nothing habbened: also tryed to do pkg-reconfigure -changedir /etc/X11 (where I created the new xorg.conf) and nothing.. removed the X conf from /tmp.. also do sudo apt-get update / upgrade... and no luck... UPDATE Updated to 12.04. This an edited xorg fr old dells like mine: # xorg.conf (X.Org X Window System server configuration file) # # This file was generated by dexconf, the Debian X Configuration tool, using # values from the debconf database. # # Edit this file with caution, and see the xorg.conf manual page. # (Type "man xorg.conf" at the shell prompt.) # # This file is automatically updated on xserver-xorg package upgrades *only* # if it has not been modified since the last upgrade of the xserver-xorg # package. # # If you have edited this file but would like it to be automatically updated # again, run the following command: # sudo dpkg-reconfigure -phigh xserver-xorg # xorg.conf for dell latitude c600 by A. Howlett and others Section "ServerLayout" Identifier "Default Server Layout" Screen 0 "Screen0" InputDevice "Keyboard0" "CoreKeyboard" InputDevice "Mouse0" "CorePointer" InputDevice "Generic Mouse" "AlwaysCore" EndSection Section "Files" RgbPath "/usr/X11R6/lib/X11/rgb" FontPath "/usr/share/fonts/local" FontPath "/usr/share/fonts/misc" FontPath "/usr/share/fonts/75dpi:unscaled" FontPath "/usr/share/fonts/100dpi:unscaled" FontPath "/usr/share/fonts/Type1" FontPath "/usr/share/fonts/CID" FontPath "/usr/share/fonts/Speedo" FontPath "/usr/share/fonts/cyrillic" FontPath "/usr/share/fonts/artwiz-aleczapka" FontPath "/usr/share/fonts/TTF" FontPath "/usr/share/fonts/util" FontPath "/usr/local/share/fonts" FontPath "/usr/share/fonts" FontPath "/usr/share/fonts" FontPath "/usr/share/fonts/aquafont" FontPath "/usr/share/fonts/artwiz" FontPath "/usr/share/fonts/artwiz-aleczapka-en" FontPath "/usr/share/fonts/corefonts" FontPath "/usr/share/fonts/freefont" EndSection Section "Module" Load "GLcore" Load "dbe" Load "dri" Load "extmod" Load "glx" Load "pex5" Load "record" Load "xie" Load "v4l" Load "freetype" EndSection Section "InputDevice" Identifier "Keyboard0" Driver "keyboard" Option "XkbModel" "pc104" Option "XkbLayout" "us" EndSection Section "InputDevice" Identifier "Mouse0" Driver "mouse" Option "CorePointer" Option "Device" "/dev/psaux" Option "Protocol" "PS/2" Option "Emulate3Buttons" "true" Option "ZAxisMapping" "4 5" EndSection Section "InputDevice" Identifier "Generic Mouse" Driver "mouse" Option "SendCoreEvents" "true" Option "Device" "/dev/input/mice" Option "Protocol" "ImPS/2" Option "Emulate3Buttons" "true" Option "ZAxisMapping" "4 5" EndSection Section "Monitor" Identifier "laptop LCD" VendorName "Dell" ModelName "Latitude C600" HorizSync 31.5-48.5 VertRefresh 40-70 EndSection Section "Device" Identifier "Video0" Driver "r128" VideoRam 8192 Option "EnablePageFlip" "true" Option "AGPFastWrite" "true" Option "AGPMode" "2" BusID "PCI:01:00:0" Screen 0 Option "Display" "FP" Option "MonitorLayout" "CRT, LFP" EndSection Section "Screen" Identifier "Screen0" Device "Video0" Monitor "laptop LCD" DefaultDepth 16 Subsection "Display" Depth 32 Modes "1280x1024" "1152x864" "1024x768" "800x600" "640x480" EndSubSection Subsection "Display" Depth 24 Modes "1280x1024" "1152x864" "1024x768" "800x600" "640x480" EndSubSection Subsection "Display" Depth 16 Modes "1280x1024" "1152x864" "1024x768" "800x600" "640x480" EndSubSection Subsection "Display" Depth 8 Modes "1280x1024" "1152x864" "1024x768" "800x600" "640x480" EndSubSection EndSection Section "DRI" Mode 0666 EndSection

