Search Results

Search found 38961 results on 1559 pages for 'boost function'.

Page 678/1559 | < Previous Page | 674 675 676 677 678 679 680 681 682 683 684 685  | Next Page >

  • Clear Select options when selecting one field while using multiple forms on same page

    - by Nizam
    Hi all, I have a situation where the second select list option is generated from the first select list selected option. Like when we select Country corresponding states are generated in next select list. In my case I am having multiple forms on single page which are same. Can anyone let me know how to implement it on multiple forms. I tried the following code but it didn't work $(".country").change(function(){ $.get("sample.php?val=" + $(this).val(), function(data){ $(this).parent().next().children('.state').children('option').remove(); $(this).parent().next().children('.state').append(data); }); Waiting for your support thanks in advance

    Read the article

  • tablednd post issue help please

    - by netrise
    Hi plz i got a terrible headache my script is very simple Why i can’t get $_POST['table-2'] after submiting update button, i want to get ID numbers sorted # index.php <head> <script src="jquery.js" type="text/javascript"></script><br /> <script src="jquery.tablednd.js" type="text/javascript"></script><br /> <script src="jqueryTableDnDArticle.js" type="text/javascript"></script><br /> </head> <body> <form method='POST' action=index.php> <table id="table-2" cellspacing="0" cellpadding="2"> <tr id="a"><td>1</td><td>One</td><td><input type="text" name="one" value="one"/></td></tr> <tr id="b"><td>2</td><td>Two</td><td><input type="text" name="two" value="two"/></td></tr> <tr id="c"><td>3</td><td>Three</td><td><input type="text" name="three" value="three"/></td></tr> <tr id="d"><td>4</td><td>Four</td><td><input type="text" name="four" value="four"/></td></tr> <tr id="e"><td>5</td><td>Five</td><td><input type="text" name="five" value="five"/></td></tr> </table> <input type="submit" name="update" value="Update"> </form> <?php $result[] = $_POST['table-2']; foreach($result as $value) { echo "$value<br/>"; } ?> </body> # jqueryTableDnDArticle.js …………. $(“#table-2?).tableDnD({ onDragClass: “myDragClass”, onDrop: function(table, row) { var rows = table.tBodies[0].rows; var debugStr = “Row dropped was “+row.id+”. New order: “; for (var i=0; i<rows.length; i++) { debugStr += rows[i].id+" "; } //$("#debugArea").html(debugStr); $.ajax({ type: "POST", url: "index.php", data: $.tableDnD.serialize(), success: function(html){ alert("Success"); } }); }, onDragStart: function(table, row) { $("#debugArea").html("Started dragging row "+row.id); } });

    Read the article

  • Slider with keypress control bugs when keys pressed to quickly.

    - by Jaybuz
    Hello, I've made a slider that uses the left and right arrow keys to move the slide but when pressed to quickly it will bug a little and I was wondering if it's possible to limit the amount of presses in say a second. You can see it here: {link} $('#slider-nav div').click(function() { $('#slider-nav div').removeClass('selected').addClass(''); $('#slider-nav div:eq('+($.jcarousel.intval($(this).text())-1)+')').addClass('selected'); }) // Allow left and right keys to control slider $(document.documentElement).keypress(function(e) { var code = (e.keyCode ? e.keyCode : e.which); var direction = null; // handle cursor keys if (code == 37) { // left key direction = 'prev'; } else if (code == 39) { // right key direction = 'next'; } if (direction != null) { $('#slider-nav div.selected')[direction]().click(); } });

    Read the article

  • Anova test in the loop and outputing the p-value in separate column

    - by Juanhijuan
    Once again I'm trying to get an answer. I am already stuck for like 5h with that so that's why I keep trying to get an answer. That's my data: id Sequence variable value 75 AAAAGAAAVANQGKK BiotinControl1_2 3893050.50 192 AAAAGAAAVANQGKK BiotinControl1_2 900604.61 3770 AAFTKLDQVWGSE BiotinControl1_2 90008.14 The code which I am trying to use to calculate the p-value: My Code: tbl_anv <- tbl_all_onlyK[,c("id", "BiotinControl1_2", "BiotinControl2", "BiotinControl3", "BiotinTreatment1_2", "BiotinTreatment2", "BiotinTreatment3", "Sequence")] tbl_reo <- melt(tbl_anv, measure.vars=2:7) set.seed(1) vars <- c("id", "BiotinControl1_2", "BiotinControl2", "BiotinControl3", "BiotinTreatment1_2", "BiotinTreatment2", "BiotinTreatment3", "Sequence") tbl_reo <- as.data.frame(tbl_reo) by(tbl_reo,tbl_reo$Sequence,function(x){ anova(lm(value ~ variable, data = x))$"Pr(>F)"[1] }) An error ocurs: There were 50 or more warnings (use warnings() to see the first 50) Anyway, how can I do that and export the p-value in the separate column. That's what I tried to do on my own: aov_test <- by(tbl_reo,tbl_reo$Sequence,function(x){ anova(lm(value ~ variable, data = x))$"Pr(>F)"[1] }) tbl_reo[,5] <- aov.test[[1]]$'Pr(>F)'[1]

