Search Results

Search found 4029 results on 162 pages for 'wildcard mapping'.

Page 68/162 | < Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >

  • SQL SERVER – Query Hint – Contest Win Joes 2 Pros Combo (USD 198) – Day 1 of 5

    - by pinaldave
    August 2011 we ran a contest where every day we give away one book for an entire month. The contest had extreme success. Lots of people participated and lots of give away. I have received lots of questions if we are doing something similar this month. Absolutely, instead of running a contest a month long we are doing something more interesting. We are giving away USD 198 worth gift every day for this week. We are giving away Joes 2 Pros 5 Volumes (BOOK) SQL 2008 Development Certification Training Kit every day. One copy in India and One in USA. Total 2 of the giveaway (worth USD 198). All the gifts are sponsored from the Koenig Training Solution and Joes 2 Pros. The books are available here Amazon | Flipkart | Indiaplaza How to Win: Read the Question Read the Hints Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India residents only) 2 Winners will be randomly selected announced on August 20th. Question of the Day: Which of the following queries will return dirty data? a) SELECT * FROM Table1 (READUNCOMMITED) b) SELECT * FROM Table1 (NOLOCK) c) SELECT * FROM Table1 (DIRTYREAD) d) SELECT * FROM Table1 (MYLOCK) Query Hints: BIG HINT POST Most SQL people know what a “Dirty Record” is. You might also call that an “Intermediate record”. In case this is new to you here is a very quick explanation. The simplest way to describe the steps of a transaction is to use an example of updating an existing record into a table. When the insert runs, SQL Server gets the data from storage, such as a hard drive, and loads it into memory and your CPU. The data in memory is changed and then saved to the storage device. Finally, a message is sent confirming the rows that were affected. For a very short period of time the update takes the data and puts it into memory (an intermediate state), not a permanent state. For every data change to a table there is a brief moment where the change is made in the intermediate state, but is not committed. During this time, any other DML statement needing that data waits until the lock is released. This is a safety feature so that SQL Server evaluates only official data. For every data change to a table there is a brief moment where the change is made in this intermediate state, but is not committed. During this time, any other DML statement (SELECT, INSERT, DELETE, UPDATE) needing that data must wait until the lock is released. This is a safety feature put in place so that SQL Server evaluates only official data. Additional Hints: I have previously discussed various concepts from SQL Server Joes 2 Pros Volume 1. SQL Joes 2 Pros Development Series – Dirty Records and Table Hints SQL Joes 2 Pros Development Series – Row Constructors SQL Joes 2 Pros Development Series – Finding un-matching Records SQL Joes 2 Pros Development Series – Efficient Query Writing Strategy SQL Joes 2 Pros Development Series – Finding Apostrophes in String and Text SQL Joes 2 Pros Development Series – Wildcard – Querying Special Characters SQL Joes 2 Pros Development Series – Wildcard Basics Recap Next Step: Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India) Bonus Winner Leave a comment with your favorite article from the “additional hints” section and you may be eligible for surprise gift. There is no country restriction for this Bonus Contest. Do mention why you liked it any particular blog post and I will announce the winner of the same along with the main contest. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Joes 2 Pros, PostADay, SQL, SQL Authority, SQL Puzzle, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Entity Framework SaveChanges error details

    - by Marek Karbarz
    When saving changes with SaveChanges on a data context is there a way to determine which Entity causes an error? For example, sometimes I'll forget to assign a date to a non-nullable date field and get "Invalid Date Range" error, but I get no information about which entity or which field it's caused by (I can usually track it down by painstakingly going through all my objects, but it's very time consuming). Stack trace is pretty useless as it only shows me an error at the SaveChanges call without any additional information as to where exactly it happened. Note that I'm not looking to solve any particular problem I have now, I would just like to know in general if there's a way to tell which entity/field is causing a problem. Quick sample of a stack trace as an example - in this case an error happened because CreatedOn date was not set on IAComment entity, however it's impossible to tell from this error/stack trace [SqlTypeException: SqlDateTime overflow. Must be between 1/1/1753 12:00:00 AM and 12/31/9999 11:59:59 PM.] System.Data.SqlTypes.SqlDateTime.FromTimeSpan(TimeSpan value) +2127345 System.Data.SqlTypes.SqlDateTime.FromDateTime(DateTime value) +232 System.Data.SqlClient.MetaType.FromDateTime(DateTime dateTime, Byte cb) +46 System.Data.SqlClient.TdsParser.WriteValue(Object value, MetaType type, Byte scale, Int32 actualLength, Int32 encodingByteSize, Int32 offset, TdsParserStateObject stateObj) +4997789 System.Data.SqlClient.TdsParser.TdsExecuteRPC(_SqlRPC[] rpcArray, Int32 timeout, Boolean inSchema, SqlNotificationRequest notificationRequest, TdsParserStateObject stateObj, Boolean isCommandProc) +6248 System.Data.SqlClient.SqlCommand.RunExecuteReaderTds(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, Boolean async) +987 System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method, DbAsyncResult result) +162 System.Data.SqlClient.SqlCommand.RunExecuteReader(CommandBehavior cmdBehavior, RunBehavior runBehavior, Boolean returnStream, String method) +32 System.Data.SqlClient.SqlCommand.ExecuteReader(CommandBehavior behavior, String method) +141 System.Data.SqlClient.SqlCommand.ExecuteDbDataReader(CommandBehavior behavior) +12 System.Data.Common.DbCommand.ExecuteReader(CommandBehavior behavior) +10 System.Data.Mapping.Update.Internal.DynamicUpdateCommand.Execute(UpdateTranslator translator, EntityConnection connection, Dictionary`2 identifierValues, List`1 generatedValues) +8084396 System.Data.Mapping.Update.Internal.UpdateTranslator.Update(IEntityStateManager stateManager, IEntityAdapter adapter) +267 [UpdateException: An error occurred while updating the entries. See the inner exception for details.] System.Data.Mapping.Update.Internal.UpdateTranslator.Update(IEntityStateManager stateManager, IEntityAdapter adapter) +389 System.Data.EntityClient.EntityAdapter.Update(IEntityStateManager entityCache) +163 System.Data.Objects.ObjectContext.SaveChanges(SaveOptions options) +609 IADAL.IAController.Save(IAHeader head) in C:\Projects\IA\IADAL\IAController.cs:61 IA.IAForm.saveForm(Boolean validate) in C:\Projects\IA\IA\IAForm.aspx.cs:198 IA.IAForm.advance_Click(Object sender, EventArgs e) in C:\Projects\IA\IA\IAForm.aspx.cs:287 System.Web.UI.WebControls.Button.OnClick(EventArgs e) +118 System.Web.UI.WebControls.Button.RaisePostBackEvent(String eventArgument) +112 System.Web.UI.WebControls.Button.System.Web.UI.IPostBackEventHandler.RaisePostBackEvent(String eventArgument) +10 System.Web.UI.Page.RaisePostBackEvent(IPostBackEventHandler sourceControl, String eventArgument) +13 System.Web.UI.Page.RaisePostBackEvent(NameValueCollection postData) +36 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +5019