    Read the article

  • Fixing some Visual Studio RC install issues

    - by terje
    The Visual Studio RC has shown some install issues in some cases, particularly for those who upgrades from VS 11 Beta.  I have listed the fixes known now below, and will update if there are more issues.  Note that a repair will not fix the issue, and a Windows restore and subsequent reinstall may not fix it either.  The system seems to remember too much. That was the case for me, at least.  The fixes below however, cures these issues. 1. The Team Explorer Build node doesn’t work You get an error saying System.TypeLoadException like this: To solve this do as follows: 1. Open a command prompt as administrator 2. Go to your program files directory for VS 2012 and down to  the extension folder like:   C:\Program Files (x86)\Microsoft Visual Studio 11.0\Common7\IDE\CommonExtensions\Microsoft\TeamFoundation\Team Explorer 3. Run “gacutil –if Microsoft.TeamFoundation.Build.Controls.dll     2. The SQL Editor gives loading error When you start up VS 2012 RC you get a loading error message.  The same happens if you try to go from the menu to  SQL/Transact-SQL Editor/New Query.    To solve this do as follows: 1. Open Control Panel/Programs and Features 2. Locate the “Microsoft SQL Server 2012 Data-Tier App Framework     (Note , you might find up to 4 such instances) The ones with version numbers ending in 55 is from the SQL 2012 RC, the ones ending in 60 is from the SQL 2012 RTM.  There are two of each, one for x32 and one for x64.  Which is which no one knows. 3. Right click each of them, and select Repair. (It would be nice if someone with this issue tries only the latest RTM ones, and see if that clears the error, and comment back to this post. I am out of non-functioning VS’s )   3.  Errors referring to some extension You get errors referring to some extension that can’t be loaded, or can’t be found.  Check the activity log (see below), and verify there.  If you see yellow collision warnings there, the fix here should solve those too. To solve these:    1. Open a Visual Studio 2012 command prompt 2.  Run:   devenv /resetsettings     How to check for errors using the log Do as follows to get to the activity log for Visual studio 2012 RC 1. Open a Visual Studio 2012 command prompt 2. Run:   devenv /log This starts up Visual Studio.  3. Go to %appdata%/Microsoft\VisualStudio\11.0 4. Double click the file named ActivityLog.xml.  It will start up in your browser, and be formatted using the xslt in the same directory. 5.  Look for items marked in red.  Example for Issue 1 :