    Read the article

  • array won't work actionscript 3

    - by steve
    I've tried everything. Arrays are quite simple so I don't know why this doesn't function: var menuList:Array = [menu_bag_mc,menu_chips_mc,menu_coke_mc,menu_cup_mc,menu_deodorant_mc,menu_fork_mc,menu_knife_mc,menu_lighter_mc,menu_milk_mc,menu_pill_mc,menu_rings_mc,menu_shampoo_mc,menu_spoon_mc,menu_straw_mc,menu_toothbrush_mc,menu_trashbag_mc,menu_water_mc]; function captureAllClicks(event:MouseEvent):void { trace(menuList.indexOf(event.target)); } stage.addEventListener(MouseEvent.CLICK, captureAllClicks); Every time I click on any of the items on the stage (which are all given the instance names listed above. each is a tweening movieclip containing a button) I get a trace of -1. WHY?!

    Read the article

  • Why are functional languages considered a boon for multi threaded environments?

    - by Billy ONeal
    I hear a lot about functional languages, and how they scale well because there is no state around a function; and therefore that function can be massively parallelized. However, this makes little sense to me because almost all real-world practical programs need/have state to take care of. I also find it interesting that most major scaling libraries, i.e. MapReduce, are typically written in imperative languages like C or C++. I'd like to hear from the functional camp where this hype I'm hearing is coming from....

    Read the article

  • some confusions to singleton pattern in PHP

    - by SpawnCxy
    Hi all, In my team I've been told to write resource class like this style: class MemcacheService { private static $instance = null; private function __construct() { } public static function getInstance($fortest = false) { if (self::$instance == null) { self::$instance = new Memcached(); if ($fortest) { self::$instance->addServer(MEMTEST_HOST, MEMTEST_PORT); } else { self::$instance->addServer(MEM_HOST, MEM_PORT); } } return self::$instance; } } But I think in PHP resource handles will be released and initialized again every time after a request over. That means MemcacheService::getInstance() is totally equal new Memcached() which cannot be called singleton pattern at all. Please correct me if I'm wrong. Regards

    Read the article

  • Getting value from key pair value into appended property using jQuery

    - by Neil
    How do I get the value from a key pair value into the rel property of an anchor tag? When I split the code to put the value in the correct place it doesn't work, the end of the a tag would appear on screen instead value wouldn't be applied. When I look at the resulting code in console in Firebug the rel and href swapped order so the rel is first. The 'key' should be and is in the correct location but the 'value' needs to be applied to the rel attribute. What am I doing wrong? $(function() { var obj = {"firstThing":"4","secondThing":"6","aThirdThing":"2","anotherThing":"3","followedByAnother":"4"}; $.each(obj, function(key,value) { $('#newmine').append("<li class='tagBlocks'>","<a href='#' rel=''>",value," ",key); }); });

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Validate zip and display error with onBlur event

    - by phil
    Check if zip is 5 digit number, if not then display 'zip is invalid'. I want to use onBlur event to trigger the display. But it's not working. <script> $(function(){ function valid_zip() { var pat=/^[0-9]{5}$/; if ( !pat.test( $('#zip').val() ) ) {$('#zip').after('<p>zip is invalid</p>');} } }) </script> zip (US only) <input type="text" name='zip' id='zip' maxlength="5" onBlur="valid_zip()">

    Read the article

  • How to work with PHP abstract?

    - by YumYumYum
    Why would you use such abstract? Does it speed up work or what exactly its for? // file1.php abstract class Search_Adapter_Abstract { private $ch = null; abstract private function __construct() { } abstract public funciton __destruct() { curl_close($this->ch); } abstract public function search($searchString,$offset,$count); } // file2.php include("file1.php"); class abc extends Search_Adapter_Abstract { // Will the curl_close now automatically be closed? } What is the reason of extending abstract here? Makes me confused. What can i get from it now?