    Read the article

  • How to configure hibernate-tools with maven to generate hibernate.cfg.xml, *.hbm.xml, POJOs and DAOs

    - by mmm
    Hi, can any one tell me how to force maven to precede mapping .hbm.xml files in the automatically generated hibernate.cfg.xml file with package path? My general idea is, I'd like to use hibernate-tools via maven to generate the persistence layer for my application. So, I need the hibernate.cfg.xml, then all my_table_names.hbm.xml and at the end the POJO's generated. Yet, the hbm2java goal won't work as I put *.hbm.xml files into the src/main/resources/package/path/ folder but hbm2cfgxml specifies the mapping files only by table name, i.e.: <mapping resource="MyTableName.hbm.xml" /> So the big question is: how can I configure hbm2cfgxml so that hibernate.cfg.xml looks like below: <mapping resource="package/path/MyTableName.hbm.xml" /> My pom.xml looks like this at the moment: <plugin> <groupId>org.codehaus.mojo</groupId> <artifactId>hibernate3-maven-plugin</artifactId> <version>2.2</version> <executions> <execution> <id>hbm2cfgxml</id> <phase>generate-sources</phase> <goals> <goal>hbm2cfgxml</goal> </goals> <inherited>false</inherited> <configuration> <components> <component> <name>hbm2cfgxml</name> <implemetation>jdbcconfiguration</implementation> <outputDirectory>src/main/resources/</outputDirectory> </component> </components> <componentProperties> <packagename>package.path</packageName> <configurationFile>src/main/resources/hibernate.cfg.xml</configurationFile> </componentProperties> </configuration> </execution> </executions> </plugin> And then the second question: is there a way to tell maven to copy resources to the target folder before executing hbm2java? At the moment I'm using mvn clean resources:resources generate-sources for that, but there must be a better way. Thanks for any help. Update: @Pascal: Thank you for your help. The path to mappings works fine now, I don't know what was wrong before, though. Maybe there is some issue with writing to hibernate.cfg.xml while reading database config from it (though the file gets updated). I've deleted the file hibernate.cfg.xml, replaced it with database.properties and run the goals hbm2cfgxml and hbm2hbmxml. I also don't use the outputDirectory nor configurationfile in those goals anymore. As a result the files hibernate.cfg.xml and all *.hbm.xml are being generated into my target/hibernate3/generated-mappings/ folder, which is the default value. Then I updated the hbm2java goal with the following: <componentProperties> <packagename>package.name</packagename> <configurationfile>target/hibernate3/generated-mappings/hibernate.cfg.xml</configurationfile> </componentProperties> But then I get the following: [INFO] --- hibernate3-maven-plugin:2.2:hbm2java (hbm2java) @ project.persistence --- [INFO] using configuration task. [INFO] Configuration XML file loaded: file:/C:/Documents%20and%20Settings/mmm/workspace/project.persistence/target/hibernate3/generated-mappings/hibernate.cfg.xml 12:15:17,484 INFO org.hibernate.cfg.Configuration - configuring from url: file:/C:/Documents%20and%20Settings/mmm/workspace/project.persistence/target/hibernate3/generated-mappings/hibernate.cfg.xml 12:15:19,046 INFO org.hibernate.cfg.Configuration - Reading mappings from resource : package.name/Messages.hbm.xml [INFO] ------------------------------------------------------------------------ [INFO] BUILD FAILURE [INFO] ------------------------------------------------------------------------ [ERROR] Failed to execute goal org.codehaus.mojo:hibernate3-maven-plugin:2.2:hbm2java (hbm2java) on project project.persistence: Execution hbm2java of goal org.codehaus.mojo:hibernate3-maven-plugin:2.2:hbm2java failed: resource: package/name/Messages.hbm.xml not found How do I deal with that? Of course I could add: <outputDirectory>src/main/resources/package/name</outputDirectory> to the hbm2hbmxml goal, but I think this is not the best approach, or is it? Is there a way to keep all the generated code and resources away from the src/ folder? I assume, the goal of this approach is not to generate any sources into my src/main/java or /resources folder, but to keep the generated code in the target folder. As I generally agree with this point of view, I'd like to continue with that eventually executing hbm2dao and packaging the project to be used as a generated persistence layer component from the business layer. Is this also what you meant?

    Read the article

  • Jboss Seam: Enabling Debug page on WebLogic 10.3.2 (11g)