    Read the article

  • Fresh Ubuntu Install - Grub not loading

    - by Ryan Sharp
    System Ubuntu 12.04 64-bit Windows 7 SP1 Samsung 64GB SSD - OS' Samsung 1TB HDD - Games, /Home, Swap WD 300'ishGB HDD - Backup Okay, so I'm very frustrated, so please excuse me if I miss anything out as my head is clouded by anger and impatience, etc. I'll try me best, though. First of all, I'll explain how I got to my predicament. I finally got my new SSD. I firstly installed Windows, which completed without a hitch. Afterwards, I tried to install Ubuntu, which failed several times due to problems irrelevant to this question, but I mention this to explain my frustrations, sorry. Anyway, I finally installed Ubuntu. However, I chose the 'bootloader' to be installed on the same partition as where I was installing the Ubuntu Root partition, as that was what I believed to be the best choice. It was of my thinking that it was supposed to go on the same partition and on the SSD, which is my OS drive, though with my problem, it apparently was wrong. So I tried to fix it by checking guides and following their directions, but seemed to have messed it up even more. Here is what I receive after I use the fdisk -l command: (I also added explanations for which I used each partition for) Disk /dev/sda: 64.0 GB, 64023257088 bytes 255 heads, 63 sectors/track, 7783 cylinders, total 125045424 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x324971d1 Device Boot Start End Blocks Id System /dev/sda1 * 2048 206847 102400 7 HPFS/NTFS/exFAT /dev/sda2 208896 48957439 24374272 7 HPFS/NTFS/exFAT /dev/sda3 48959486 125044735 38042625 5 Extended /dev/sda5 48959488 125044735 38042624 83 Linux sda1 --/ Windows Recovery sda2 --/ Windows 7 sda3/5 --/ Ubuntu root [ / ] Disk /dev/sdb: 1000.2 GB, 1000204886016 bytes 255 heads, 63 sectors/track, 121601 cylinders, total 1953525168 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0xc0ee6a69 Device Boot Start End Blocks Id System /dev/sdb1 1024208894 1953523711 464657409 5 Extended /dev/sdb3 * 2048 1024206847 512102400 7 HPFS/NTFS/exFAT /dev/sdb5 1024208896 1939851263 457821184 83 Linux /dev/sdb6 1939853312 1953523711 6835200 82 Linux swap / Solaris sdb3 --/ Partition for Steam games, etc. sdb5 --/ Ubuntu Home [ /home ] sdb6 --/ Ubuntu Swap Partition table entries are not in disk order Disk /dev/sdc: 320.1 GB, 320072933376 bytes 255 heads, 63 sectors/track, 38913 cylinders, total 625142448 sectors Units = sectors of 1 * 512 = 512 bytes Sector size (logical/physical): 512 bytes / 512 bytes I/O size (minimum/optimal): 512 bytes / 512 bytes Disk identifier: 0x292eee23 Device Boot Start End Blocks Id System /dev/sdc1 2048 625141759 312569856 7 HPFS/NTFS/exFAT sdc1 --/ Generic backup I also used a Boot Script that other users suggested, so that I can give more details on my partitions and also where Grub is located... ============================= Boot Info Summary: =============================== => Grub2 (v1.99) is installed in the MBR of /dev/sda and looks at sector 1 of the same hard drive for core.img. core.img is at this location and looks for (,msdos5)/boot/grub on this drive. => Grub2 (v1.99) is installed in the MBR of /dev/sdb and looks at sector 1 of the same hard drive for core.img. core.img is at this location and looks for (,msdos5)/boot/grub on this drive. => Windows is installed in the MBR of /dev/sdc. Now that is weird... Why would Grub2 be installed on both my SSD and HDD? Even weirder is why is Windows on the MBR of my backup hard drive? Nothing I did should have done that... Anyway, here is the entire Output from that script... PASTEBIN So, to summarize what I need: How can I fix my setup so grub loads on startup? How can I clean my partitions to remove unnecessary grubs? What did I do wrong so that I don't do something so daft again? Thank you so much for reading, and I hope you can help me. I've been trying to have a successful setup since Friday, and I'm almost at the point that I'm really tempted to throw my computer out the window due to my frustration.