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • approximating log10[x^k0 + k1]

    - by Yale Zhang
    Greetings. I'm trying to approximate the function Log10[x^k0 + k1], where .21 < k0 < 21, 0 < k1 < ~2000, and x is integer < 2^14. k0 & k1 are constant. For practical purposes, you can assume k0 = 2.12, k1 = 2660. The desired accuracy is 5*10^-4 relative error. This function is virtually identical to Log[x], except near 0, where it differs a lot. I already have came up with a SIMD implementation that is ~1.15x faster than a simple lookup table, but would like to improve it if possible, which I think is very hard due to lack of efficient instructions. My SIMD implementation uses 16bit fixed point arithmetic to evaluate a 3rd degree polynomial (I use least squares fit). The polynomial uses different coefficients for different input ranges. There are 8 ranges, and range i spans (64)2^i to (64)2^(i + 1). The rational behind this is the derivatives of Log[x] drop rapidly with x, meaning a polynomial will fit it more accurately since polynomials are an exact fit for functions that have a derivative of 0 beyond a certain order. SIMD table lookups are done very efficiently with a single _mm_shuffle_epi8(). I use SSE's float to int conversion to get the exponent and significand used for the fixed point approximation. I also software pipelined the loop to get ~1.25x speedup, so further code optimizations are probably unlikely. What I'm asking is if there's a more efficient approximation at a higher level? For example: Can this function be decomposed into functions with a limited domain like log2((2^x) * significand) = x + log2(significand) hence eliminating the need to deal with different ranges (table lookups). The main problem I think is adding the k1 term kills all those nice log properties that we know and love, making it not possible. Or is it? Iterative method? don't think so because the Newton method for log[x] is already a complicated expression Exploiting locality of neighboring pixels? - if the range of the 8 inputs fall in the same approximation range, then I can look up a single coefficient, instead of looking up separate coefficients for each element. Thus, I can use this as a fast common case, and use a slower, general code path when it isn't. But for my data, the range needs to be ~2000 before this property hold 70% of the time, which doesn't seem to make this method competitive. Please, give me some opinion, especially if you're an applied mathematician, even if you say it can't be done. Thanks.

    Read the article

  • XCode, error: '_object' undeclared. Need some help solving this problem

    - by user309030
    I've got this code in my viewController.m file - (void)viewDidLoad { [super viewDidLoad]; GameLogic *_game = [[GameLogic alloc] init]; [_game initGame]; ....... } GameLogic is another class which I created. in the same viewController.m file, I have got another function - (void)test { if([_game returnElecFence]) { NSLog(@"YES"); } else { NSLog(@"NO"); } } Problem is, whenever the test function is called, I get an error saying '_game' undeclared. I tried putting the GameLogic init code in the .h file and on top of the @implementation to make it global but every method I tried resulted in a worse error. TIA to anyone who can suggest some ideas to clear this error up