    - by Markos Fragkakis
    Hi all, SKIP TO UPDATE 3 I want to enable the Seam debug page on Weblogic 10.3.2 (11g). So, I have done the following: I have the jboss-seam and jboss-seam-debug jars as dependency in both my ejb and web maven projects (both are modules of my superproject) I put this context parameter in my web.xml: <context-param> <param-name>org.jboss.seam.core.init.debug</param-name> <param-value>true</param-value> </context-param> Now, when I hit the URL of my application, I get the debug page with this exception (full stacktrace at the end of the post): Caused by java.lang.IllegalStateException with message: "No phase id bound to current thread (make sure you do not have two SeamPhaseListener instances installed)" From posts I read it seems that this is somehow related to two jars of jboss-seam or jboss-seam-debug being in the classpath. I opened my ear file and only one of each is present (in the ear) whereas the war itself has no libraries in the WEB-INF/lib. I have also read of another way to initialize debug page using the components.xml. I also tried to include the following components.xml in the WEB-INF, but it didn't work either: <?xml version="1.0" encoding="UTF-8"?> <components xmlns="http://jboss.com/products/seam/components" xmlns:core="http://jboss.com/products/seam/core" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation=" http://jboss.com/products/seam/core http://jboss.com/products/seam/core-2.2.xsd http://jboss.com/products/seam/components http://jboss.com/products/seam/components-2.2.xsd"> <core:init debug="true"/> </components> Any suggestions on what to do to enable the debug page correctly? Cheers! Full stacktrace: org.jboss.seam.contexts.PageContext.getPhaseId(PageContext.java:163) org.jboss.seam.contexts.PageContext.isBeforeInvokeApplicationPhase(PageContext.java:175) org.jboss.seam.contexts.PageContext.getCurrentWritableMap(PageContext.java:91) org.jboss.seam.contexts.PageContext.remove(PageContext.java:105) org.jboss.seam.Component.newInstance(Component.java:2141) org.jboss.seam.Component.getInstance(Component.java:2021) org.jboss.seam.Component.getInstance(Component.java:2000) org.jboss.seam.Component.getInstance(Component.java:1994) org.jboss.seam.Component.getInstance(Component.java:1967) org.jboss.seam.Component.getInstance(Component.java:1962) org.jboss.seam.faces.FacesPage.instance(FacesPage.java:92) org.jboss.seam.core.ConversationPropagation.restorePageContextConversationId(ConversationPropagation.java:84) org.jboss.seam.core.ConversationPropagation.restoreConversationId(ConversationPropagation.java:57) org.jboss.seam.jsf.SeamPhaseListener.afterRestoreView(SeamPhaseListener.java:391) org.jboss.seam.jsf.SeamPhaseListener.afterServletPhase(SeamPhaseListener.java:230) org.jboss.seam.jsf.SeamPhaseListener.afterPhase(SeamPhaseListener.java:196) com.sun.faces.lifecycle.Phase.handleAfterPhase(Phase.java:175) com.sun.faces.lifecycle.Phase.doPhase(Phase.java:114) com.sun.faces.lifecycle.RestoreViewPhase.doPhase(RestoreViewPhase.java:104) com.sun.faces.lifecycle.LifecycleImpl.execute(LifecycleImpl.java:118) javax.faces.webapp.FacesServlet.service(FacesServlet.java:265) weblogic.servlet.internal.StubSecurityHelper$ServletServiceAction.run(StubSecurityHelper.java:227) weblogic.servlet.internal.StubSecurityHelper.invokeServlet(StubSecurityHelper.java:125) weblogic.servlet.internal.ServletStubImpl.execute(ServletStubImpl.java:292) weblogic.servlet.internal.TailFilter.doFilter(TailFilter.java:26) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) org.ajax4jsf.webapp.BaseXMLFilter.doXmlFilter(BaseXMLFilter.java:178) org.ajax4jsf.webapp.BaseFilter.handleRequest(BaseFilter.java:290) org.ajax4jsf.webapp.BaseFilter.processUploadsAndHandleRequest(BaseFilter.java:388) org.ajax4jsf.webapp.BaseFilter.doFilter(BaseFilter.java:515) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:83) org.jboss.seam.web.LoggingFilter.doFilter(LoggingFilter.java:60) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.IdentityFilter.doFilter(IdentityFilter.java:40) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.MultipartFilter.doFilter(MultipartFilter.java:90) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.ExceptionFilter.doFilter(ExceptionFilter.java:64) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.RedirectFilter.doFilter(RedirectFilter.java:45) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.HotDeployFilter.doFilter(HotDeployFilter.java:53) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.servlet.SeamFilter.doFilter(SeamFilter.java:158) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) weblogic.servlet.internal.RequestEventsFilter.doFilter(RequestEventsFilter.java:27) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) weblogic.servlet.internal.WebAppServletContext$ServletInvocationAction.run(WebAppServletContext.java:3592) weblogic.security.acl.internal.AuthenticatedSubject.doAs(AuthenticatedSubject.java:321) weblogic.security.service.SecurityManager.runAs(SecurityManager.java:121) weblogic.servlet.internal.WebAppServletContext.securedExecute(WebAppServletContext.java:2202) weblogic.servlet.internal.WebAppServletContext.execute(WebAppServletContext.java:2108) weblogic.servlet.internal.ServletRequestImpl.run(ServletRequestImpl.java:1432) weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) weblogic.work.ExecuteThread.run(ExecuteThread.java:173) UPDATE 1: Now the debug page does not appear at all. When I ask for http://localhost/myapp/debug.xhtml I get a page with: myapp/debug.xhtml the same as any page that does not exist. I opened the .ear and the following jboss jars are in: jboss-seam-debug-2.2.0.GA.jar jboss-el-1.0_02.CR4.jar jboss-seam-2.2.0.GA.jar My current configuration: <?xml version="1.0" encoding="UTF-8"?> <web-app xmlns="http://java.sun.com/xml/ns/javaee" xmlns:xsi="http://www.w3.org /2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_2_5.xsd" version="2.5"> <display-name>PRS 6.0</display-name> <session-config> <session-timeout>30</session-timeout> </session-config> <!-- The default behavior of JSF is to map the incoming request for a JSF view identifier (view ID for short) to a JSP file with the file extension .jsp. To get JSF to look for a Facelets template instead, we must register the .xhtml extension as the default suffix for JSF views --> <context-param> <param-name>javax.faces.DEFAULT_SUFFIX</param-name> <param-value>.xhtml</param-value> </context-param> <context-param> <param-name>javax.faces.STATE_SAVING_METHOD</param-name> <param-value>server</param-value> </context-param> <context-param> <param-name>javax.faces.CONFIG_FILES</param-name> <param-value> /WEB-INF/faces-config/application.xml </param-value> </context-param> <context-param> <param-name>facelets.REFRESH_PERIOD</param-name> <param-value>2</param-value> </context-param> <context-param> <param-name>facelets.DEVELOPMENT</param-name> <param-value>true</param-value> </context-param> <context-param> <param-name>facelets.SKIP_COMMENTS</param-name> <param-value>true</param-value> </context-param> <context-param> <param-name>com.sun.faces.verifyObjects</param-name> <param-value>false</param-value> </context-param> <context-param> <param-name>org.ajax4jsf.VIEW_HANDLERS</param-name> <param-value>com.sun.facelets.FaceletViewHandler</param-value> </context-param> <context-param> <param-name>org.ajax4jsf.COMPRESS_SCRIPT</param-name> <param-value>true</param-value> </context-param> <context-param> <param-name>org.ajax4jsf.COMPRESS_STYLE</param-name> <param-value>true</param-value> </context-param> <context-param> <param-name>org.ajax4jsf.xmlparser.ORDER</param-name> <param-value>NONE</param-value> </context-param> <context-param> <param-name>org.richfaces.SKIN</param-name> <param-value>blueSky</param-value> </context-param> <context-param> <param-name>org.richfaces.CONTROL_SKINNING</param-name> <param-value>enable</param-value> </context-param> <context-param> <param-name>org.richfaces.LoadStyleStrategy</param-name> <param-value>ALL</param-value> </context-param> <context-param> <param-name>org.richfaces.LoadScriptStrategy</param-name> <param-value>ALL</param-value> </context-param> <!-- Seam Filter --> <!-- (MUST BE FIRST)--> <filter> <filter-name>Seam Filter</filter-name> <filter-class>org.jboss.seam.servlet.SeamFilter</filter-class> </filter> <filter-mapping> <filter-name>Seam Filter</filter-name> <url-pattern>/*</url-pattern> </filter-mapping> <!-- RichFaces filter --> <filter> <display-name>RichFaces Filter</display-name> <filter-name>richfaces</filter-name> <filter-class>org.ajax4jsf.Filter</filter-class> <init-param> <description>Set the size limit for uploaded files as attachments in bytes. (max 5MB)</description> <param-name>maxRequestSize</param-name> <param-value>5242880</param-value> </init-param> </filter> <filter-mapping> <filter-name>richfaces</filter-name> <servlet-name>Faces Servlet</servlet-name> <dispatcher>REQUEST</dispatcher> <dispatcher>FORWARD</dispatcher> <dispatcher>INCLUDE</dispatcher> </filter-mapping> <listener> <listener-class> XX.XXXX.XXX.prs.web.listeners.ResourceInitializationListener</listener-class> </listener> <listener> <listener-class>com.sun.faces.config.ConfigureListener</listener-class> </listener> <listener> <listener-class>XX.XXXX.XXX.prs.web.listeners.EJBInjectionListener</listener-class> </listener> <!