Search Results

Search found 30896 results on 1236 pages for 'best buy'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 675/1236 | < Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >

  • Is Tomcat 6 ready for continuous integration or how to get it work?

    - by Philipp Sende
    Hello stackoverflow community, I'm looking for a hint how to make tomcat CI ready or an servlet container / application container which stand often redeploys like they happen when using hudson ci. I experienced that Tomcat 6 does not properly undeploy webapps, leaving classes in jvm. For example I monitored tomcat 6 with VisualVM: on start 2000 classes, on deploy of an app 3000 after redeploy 4000 and redeploy 5000 classes and so on - leading to crashes, memory leaks... Okay hope one have a hint on tomcat and continuous-integration or other app servers. Best,

    Read the article

  • OpenGL: Implementing transformation matrix stack

    - by Jakub M.
    In a newer OpenGL there is no matrix stack. I am working on a simple display engine, and I am going to implement the transformation stack. What is a common strategy here? Should I build a push/pop stack, and use it with a tree representing my model? I suppose this is the "old" approach, that was deprecated in the newer OpenGL versions. Maybe then it is not the best solution (it was removed for some reason)

    Read the article

  • Custom search engine in asp.net mvc and entity framework

    - by Rahat
    Hi, does anyone have any idea how I can get started building a search engine for my asp.net mvc site using entity framework. I plan to build something like: http://www.carsguide.com.au/search/?N=4294962119++492&type=cars there on the left there is a refine search option panel. What's the best approach to design a model for the UI and optimized query with entity framework.

    Read the article

  • Get just the hour of day from DateTime using either 12 or 24 hour format as defined by the current c

    - by InvisibleBacon
    .Net has the built in ToShortDateString() function for DateTime that uses the CultureInfo.CurrentCulture.DateTimeFormat.ShortTimePattern format. It returns something like this for en-US: "5:00 pm". For a 24 hour culture such as de-DE it would return "17:00". What I want is a way to just return just the hour (So "5 pm" and "17" in the cases above) that works with every culture. What's the best/cleanest way to do this? Thanks!

    Read the article

  • SQLite and Portuguese-br characters

    - by ForeignerBR
    I'm developing an app that requires the storage of Portuguese characters. I was wondering if I need to do any configuration to prepare my SQLite db to store those considered special characters. When I query a db table that contains those characters I get a '?' (without quotes) in their place. best regards, mp

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Tuples vs. Anonymous Types vs. Expando object. (in regards to LINQ queries)

    - by punkouter
    I am a beginner who finally started understanding anonymous types. (see old post http://stackoverflow.com/questions/3010147/what-is-the-return-type-for-a-anonymous-linq-query-select-what-is-the-best-way-t) So in LINQ queries you form the type of return value you want within the linq query right? It seems the way to do this is anonymous type right? Can someone explain to me if and when I could use a Tuple/Expando object instead? They all seem very simliar?

    Read the article

  • Programmatically add an application to Windows Firewall

    - by RichieACC
    I have an application that is installed and updated via ClickOnce. The application downloads files via FTP, and therefore needs to be added as an exception to the windows firewall. Because of the way that ClickOnce works, the path to the EXE changes with every update, so the exception needs to change also. What would be the best way to have the changes made to the firewall so that it's invisible to the end user? (The application is written in C#)

    Read the article

  • Eclipse project artefacts in Maven repository

    - by Georgios Gousios
    I want to use some of the libraries produced by the Eclipse project through Maven. I 've had a look at the main Maven repo and while it looks like that there are a few projects already imported, their versions are old and some important ones are missing (e.g. cdt). Is there any Eclipse project official Maven repository? If not, what would be the best option to use current versions of libraries such as the JDT compiler in a maven-enabled project?

    Read the article

  • wpf Image resources and visual studio 2010 resource editor

    - by Berryl
    Hello My motivation for this question is really just to specify an image to be used in a user control via a dependency property for ImageSource. I'm hitting some pain points involving the management, access, and unit testing for this. Is the resource editor a good tool to use to maintain images for the application? What is the best way to translate the Bitmap from the editor to an ImageSource? How can I grab the resource Filename from the editor? Cheers, Berryl

    Read the article

  • Passing login details between pages in jQuery Mobile?

    - by manraj82
    I am a newbie to jQuery Mobile and trying to come with the best and scure way of passing login details between pages in jQuery Mobile.I did a quick search and found some solutions, Solution 1 :Since its the same dom data can be accessed using plain old variables. Solution 2 :Use HTML5 sessionStorage I have not found anymore solutions yet.If some one has successfully implemented this,could you please advise how I should go about doing this? Thank You

    Read the article

  • Inter process communication C# <--> C++ for game debugging engine.

    - by Andy
    I am working on a debugger project for a game's scripting engine. I'm hoping to write the debugger's GUI in C#. The actual debugging engine, however, is embedded in the game itself and is written in a mixture of C, C++, and assembly patches. What's the best way to handle communication between the debugger GUI and the debugging engine? The two will be running in separate processes. Thanks! Andy

    Read the article

  • Play audio file on hover

    - by powtac
    What is the best solution to play an audio file on mouse over via JavaScript? And stop it when the mouse leaves the link. jQuery is available. <a href="/test.mp3" class="play">play</a>

    Read the article

  • How do I use a string as a keyword argument?