    Read the article

  • JPA Inheritance and Relations - Clarification question

    - by Michael
    Here the scenario: I have a unidirectional 1:N Relation from Person Entity to Address Entity. And a bidirectional 1:N Relation from User Entity to Vehicle Entity. Here is the Address class: @Entity public class Address implements Serializable { private static final long serialVersionUID = 1L; @Id @GeneratedValue(strategy = GenerationType.AUTO) privat Long int ... The Vehicles Class: @Entity public class Vehicle implements Serializable { @Id @GeneratedValue(strategy = GenerationType.AUTO) private Long id; @ManyToOne private User owner; ... @PreRemove protected void preRemove() { //this.owner.removeVehicle(this); } public Vehicle(User owner) { this.owner = owner; ... The Person Class: @Entity @Inheritance(strategy = InheritanceType.JOINED) @DiscriminatorColumn(name="PERSON_TYP") public class Person implements Serializable { @Id protected String username; @OneToMany(cascade = CascadeType.ALL, orphanRemoval=true) @JoinTable(name = "USER_ADDRESS", joinColumns = @JoinColumn(name = "USERNAME"), inverseJoinColumns = @JoinColumn(name = "ADDRESS_ID")) protected List<Address> addresses; ... @PreRemove protected void prePersonRemove(){ this.addresses = null; } ... The User Class which is inherited from the Person class: @Entity @Table(name = "Users") @DiscriminatorValue("USER") public class User extends Person { @OneToMany(mappedBy = "owner", cascade = {CascadeType.PERSIST, CascadeType.REMOVE}) private List<Vehicle> vehicles; ... When I try to delete a User who has an address I have to use orphanremoval=true on the corresponding relation (see above) and the preRemove function where the address List is set to null. Otherwise (no orphanremoval and adress list not set to null) a foreign key contraint fails. When i try to delete a user who has an vehicle a concurrent Acces Exception is thrown when do not uncomment the "this.owner.removeVehicle(this);" in the preRemove Function of the vehicle. The thing i do not understand is that before i used this inheritance there was only a User class which had all relations: @Entity @Table(name = "Users") public class User implements Serializable { @Id protected String username; @OneToMany(mappedBy = "owner", cascade = {CascadeType.PERSIST, CascadeType.REMOVE}) private List<Vehicle> vehicles; @OneToMany(cascade = CascadeType.ALL) @JoinTable(name = "USER_ADDRESS", joinColumns = @JoinColumn(name = "USERNAME") inverseJoinColumns = @JoinColumn(name = "ADDRESS_ID")) ptivate List<Address> addresses; ... No orphanremoval, and the vehicle class has used the uncommented statement above in its preRemove function. And - I could delte a user who has an address and i could delte a user who has a vehicle. So why doesn't everything work without changes when i use inheritance? I use JPA 2.0, EclipseLink 2.0.2, MySQL 5.1.x and Netbeans 6.8

    Read the article

  • How do I process a jQuery SVG group event in a single handler?

    - by rmflow
    I'm trying to draw a button using jQuery SVG, the button is a filled rect and the text is placed on top of the rect. Rect and text are grouped and I want to control the mouseover/mouseout events. The problem is: mouseover/mouseout events are triggered separately for every element of the group. Is it possible to make a single event handler for entire group? Here is an example: gClear = svg.group(); btClear = svg.rect(gClear, 10, 10, 100, h-20, 5 ,5, attrs); txtClear = svg.text(gClear, 35, 30, "Clear", {fontFamily: "Verdana", fontWeight: "bold", fontSize: "16px"}); $(gClear, svg.root()).bind("mouseover", function() { $(btClear).animate({svgFill: '#adf'}, 100); }).bind("mouseout", function() { $(btClear).animate({svgFill: '#fff'}, 100); }) When I move the mouse inside the rect the events mouseover/mouseout are triggered. Can I make "text" events transparent or can I have a single event handler for the group?

    Read the article

  • jQuery Plugin with $.getJSON Returning undefined?

    - by Oscar Godson
    Inside of a jQuery plugin I made I have: $.getJSON(base_url,{ agenda_id:defaults.id, action:defaults.action+defaults.type, output:defaults.output },function(json){ return json; }); And in a separate JS file (yes, it comes after the plugin): json = $('#agenda-live-preview').agenda({action:'get',type:'agenda',output:'json'}); alert(json[0].agenda_id); If i do the above $.getJSON and put an alert inside of the $.getJSON it works and returns "3", which is correct. If I do it like the json=$('#agenda-live-preview').agenda(...)... it returns undefined. My JSON is valid, and the json[0].agenda_id is correct also, I know it's in a callback, so how do I get the stuff inside of a callback in a function return?

    Read the article

  • nodejs response speed and nginx

    - by user1502440
    I'm just started testing nodejs, and wanted to get some help in understanding following behavior: Example #1: var http = require('http'); http.createServer(function(req, res){ res.writeHeader(200, {'Content-Type': 'text/plain'}); res.end('foo'); }).listen(1001, '0.0.0.0'); Example #2: var http = require('http'); http.createServer(function(req, res){ res.writeHeader(200, {'Content-Type': 'text/plain'}); res.write('foo'); res.end('bar'); }).listen(1001, '0.0.0.0'); When testing response time in Chrome: example #1 - 6-10ms example #2 - 200-220ms But, if test both examples through nginx proxy_pass server{ listen 1011; location / { proxy_pass http://127.0.0.1:1001; } } i get this: example #1 - 4-8ms example #2 - 4-8ms I am not an expert on either nodejs or nginx, and asking if someone can explain this? nodejs - v.0.8.1 nginx - v.1.2.2