-- Seam Listener--> <listener> <listener-class>org.jboss.seam.servlet.SeamListener</listener-class> </listener> <!-- Faces Servlet --> <servlet> <servlet-name>Faces Servlet</servlet-name> <servlet-class>javax.faces.webapp.FacesServlet</servlet-class> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Faces Servlet</servlet-name> <url-pattern>*.xhtml</url-pattern> </servlet-mapping> -- Seam Resource Servlet-- org.jboss.seam.servlet.SeamResourceServlet-- -- -- Seam Resource Servlet-- /seam/resource/*-- -- <welcome-file-list> <welcome-file>index.xhtml</welcome-file> </welcome-file-list> </web-app> faces.config <?xml version="1.0" encoding="UTF-8"?> <faces-config xmlns="http://java.sun.com/xml/ns/j2ee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/j2ee http://java.sun.com/xml/ns/j2ee/web-facesconfig_1_2.xsd" version="1.2"> <application> <locale-config> <default-locale>en</default-locale> <supported-locale>en</supported-locale> </locale-config> <view-handler>com.sun.facelets.FaceletViewHandler</view-handler> <el-resolver>org.jboss.seam.el.SeamELResolver</el-resolver> <resource-bundle> <base-name>XX.XXXX.XXX.prs.web.messages.messages</base-name> <var>msgs</var> </resource-bundle> <resource-bundle> <base-name>XX.XXXX.XXX.prs.web.messages.validation</base-name> <var>val</var> </resource-bundle> </application> <lifecycle> <phase-listener>XX.XXXX.XXX.prs.web.listeners.SetFocusListener</phase-listener> </lifecycle> <!-- <lifecycle>--> <!-- <phase-listener>XX.XXXX.XXX.prs.web.listeners.DebugPhaseListener</phase-listener> --> <converter> <converter-for-class>XX.XXXX.XXX.prs.model.Applicant</converter-for-class> <converter-class> XX.XXXX.XXX.prs.web.common.converters.ApplicantConverter</converter-class> </converter> <validator> <validator-id>EmailValidator</validator-id> <validator-class>XX.XXXX.XXX.prs.web.common.validators.EmailValidator</validator-class> </validator> </faces-config> components.xml <?xml version="1.0" encoding="UTF-8"?> <components xmlns="http://jboss.com/products/seam/components" xmlns:core="http://jboss.com/products/seam/core" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation=" http://jboss.com/products/seam/core http://jboss.com/products/seam/core-2.2.xsd http://jboss.com/products/seam/components http://jboss.com/products/seam/components-2.2.xsd"> <core:init debug="true" /> <core:manager concurrent-request-timeout="500" conversation-timeout="1200000" conversation-id-parameter="cid" parent-conversation-id-parameter="pid" /> UPDATE 2: These guys here have the same problem. They have an outer EAR project containing the inner WAR project. They discuss that this may be related to how jars end up in the projects. I use Maven, and I had set it to create "Skinny Wars", that is excluding all jar dependencies from the inner WAR project, so that it remains small in size. All its dependencies are contained in the EAR and are used by all other modules. I changed the settings of the maven-war-plugin to leave inside the war the web-specific jars (the ones mentioned in the link, like RichFaces, jboss-seam-debug, Facelets etc). However, the problem has reverted to its previous form. I now get the debug page, whatever link I press, with the initial exception. Caused by java.lang.IllegalStateException with message: "No phase id bound to current thread (make sure you do not have two SeamPhaseListener instances installed)" UPDATE 3: The structure of the application .ear is the following: application.ear |--> APP-INF | |--> classes |--> lib (all jar dependencies go here, including the WAR dependencies, EJB module dependencies) |-->META_INF | |--> application.xml | |--> data-sources.xml | |--> MANIFEST.MF | |--> weblogic.xml | |--> weblogic-application.xml |--> jboss-seam-2.2.0.GA.jar |--> myEjbModule1.jar |--> myEjbModule2.jar |--> myEjbModule3.jar |--> myEjbModule4.jar |--> myWar.war (NO libraries in WEB-INF/lib, finds everything in EAR/lib) When deploying .ear application WITHOUT debug enabled (not including the jboss-seam-debug.jar in the ear), the application is loaded correctly. When deploying WITH jboss-seam-debug.jar in the EAR (EAR/lib directory), the application does not appear, but ONLY the debug page with the following exception (stacktrace at the end): Exception during request processing: Caused by java.lang.IllegalStateException with message: "No phase id bound to current thread (make sure you do not have two SeamPhaseListener instances installed)" When "JBoss-izing" the same EAR (remove hibernate jars, which are provided by JBoss, and move all libraries from EAR/lib to EAR root), the application loads correctly. BOTH the application AND the debug page appear correctly. Full stacktrace: org.jboss.seam.contexts.PageContext.getPhaseId(PageContext.java:163) org.jboss.seam.contexts.PageContext.isBeforeInvokeApplicationPhase(PageContext.java:175) org.jboss.seam.contexts.PageContext.getCurrentWritableMap(PageContext.java:91) org.jboss.seam.contexts.PageContext.remove(PageContext.java:105) org.jboss.seam.Component.newInstance(Component.java:2141) org.jboss.seam.Component.getInstance(Component.java:2021) org.jboss.seam.Component.getInstance(Component.java:2000) org.jboss.seam.Component.getInstance(Component.java:1994) org.jboss.seam.Component.getInstance(Component.java:1967) org.jboss.seam.Component.getInstance(Component.java:1962) org.jboss.seam.faces.FacesPage.instance(FacesPage.java:92) org.jboss.seam.core.ConversationPropagation.restorePageContextConversationId(ConversationPropagation.java:84) org.jboss.seam.core.ConversationPropagation.restoreConversationId(ConversationPropagation.java:57) org.jboss.seam.jsf.SeamPhaseListener.afterRestoreView(SeamPhaseListener.java:391) org.jboss.seam.jsf.SeamPhaseListener.afterServletPhase(SeamPhaseListener.java:230) org.jboss.seam.jsf.SeamPhaseListener.afterPhase(SeamPhaseListener.java:196) com.sun.faces.lifecycle.Phase.handleAfterPhase(Phase.java:175) com.sun.faces.lifecycle.Phase.doPhase(Phase.java:114) com.sun.faces.lifecycle.RestoreViewPhase.doPhase(RestoreViewPhase.java:104) com.sun.faces.lifecycle.LifecycleImpl.execute(LifecycleImpl.java:118) javax.faces.webapp.FacesServlet.service(FacesServlet.java:265) weblogic.servlet.internal.StubSecurityHelper$ServletServiceAction.run(StubSecurityHelper.java:227) weblogic.servlet.internal.StubSecurityHelper.invokeServlet(StubSecurityHelper.java:125) weblogic.servlet.internal.ServletStubImpl.execute(ServletStubImpl.java:292) weblogic.servlet.internal.TailFilter.doFilter(TailFilter.java:26) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) org.ajax4jsf.webapp.BaseFilter.doFilter(BaseFilter.java:530) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:83) org.jboss.seam.web.IdentityFilter.doFilter(IdentityFilter.java:40) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.MultipartFilter.doFilter(MultipartFilter.java:90) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.ExceptionFilter.doFilter(ExceptionFilter.java:64) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.RedirectFilter.doFilter(RedirectFilter.java:45) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.ajax4jsf.webapp.BaseXMLFilter.doXmlFilter(BaseXMLFilter.java:178) org.ajax4jsf.webapp.BaseFilter.handleRequest(BaseFilter.java:290) org.ajax4jsf.webapp.BaseFilter.processUploadsAndHandleRequest(BaseFilter.java:388) org.ajax4jsf.webapp.BaseFilter.doFilter(BaseFilter.java:515) org.jboss.seam.web.Ajax4jsfFilter.doFilter(Ajax4jsfFilter.java:56) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.LoggingFilter.doFilter(LoggingFilter.java:60) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.web.HotDeployFilter.doFilter(HotDeployFilter.java:53) org.jboss.seam.servlet.SeamFilter$FilterChainImpl.doFilter(SeamFilter.java:69) org.jboss.seam.servlet.SeamFilter.doFilter(SeamFilter.java:158) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) weblogic.servlet.internal.RequestEventsFilter.doFilter(RequestEventsFilter.java:27) weblogic.servlet.internal.FilterChainImpl.doFilter(FilterChainImpl.java:56) weblogic.servlet.internal.WebAppServletContext$ServletInvocationAction.run(WebAppServletContext.java:3592) weblogic.security.acl.internal.AuthenticatedSubject.doAs(AuthenticatedSubject.java:321) weblogic.security.service.SecurityManager.runAs(SecurityManager.java:121) weblogic.servlet.internal.WebAppServletContext.securedExecute(WebAppServletContext.java:2202) weblogic.servlet.internal.WebAppServletContext.execute(WebAppServletContext.java:2108) weblogic.servlet.internal.ServletRequestImpl.run(ServletRequestImpl.java:1432) weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) weblogic.work.ExecuteThread.run(ExecuteThread.java:173)