    Read the article

  • Install the Ajax Control Toolkit from NuGet

    - by Stephen Walther
    The Ajax Control Toolkit is now available from NuGet. This makes it super easy to add the latest version of the Ajax Control Toolkit to any Web Forms application. If you haven’t used NuGet yet, then you are missing out on a great tool which you can use with Visual Studio to add new features to an application. You can use NuGet with both ASP.NET MVC and ASP.NET Web Forms applications. NuGet is compatible with both Websites and Web Applications and it works with both C# and VB.NET applications. For example, I habitually use NuGet to add the latest version of ELMAH, Entity Framework, jQuery, jQuery UI, and jQuery Templates to applications that I create. To download NuGet, visit the NuGet website at: http://NuGet.org Imagine, for example, that you want to take advantage of the Ajax Control Toolkit RoundedCorners extender to create cross-browser compatible rounded corners in a Web Forms application. Follow these steps. Right click on your project in the Solution Explorer window and select the option Add Library Package Reference. In the Add Library Package Reference dialog, select the Online tab and enter AjaxControlToolkit in the search box: Click the Install button and the latest version of the Ajax Control Toolkit will be installed. Installing the Ajax Control Toolkit makes several modifications to your application. First, a reference to the Ajax Control Toolkit is added to your application. In a Web Application Project, you can see the new reference in the References folder: Installing the Ajax Control Toolkit NuGet package also updates your Web.config file. The tag prefix ajaxToolkit is registered so that you can easily use Ajax Control Toolkit controls within any page without adding a @Register directive to the page. <configuration> <system.web> <compilation debug="true" targetFramework="4.0" /> <pages> <controls> <add tagPrefix="ajaxToolkit" assembly="AjaxControlToolkit" namespace="AjaxControlToolkit" /> </controls> </pages> </system.web> </configuration> You should do a rebuild of your application by selecting the Visual Studio menu option Build, Rebuild Solution so that Visual Studio picks up on the new controls (You won’t get Intellisense for the Ajax Control Toolkit controls until you do a build). After you add the Ajax Control Toolkit to your application, you can start using any of the 40 Ajax Control Toolkit controls in your application (see http://www.asp.net/ajax/ajaxcontroltoolkit/samples/ for a reference for the controls). <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="WebForm1.aspx.cs" Inherits="WebApplication1.WebForm1" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title>Rounded Corners</title> <style type="text/css"> #pnl1 { background-color: gray; width: 200px; color:White; font: 14pt Verdana; } #pnl1_contents { padding: 10px; } </style> </head> <body> <form id="form1" runat="server"> <div> <asp:Panel ID="pnl1" runat="server"> <div id="pnl1_contents"> I have rounded corners! </div> </asp:Panel> <ajaxToolkit:ToolkitScriptManager ID="sm1" runat="server" /> <ajaxToolkit:RoundedCornersExtender TargetControlID="pnl1" runat="server" /> </div> </form> </body> </html> The page contains the following three controls: Panel – The Panel control named pnl1 contains the content which appears with rounded corners. ToolkitScriptManager – Every page which uses the Ajax Control Toolkit must contain a single ToolkitScriptManager. The ToolkitScriptManager loads all of the JavaScript files used by the Ajax Control Toolkit. RoundedCornersExtender – This Ajax Control Toolkit extender targets the Panel control. It makes the Panel control appear with rounded corners. You can control the “roundiness” of the corners by modifying the Radius property. Notice that you get Intellisense when typing the Ajax Control Toolkit tags. As soon as you type <ajaxToolkit, all of the available Ajax Control Toolkit controls appear: When you open the page in a browser, then the contents of the Panel appears with rounded corners. The advantage of using the RoundedCorners extender is that it is cross-browser compatible. It works great with Internet Explorer, Opera, Firefox, Chrome, and Safari even though different browsers implement rounded corners in different ways. The RoundedCorners extender even works with an ancient browser such as Internet Explorer 6. Getting the Latest Version of the Ajax Control Toolkit The Ajax Control Toolkit continues to evolve at a rapid pace. We are hard at work at fixing bugs and adding new features to the project. We plan to have a new release of the Ajax Control Toolkit each month. The easiest way to get the latest version of the Ajax Control Toolkit is to use NuGet. You can open the NuGet Add Library Package Reference dialog at any time to update the Ajax Control Toolkit to the latest version.