    Read the article

  • How to have type hinting in PHP that specifies variable scope inside of a template? (specifically PhpStorm)

    - by Lance Rushing
    I'm looking for a doc comment that would define the scope/context of the current php template. (similar to @var) Example View Class: <?php class ExampleView { protected $pageTitle; public function __construct($title) { $this->pageTitle = $title; } public function render() { require_once 'template.php'; } } -- <?php // template.php /** @var $this ExampleView */ echo $this->pageTitle; PHPStorm gives an inspection error because the access on $pageTitle is protected. Is there a hint to give scope? Something like: <?php // template.php /** @scope ExampleView */ // <---???? /** @var $this ExampleView */ echo $this->pageTitle;

    Read the article

  • How should I port this Prototype to JQuery?

    - by blu
    There is currently this Prototype code that does a PUT: new Ajax.Request(someUrl, { method: 'put', parameters: { 'foo': bar }, onSuccess: function(response) { } .bind(this) }); I found this post but the solution uses an extra parameter supported by RoR, however I am targeting an ASP.NET backend. I searched a bit and found that not all browsers support PUT operations so apparently this could fail in certain browsers? This is already in prod, so a direct port would be fine for now I suppose. As an aside, what is the deal with the bind(this) in the onSuccess function?

    Read the article

  • Avoid multiple autocomplete calls by wrapping it with SetTimeOut

    - by pixelboy
    Here's my issue : using an autocomplete jQuery plugin, I'd like to avoid multiple ajax requests when user strikes his keynoard by surrounding the $('#query1').autocomplete({ serviceUrl:'/actions/autocomplete?population=salon', minChars:3, maxHeight:300, width:200, clearCache:true, onSelect: function(suggestions,data){ $(".btn1").attr("href", "${pageContext.request.contextPath}/actions/espaceClients?participantId=" + data) } }); with something like var search = false; $('#query1, #query2, #query3').keyup(function(){ if (!search){ search = true; } if (search) { search = false; autocompleteThem(); } }); A you can see, above code is stupid, but it kinda shows what i'm trying to do. In simple words, if user dosen't type anything else in a certain period of time, then you can call autocomplete. I hope i'm being clear, as my brains are a mess...

    Read the article

  • Why I am not getting Row value on click using this?

    - by rockers
    $("#grid td:first-child").click(function() { var value = $(this).closest('tr').find('td:eq(2)').text(); // for third column alert(value); var value = $(this).closest('tr').find('td:eq(3)').text(); // for fourth column alert(value); var AccountName = accountid; var x = function() { $(this).click($("#showregiongrid").load('/analyst/ror/regionspeexc/?a=' + AccountName)); } clickTimer = window.setTimeout(x, 300); }); Why i am not getting the row values of eq(2) and eq(3).. is there anyting I am doing wrong? if I delete td:first-child from my click event I am getting null vallues on popup? thanks

    Read the article

  • BizTalk 2009 XSLT and Attribute Value Templates

    - by amok
    I'm trying to make use of attribute value type in a BizTalk XSL transformation to dynamically setting attribute or other element names. Read more here: http://www.w3.org/TR/xslt#dt-attribute-value-template The following code is an example of an XSL template to add an attribute optionally. <xsl:template name="AttributeOptional"> <xsl:param name="value"/> <xsl:param name="attr"/> <xsl:if test="$value != ''"> <xsl:attribute name="{$attr}"> <xsl:value-of select="$value"/> </xsl:attribute> </xsl:if> </xsl:template> Running this script in BizTalk results in "Exception from HRESULT: 0x80070002)" An alternative I was thinking of was to call a msxsl:script function to do the same but i cannot get a handle on the XSL output context from within the function. An ideas?

    Read the article

  • Pointer to local variable

    - by Radek Šimko
    May I have any acces to local variable in different function? If may, how? void replaceNumberAndPrint(int array[3]) { printf("%i\n", array[1]); printf("%i\n", array[1]); } int * getArray() { int myArray[3] = {4, 65, 23}; return myArray; } int main() { replaceNumberAndPrint(getArray()); } The output of the piece of code above: 65 4202656 What am i doing wrong? What the "4202656" means?? Do I have to copy the whole array in the replaceNumberAndPrint() function to be able to access to it more than first times?

    Read the article

  • XML pass values to timer, AS3

    - by VideoDnd
    My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

    Read the article

< Previous Page | 674 675 676 677 678 679 680 681 682 683 684 685  | Next Page >