    Read the article

  • Defining an Entity Framework 1:1 association

    - by Craig Fisher
    I'm trying to define a 1:1 association between two entities (one maps to a table and the other to a view - using DefinedQuery) in an Entity Framework model. When trying to define the mapping for this in the designer, it makes me choose the (1) table or view to map the association to. What am I supposed to choose? I can choose either of the two tables but then I am forced to choose a column from that table (or view) for each end of the relationship. I would expect to be able to choose a column from one table for one end of the association and a column from the other table for the other end of the association, but there's no way to do this. Here I've chosen to map to the "DW_ WF_ClaimInfo" view and it is forcing me to choose two columns from that view - one for each end of the relationship. I've also tried defining the mapping manually in the XML as follows: <AssociationSetMapping Name="Entity1Entity2" TypeName="ClaimsModel.Entity1Entity2" StoreEntitySet="Entity1"> <EndProperty Name="Entity2"> <ScalarProperty Name="DOCUMENT" ColumnName="DOCUMENT" /> </EndProperty> <EndProperty Name="Entity1"> <ScalarProperty Name="PK_DocumentId" ColumnName="PK_DocumentId" /> </EndProperty> </AssociationSetMapping> But this gives: Error 2010: The Column 'DOCUMENT' specified as part of this MSL does not exist in MetadataWorkspace. Seems like it still expects both columns to come from the same table, which doesn't make sense to me. Furthermore, if I select the same key for each end, e.g.: <AssociationSetMapping Name="Entity1Entity2" TypeName="ClaimsModel.Entity1Entity2" StoreEntitySet="Entity1"> <EndProperty Name="Entity2"> <ScalarProperty Name="DOCUMENT" ColumnName="PK_DocumentId" /> </EndProperty> <EndProperty Name="Entity1"> <ScalarProperty Name="PK_DocumentId" ColumnName="PK_DocumentId" /> </EndProperty> </AssociationSetMapping> I then get: Error 3021: Problem in Mapping Fragment starting at line 675: Each of the following columns in table AssignedClaims is mapped to multiple conceptual side properties: AssignedClaims.PK_DocumentId is mapped to <AssignedClaimDW_WF_ClaimInfo.DW_WF_ClaimInfo.DOCUMENT, AssignedClaimDW_WF_ClaimInfo.AssignedClaim.PK_DocumentId> What am I not getting?

    Read the article

  • Logging IP address for uniqueness without storing the IP address itself for privacy

    - by szabgab
    In a web application when logging some data I'd like to make sure I can identify data that came at differetn times but from the same IP address. On the other hand for privacy concerns as the data will be released publicly I'd like to make sure the actual IP cannot be retrieved. So I need some one way mapping of the IP addresses to some other strings that ensures 1-1 mapping. If I understand correctly then MD5, SHA1 or SHA256 could be a solution. I wonder if they are not too expensive in terms of processing needed? I'd be interested in any solution though if there is implementation in Perl that would be even better.

    Read the article

  • FluentNhibernate IDictionary<Entity,ValueObject>

    - by Miguel Marques
    I had a mapping for a IDictionary<StocksLocation,decimal> property, this was the mapping: HasMany<StocksLocation>(mq => mq.StocksLocation) .KeyColumn("IDProduct") .AsEntityMap("IDLocation") .Element("Quantity", qt => qt.Type<decimal>()); Now i changed from decimal to a Value Object: Quantity. Quantity has two properties, decimal Value and Unit Unit (where Unit is an enum). I now have to map IDictionary<StocksLocation,Quantity>, how can i achieve this? Thanks in advance

    Read the article

  • Problem with UTF-8

    - by Pablo Fernandez
    I'm using castor as an OXM mapper, and I'm having a problem with UTF-8 encoding. The code here shows the issue: //Marshaller configuration ByteArrayOutputStream baos = new ByteArrayOutputStream(); OutputStreamWriter os = new OutputStreamWriter(baos, UTF_8); Marshaller marshaller = new Marshaller(os); marshaller.setSuppressXSIType(true); //Mappings configuration Mapping map = new Mapping(); map.loadMapping(MarshallingService.class.getResource(MAPPINGS_PATH)); marshaller.setMapping(map); //Example //BEFORE MARSHALLING: This prints correctly the UTF-8 Chars object.getName() ; marshaller.marshal(object); //AFTER MARSHALLING: This returns the characters like \435\235\654\345 return baos.toString(UTF_8);