    Read the article

  • apt-get install was interrupted

    - by user3475299
    I am new to Ubuntu. I got the following lines after an interrupted apt-get install. Running depmod. update-initramfs: deferring update (hook will be called later) Examining /etc/kernel/postinst.d. run-parts: executing /etc/kernel/postinst.d/apt-auto-removal 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/initramfs-tools 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic update-initramfs: Generating /boot/initrd.img-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/pm-utils 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/update-notifier 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic run-parts: executing /etc/kernel/postinst.d/zz-update-grub 3.13.0-29-generic /boot/vmlinuz-3.13.0-29-generic /usr/sbin/grub-mkconfig: 14: /etc/default/grub: nouveau.modeset=0: not found run-parts: /etc/kernel/postinst.d/zz-update-grub exited with return code 127 Failed to process /etc/kernel/postinst.d at /var/lib/dpkg/info/linux-image-3.13.0-29-generic.postinst line 1025. No apport report written because the error message indicates its a followup error from a previous failure. No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already No apport report written because MaxReports is reached already dpkg: error processing package linux-image-3.13.0-29-generic (--configure): subprocess installed post-installation script returned error exit status 2 dpkg: dependency problems prevent configuration of linux-image-extra-3.13.0-29-generic: linux-image-extra-3.13.0-29-generic depends on linux-image-3.13.0-29-generic; however: Package linux-image-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-image-extra-3.13.0-29-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-image-generic: linux-image-generic depends on linux-image-3.13.0-29-generic; however: Package linux-image-3.13.0-29-generic is not configured yet. linux-image-generic depends on linux-image-extra-3.13.0-29-generic; however: Package linux-image-extra-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-image-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-generic: linux-generic depends on linux-image-generic (= 3.13.0.29.35); however: Package linux-image-generic is not configured yet. dpkg: error processing package linux-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-image-extra-3.13.0-27-generic: linux-image-extra-3.13.0-27-generic depends on linux-image-3.13.0-27-generic; however: Package linux-image-3.13.0-27-generic is not configured yet. dpkg: error processing package linux-image-extra-3.13.0-27-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-image-3.13.0-29-generic: linux-signed-image-3.13.0-29-generic depends on linux-image-3.13.0-29-generic (= 3.13.0-29.53); however: Package linux-image-3.13.0-29-generic is not configured yet. linux-signed-image-3.13.0-29-generic depends on linux-image-extra-3.13.0-29-generic (= 3.13.0-29.53); however: Package linux-image-extra-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-signed-image-3.13.0-29-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-image-generic: linux-signed-image-generic depends on linux-signed-image-3.13.0-29-generic; however: Package linux-signed-image-3.13.0-29-generic is not configured yet. dpkg: error processing package linux-signed-image-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-generic: linux-signed-generic depends on linux-signed-image-generic (= 3.13.0.29.35); however: Package linux-signed-image-generic is not configured yet. dpkg: error processing package linux-signed-generic (--configure): dependency problems - leaving unconfigured dpkg: dependency problems prevent configuration of linux-signed-image-3.13.0-27-generic: linux-signed-image-3.13.0-27-generic depends on linux-image-3.13.0-27-generic (= 3.13.0-27.50); however: Package linux-image-3.13.0-27-generic is not configured yet. linux-signed-image-3.13.0-27-generic depends on linux-image-extra-3.13.0-27-generic (= 3.13.0-27.50); however: Package linux-image-extra-3.13.0-27-generic is not configured yet. dpkg: error processing package linux-signed-image-3.13.0-27-generic (--configure): dependency problems - leaving unconfigured Setting up libxkbcommon-x11-0:amd64 (0.4.1-0ubuntu1) ... Setting up libqt5gui5:amd64 (5.2.1+dfsg-1ubuntu14.2) ... Processing triggers for libc-bin (2.19-0ubuntu6) ... Errors were encountered while processing: linux-image-3.13.0-27-generic linux-image-3.13.0-29-generic linux-image-extra-3.13.0-29-generic linux-image-generic linux-generic linux-image-extra-3.13.0-27-generic linux-signed-image-3.13.0-29-generic linux-signed-image-generic linux-signed-generic linux-signed-image-3.13.0-27-generic E: Sub-process /usr/bin/dpkg returned an error code (1)

    Read the article

< Previous Page | 63 64 65 66 67 68 69 70 71 72 73 74  | Next Page >