    - by Issac Kelly
    Specifically, I'm trying to use a string to arbitrairly filter the ORM. I've tried exec and eval solutions, but I'm running into walls. The code below doesn't work, but it's the best way I know how to explain where I'm trying to go from gblocks.models import Image f = 'image__endswith="jpg"' # Would be scripted in another area, but passed as text <user input> d = Image.objects.filter(f) #for the non-django pythonistas: d = Image.objects.filter(image__endswith="jpg") # would be the non-dynamic equivalent.

    Read the article

  • PHP echo query result in Class??

    - by Jerry
    Hi all I have a question about PHP Class. I am trying to get the result from Mysql via PHP. I would like to know if the best practice is to display the result inside the Class or store the result and handle it in html. For example, display result inside the Class class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); } while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ //display the result..ex: echo $row['winner']; } mysql_close($scheduleQuery); //no returns } } Or return the query result as a variable and handle in php class Schedule { public $currentWeek; function teamQuery($currentWeek){ $this->currentWeek=$currentWeek; } function getSchedule(){ $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } $scheduleQuery=mysql_query("SELECT guest, home, time, winner, pickEnable FROM $this->currentWeek ORDER BY time", $connection); if (!$scheduleQuery){ die("database has errors: ".mysql_error()); // create an array } $ret = array(); while($row=mysql_fetch_array($scheduleQuery, MYSQL_NUMS)){ $ret[]=$row; } mysql_close($scheduleQuery); return $ret; // and handle the return value in php } } Two things here: I found that returned variable in php is a little bit complex to play with since it is two dimension array. I am not sure what the best practice is and would like to ask you experts opinions. Every time I create a new method, I have to recreate the $connection variable: see below $connection = mysql_connect(DB_SERVER,DB_USER,DB_PASS); if (!$connection) { die("Database connection failed: " . mysql_error()); } $db_select = mysql_select_db(DB_NAME,$connection); if (!$db_select) { die("Database selection failed: " . mysql_error()); } It seems like redundant to me. Can I only do it once instead of calling it anytime I need a query? I am new to php class. hope you guys can help me. thanks.

    Read the article

  • Can this django query be improved?

    - by Hobhouse
    Given a model structure like this: class Book(models.Model): user = models.ForeignKey(User) class Readingdate(models.Model): book = models.ForeignKey(Book) date = models.DateField() One book may have several readingdates. How do I list books having at least one readingdate within a specific year? I can do this: from_date = datetime.date(2010,1,1) to_date = datetime.date(2010,12,31) book_ids = Readingdate.objects\ .filter(date__range=(from_date,to_date))\ .values_list('book_id', flat=True) books_read_2010 = Book.objects.filter(id__in=book_ids) Is it possible to do this with one queryset, or is this the best way?

    Read the article

  • Is Borland C++ v3 for DOS available anywhere now?

    - by Galwegian
    Hi, I'm looking for a copy of either Borland C++ v3 or Turbo C++ which can run on DOS, but my searches are turning up a blank. I vaguely remember a free Turbo version available, but can't track it down. Are there free/pay versions of these still available? Is http://www.embarcadero.com my best hope? Thanks for any info...

    Read the article

  • Run python in a separate process

    - by Bialecki
    I'm looking for a quick bash script or program that will allow me to kick off a python script in a separate process. What's the best way to do this? I know this is incredibly simple, just curious if there's a preferred way to do it.

    Read the article

  • How to localize ASP .Net MVC application?

    - by pirho
    What would be best practice to localize your ASP .Net MVC application ? I would like to cover two situations: one application deployment in IIS which would handle multiple languages one language / application deployment. In first situation should you go with somekind of view based thing like, ~/View/EN, ~/View/FI, ~/View/SWE or something different ? What about second case, just application based config via Web.config and point these different languages to different urls ?

    Read the article

  • I simple search controller that stores search history, should I use resource routing or non-resource?

    - by vfilby
    I am learning rails and am toying with a simple web-app that integrates with flickr to search photos based on user given criteria and store the query in a search history table. I am seeking the best or 'rails' way of handling this. Should I setup a controller and non-resource routes that handle the search and store the data in a custom table; or should I create a resource for queries with a resource route and an additional path for search?

    Read the article

  • Letting users try your web app before sign-up: sessions or temp db?

    - by Mat
    I've seen a few instances now where web applications are letting try them out without you having to sign-up (though to save you need to of course). example: try at http://minutedock.com/ I'm wondering about doing this for my own web app and the fundamental question is whether to store their info into sessions or into a temp user table? The temp user table would allow logging and potentially be less of a hit on the server, correct? Is there a best practice here?

    Read the article

  • Rearrange items in ListBox

    - by superexsl
    Hey, I have a ListBox with a number of ListBoxItem objects. What is the best way to allow users to rearrange the items by dragging and dropping? Do I have to use StackPanels instead? Thanks for any suggestions

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 671 672 673 674 675 676 677 678 679 680 681 682  | Next Page >