    Read the article

  • OpenGL FrameBuffer Objects weird behavior

    - by Ben Jones
    My algorithm is this: Render the scene to a FBO with shadow mapping from multiple locations Render the scene to the screen with shadow mapping ...black magic that I still have to imlement... Combine the samples from step 1 with the image from step 2 I'm trying to debug steps 1 and 2 and am coming across STRANGE behavior. My algorithm for each shadow mapped pass is: render the scene to a FBO connected to a depth array texture from the POV of each light render the scene from the viewpoint and use vertex/frag shaders to compare the depths When I run my algorithm this way: render from point to FBO render from point to screen glutSwapBuffers() The normal vectors in the screen pass appear to be incorrect (inverted possibly). I'm pretty sure that's the issue because my diffuse lighting calculation is incorrect, but the material colors are correct, and the shadows appear in the correct places. So, it seems like the only thing that could be the culprit is the normals. However if I do render from point to FBO render from point to Screen glutSwapBuffers() //wrong here render from point to Screen glutSwapBuffers() the second pass is correct. I assume there's a problem with my framebuffer calls. Can anyone see what the problem is from the log below? Its from a bugle trace grepped for 'buffer' with a few edits to make it a little more clear. Thanks! [INFO] trace.call: glGenFramebuffersEXT(1, 0xdfeb90 - { 1 }) [INFO] trace.call: glGenFramebuffersEXT(1, 0xdfebac - { 2 }) [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 1) [INFO] trace.call: glDrawBuffer(GL_NONE) [INFO] trace.call: glReadBuffer(GL_NONE) [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 0) //start render to FBO [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 2) [INFO] trace.call: glReadBuffer(GL_NONE) [INFO] trace.call: glFramebufferTexture2DEXT(GL_FRAMEBUFFER, GL_COLOR_ATTACHMENT0, GL_TEXTURE_2D, 2, 0) [INFO] trace.call: glFramebufferTexture2DEXT(GL_FRAMEBUFFER, GL_DEPTH_ATTACHMENT, GL_TEXTURE_2D, 3, 0) [INFO] trace.call: glDrawBuffer(GL_COLOR_ATTACHMENT0) //bind to the FBO attached to a depth tex array for shadows [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 1) [INFO] trace.call: glFramebufferTextureLayerARB(GL_FRAMEBUFFER, GL_DEPTH_ATTACHMENT, 1, 0, 0) [INFO] trace.call: glClear(GL_DEPTH_BUFFER_BIT) //draw geometry //bind to the FBO I want the shadow mapped image rendered to [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 2) [INFO] trace.call: glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT) //draw geometry //draw to screen pass //again shadow mapping FBO [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 1) [INFO] trace.call: glFramebufferTextureLayerARB(GL_FRAMEBUFFER, GL_DEPTH_ATTACHMENT, 1, 0, 0) [INFO] trace.call: glClear(GL_DEPTH_BUFFER_BIT) //draw geometry //bind to the screen [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 0) [INFO] trace.call: glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT) //finished, swap buffers [INFO] trace.call: glXSwapBuffers(0xd5fc10, 0x05800002) //INCORRECT OUTPUT //second try at render to screen: [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 1) [INFO] trace.call: glFramebufferTextureLayerARB(GL_FRAMEBUFFER, GL_DEPTH_ATTACHMENT, 1, 0, 0) [INFO] trace.call: glClear(GL_DEPTH_BUFFER_BIT) //draw geometry [INFO] trace.call: glBindFramebufferEXT(GL_FRAMEBUFFER, 0) [INFO] trace.call: glClear(GL_COLOR_BUFFER_BIT | GL_DEPTH_BUFFER_BIT) draw geometry [INFO] trace.call: glXSwapBuffers(0xd5fc10, 0x05800002) //correct output

    Read the article

  • Spring MVC annotation config problem

    - by Seth
    I'm trying to improve my spring mvc configuration so as to not require a new config file for every servlet I add, but I'm running into problems. I've tried using this tutorial as a starting point, but I'm running into an issue that I can't figure out. The problem is that when I do a GET to my servlet, I get back a 404 error. Here's my config and a representative java snippet from a Controller: web.xml: <?xml version="1.0" encoding="UTF-8"?> <web-app version="2.5" xmlns="http://java.sun.com/xml/ns/javaee" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://java.sun.com/xml/ns/javaee http://java.sun.com/xml/ns/javaee/web-app_2_5.xsd"> <display-name>SightLogix Coordination System</display-name> <description>SightLogix Coordination System</description> <servlet> <servlet-name>Spring MVC Dispatcher Servlet</servlet-name> <servlet-class>org.springframework.web.servlet.DispatcherServlet</servlet-class> <init-param> <param-name>contextConfigLocation</param-name> <param-value> /WEB-INF/application-context.xml /WEB-INF/application-security.xml </param-value> </init-param> <load-on-startup>1</load-on-startup> </servlet> <servlet-mapping> <servlet-name>Spring MVC Dispatcher Servlet</servlet-name> <url-pattern>/slcs/*</url-pattern> </servlet-mapping> <context-param> <param-name>contextConfigLocation</param-name> <param-value> /WEB-INF/application-context.xml /WEB-INF/application-security.xml </param-value> </context-param> <listener> <listener-class> org.springframework.web.context.ContextLoaderListener </listener-class> </listener> <filter> <filter-name>springSecurityFilterChain</filter-name> <filter-class>org.springframework.web.filter.DelegatingFilterProxy</filter-class> </filter> <filter-mapping> <filter-name>springSecurityFilterChain</filter-name> <url-pattern>/*</url-pattern> </filter-mapping> </web-app> application-context.xml: <?xml version="1.0" encoding="UTF-8"?> <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:mvc="http://www.springframework.org/schema/mvc" xmlns:context="http://www.springframework.org/schema/context" xsi:schemaLocation=" http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-3.0.xsd http://www.springframework.org/schema/mvc http://www.springframework.org/schema/mvc/spring-mvc-3.0.xsd http://www.springframework.org/schema/context http://www.springframework.org/schema/context/spring-context-3.0.xsd" default-init-method="init" default-destroy-method="destroy"> <mvc:annotation-driven /> <context:component-scan base-package="top.level" /> </beans> application-security.xml: <beans:beans xmlns="http://www.springframework.org/schema/security" xmlns:beans="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-3.0.xsd http://www.springframework.org/schema/security http://www.springframework.org/schema/security/spring-security-3.0.xsd"> <http> <intercept-url pattern="/**" access="ROLE_MANAGER" requires-channel="https" /> <http-basic /> </http> <authentication-manager> <authentication-provider user-service-ref="myUserDetailsService"> <password-encoder hash="sha"/> </authentication-provider> </authentication-manager> <beans:bean id="myUserDetailsService" class="path.to.my.UserDetailsServiceImpl"> </beans:bean> </beans:beans> Snippet of a Controller class (one of many, but they all look essentially like this): @Controller @RequestMapping("/foo.xml") public class FooController { @RequestMapping(method=RequestMethod.GET) public void handleGET(HttpServletRequest request, HttpServletResponse response) throws IOException { ... Can anyone tell me what I'm doing incorrectly? Thanks!

    Read the article

  • Exclude filter from certain url's

    - by Mads Mobæk
    I'm using a filter in web.xml to check if a user is logged in or not: <filter> <filter-name>LoginFilter</filter-name> <filter-class>com.mycompany.LoginFilter</filter-class> </filter> <filter-mapping> <filter-name>LoginFilter</filter-name> <url-pattern>/*</url-pattern> </filter-mapping> And this works like a charm until I have a stylesheet or image I want to exclude from this filter. I know one approach is to put everything that's protected inside /privateor similar, and then set the url-pattern to: <url-pattern>/private/*</url-pattern>. The downside to this is my URLs now looking like: http://www.mycompany.com/private/mypage instead of http://www.mycompany.com/mypage. Is there another solution to this problem, that let me keep my pretty-urls?

    Read the article

  • Grails / GORM, read-only cache and transient fields

    - by Stephen Swensen
    Suppose I have the following Domain object mapping to a legacy table, utilizing read-only second-level cache, and having a transient field: class DomainObject { static def transients = ['userId'] Long id Long userId static mapping = { cache usage: 'read-only' table 'SOME_TABLE' } } I have a problem, references to DomainObject instances seem to be shared due to the caching, and thus transient fields are writing over each other. For example, def r1 = DomainObject.get(1) r1.userId = 22 def r2 = DomainObject.get(1) r2.userId = 34 assert r1.userId == 34 That is, r1 and r2 are references to the same instance. This is undesirable, I would like to cache the table data without sharing references. Any ideas?

    Read the article

  • VSS to TFS Migration - Persist User on check-in actions

    - by Adam Jenkin
    I am using the VSSConveter.exe tool to import from VSS6 (using 2005 ide) to TFS2008. I have run analyze (no errors) and migrate WITH a user mapping file (containg the vss/domain user mappings) I would like to persist in tfs the check-in user of the file, currently the check-in user for all versions of file shows as admin (the account im running the import with), the origional check-in user is appended to the check-in comment. For example:- TestFile.aspx in VSS Check in ver: 1 - User:Adam - Comment:TEST1 Check in ver: 2 - User:James - Comment:TEST2 Check in ver: 3 - User:Joel - Comment:TEST2 After import into TFS Check in ver: 1 - User:mydomain\Admin - Comment:TEST1 (Commited by Adam) Check in ver: 2 - User:mydomain\Admin - Comment:TEST2 (Commited by James) Check in ver: 3 - User:mydomain\Admin - Comment:TEST2 (Commited by Joel) In TFS I want the user to show as the correct domain user as configured in my user mapping file. Is this possible, or is this just how the VSSConverter program works?

    Read the article

  • Hibernate annotations cascading doesn't work

    - by user304309
    Hi all, I've decided to change hbm.xml style to annotations using hibernate. I had in my hbm.xml: <hibernate-mapping package="by.sokol.jpr.data"> <class name="Licence"> <id name="licenceId"> <generator class="native" /> </id> <many-to-one name="user" lazy="false" cascade="save-update" column="usr"/> </class> </hibernate-mapping> And changed it to: @Entity public class Licence { @Id @GeneratedValue(strategy = GenerationType.AUTO) private int licenceId; @ManyToOne(targetEntity=User.class, fetch=FetchType.EAGER, cascade = CascadeType.ALL) @Cascade(value = { org.hibernate.annotations.CascadeType.SAVE_UPDATE }) private User user; } And hibernate doesn't save user on saving. I really need help!

    Read the article

  • Grails multiple databases

    - by srinath
    Hi, how can we write queries on 2 databases . I installed datasources plugin and domain classes are : class Organization { long id long company_id String name static mapping = { version false table 'organization_' id column : 'organizationId' company_id column : 'companyId' name column : 'name' } } class Assoc { Integer id Integer association_id Integer organization_id static mapping = { version false table 'assoc' id column : 'ASSOC_ID' association_id column : 'ASSOCIATION_ID' organization_id column : 'ORGANIZATION_ID' } } this is working : def org = Organization.list() def assoc = Assoc.list() and this is not working : def query = Organization.executeQuery("SELECT o.name as name, o.id FROM Organization o WHERE o.id IN (SELECT a.organization_id FROM Assoc a )") error : org.hibernate.hql.ast.QuerySyntaxException: Assoc is not mapped [SELECT o.name as name, o.id FROM org.com.domain.Organization o WHERE o.id IN (SELECT a.organization_id FROM AssocOrg a )] How can we connect with 2 databases using single query ? thanks in advance .

    Read the article

  • ETag in Spring (ShallowEtagHeaderFilter)

    - by niklassaers
    Hi guys, I've followed http://static.springsource.org/spring/docs/3.0.2.RELEASE/spring-framework-reference/html/mvc.html#mvc-etag and put ShallowEtagHeaderFilter in my web.xml like this: <filter> <filter-name>etagFilter</filter-name> <filter-class>org.springframework.web.filter.ShallowEtagHeaderFilter</filter-class> </filter> <filter-mapping> <filter-name>etagFilter</filter-name> <servlet-name>myServlet</servlet-name> <!-- I've even tried <url-pattern>/*</url-pattern> --> </filter-mapping> But whenever I load my pages, I don't get any etag headers in my response. Any suggestions as to what might be going on? Is there any kind of ordering my filters should have? (I'm also using OpenSessionInViewFilter and DelegatingFilterProxy Cheers Nik

    Read the article

  • problem in opening a link to .rar file

    - by Kenneth
    Hi all, In my jsp, I have a hyperlink linking to a .rar file in the system. Somehow when I clicked on the link, it does not ask users to 'save file' or 'open file' nor using 7zip to open the .rar file. Instead, it just displays some junk characters on the web page. I thought it might be the problem with mime-mapping. So I put an mime-mapping to web.xml with mime-type=application/x-rar-compressed. But it still doesn't work. Do you have any idea what the problem is and how to solve it? Thanks a lot in advance. Other file types have no problem. Kenneth

    Read the article

  • Geopraphic Charting controls for Websites

    - by Ian
    Hi All, I need to create dash boards showing geographic regions and show sales, hot spots etc on a map. What have you tried and what do you recommend? I like the look of both Fusion Charts and Dundas I will be using asp.net for the site but any control's or library's including flash or javascript are good options. Most important is the look and feel followed by functionality in South Africa. After my last post looking for commercial mapping solutions, it looks like they are very expensive and now I am investigating alternatives to full mapping solutions. thanks

    Read the article

  • Java input method for Virtual Keyboad

    - by shekhar
    Hi, I am facing problem in implementing Input method for Virtual Keyboard, currently I am using robot class for sending input to any application from virtual keyboard. but for that I need to create mapping of key-code and unicode, which is not consistent on different keyboard layout, can I directly pass the UNICODE to any application using Input method without worry about mapping between keycode and unicode. any useful link or sample code will be useful. It is simple Java program which is always on top of any application and work as onscreen keyboard. using a mouse while you press any button (key) of the keyboard, the corresponding character will be typed in the application running below. This is working perfectly for English Alphabets. I am facing problem while I am doing for unicode.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Best Persistence API for use with GWT

    - by KevMo
    What is the best persistence API for use with GWT? Sadly, the application will be hosted on my own java server, as I will need more control than GAE will give me. I know I will need to have two sets of my entities, one for the server side, and some pojo's for the client side. I'm looking to make the mapping of the data as simple as possible between the two, but these will be deeply nested objects so it has to be robust. I was looking at Dozer for my mapping needs. Previously I've used EJB3 with TopLink, so that's very familiar to me, but I would like to get community input on what other API's work well with Dozer and GWT.

    Read the article

  • Spring, Jersey and Viewable JSP Integration

    - by Brian D.
    I'm trying to integrate Spring 3.0.5 with Jersey 1.4. I seem to have everything working, but whenever I try and return a Viewable that points to a JSP, I get a 404 error. When I wasn't using spring I could use this filter: <filter> <filter-name>Jersey Filter</filter-name> <filter-class>com.sun.jersey.spi.container.servlet.ServletContainer</filter-class> <init-param> <param-name>com.sun.jersey.config.feature.Redirect</param-name> <param-value>true</param-value> </init-param> <init-param> <param-name>com.sun.jersey.config.property.packages</param-name> <param-value>cheetah.frontend.controllers</param-value> </init-param> <init-param> <param-name>com.sun.jersey.config.feature.FilterForwardOn404</param-name> <param-value>true</param-value> </init-param> <init-param> <param-name>com.sun.jersey.config.property.WebPageContentRegex</param-name> <param-value>/(images|css|jsp)/.*</param-value> </init-param> </filter> And I could return a Viewable to any JSP's, image, css that were stored in the appropriate folder. However, now that I have to use the SpringServlet to get spring integration, I'm at a loss for how to access resources, since I can't use the filter above. I've tried using this servlet mapping with no luck: <servlet> <servlet-name>jerseyspring</servlet-name> <servlet-class>com.sun.jersey.spi.spring.container.servlet.SpringServlet</servlet-class> <load-on-startup>1</load-on-startup> <init-param> <param-name>com.sun.jersey.config.property.WebPageContentRegex</param-name> <param-value>/(images|css|jsp)/.*</param-value> </init-param> </servlet> <servlet-mapping> <servlet-name>jerseyspring</servlet-name> <url-pattern>/*</url-pattern> </servlet-mapping> Does anyone know the proper configurations to achieve this? Thanks for any help.

    Read the article

  • Hibernate - PropertyNotFoundException: Could not find a getter for ...

    - by Ben Noland
    I have a class that looks like the following: public class MyClass { private String dPart1; public String getDPart1() { return dPart1; } public void setDPart1(String dPart1) { this.dPart1 = dPart1; } } My hibernate mapping file maps the property as follows: <property name="dPart1" not-null="true"/> I get the following error: org.hibernate.PropertyNotFoundException: Could not find a getter for dPart1 in class com.mypackage.MyClass at org.hibernate.property.BasicPropertyAccessor.createGetter(BasicPropertyAccessor.java:282) at org.hibernate.property.BasicPropertyAccessor.getGetter(BasicPropertyAccessor.java:275) at org.hibernate.mapping.Property.getGetter(Property.java:272) at org.hibernate.tuple.entity.PojoEntityTuplizer.buildPropertyGetter(PojoEntityTuplizer.java:247) at org.hibernate.tuple.entity.AbstractEntityTuplizer.<init>(AbstractEntityTuplizer.java:125) at org.hibernate.tuple.entity.PojoEntityTuplizer.<init>(PojoEntityTuplizer.java:55) at org.hibernate.tuple.entity.EntityEntityModeToTuplizerMapping.<init>(EntityEntityModeToTuplizerMapping.java:56) at org.hibernate.tuple.entity.EntityMetamodel.<init>(EntityMetamodel.java:302) at org.hibernate.persister.entity.AbstractEntityPersister.<init>(AbstractEntityPersister.java:434) at It appears that hibernate doesn't like my capitalization. How should I fix this?

    Read the article

  • Using Hibernate to do a query involving two tables

    - by Nathan Spears
    I'm inexperienced with sql in general, so using Hibernate is like looking for an answer before I know exactly what the question is. Please feel free to correct any misunderstandings I have. I am on a project where I have to use Hibernate. Most of what I am doing is pretty basic and I could copy and modify. Now I would like to do something different and I'm not sure how configuration and syntax need to come together. Let's say I have two tables. Table A has two (relevant) columns, user GUID and manager GUID. Obviously managers can have more than one user under them, so queries on manager can return more than one row. Additionally, a manager can be managing the same user on multiple projects, so the same user can be returned multiple times for the same manager query. Table B has two columns, user GUID and user full name. One-to-one mapping there. I want to do a query on manager GUID from Table A, group them by unique User GUID (so the same User isn't in the results twice), then return those users' full names from Table B. I could do this in sql without too much trouble but I want to use Hibernate so I don't have to parse the sql results by hand. That's one of the points of using Hibernate, isn't it? Right now I have Hibernate mappings that map each column in Table A to a field (well the get/set methods I guess) in a DAO object that I wrote just to hold that Table's data. I could also use the Hibernate DAOs I have to access each table separately and do each of the things I mentioned above in separate steps, but that would be less efficient (I assume) that doing one query. I wrote a Service object to hold the data that gets returned from the query (my example is simplified - I'm going to keep some other data from Table A and get multiple columns from Table B) but I'm at a loss for how to write a DAO that can do the join, or use the DAOs I have to do the join. FYI, here is a sample of my hibernate config file (simplified to match my example): <hibernate-mapping package="com.my.dao"> <class name="TableA" table="table_a"> <id name="pkIndex" column="pk_index" /> <property name="userGuid" column="user_guid" /> <property name="managerGuid" column="manager_guid" /> </class> </hibernate-mapping> So then I have a DAOImplementation class that does queries and returns lists like public List<TableA> findByHQL(String hql, Map<String, String> params) etc. I'm not sure how "best practice" that is either.

    Read the article

< Previous Page | 64 65 66 67 68 69 70 71 72 73 74 75  | Next Page >