Search Results

Search found 18146 results on 726 pages for 'jquery calculation'.

Page 684/726 | < Previous Page | 680 681 682 683 684 685 686 687 688 689 690 691  | Next Page >

• Designing template for Ruby on Rails view. What and where to learn?

  - by Victor

  Hi. I have a project going on, and I am in charge of the front-end design, whereas my developers will work on the back-end with Ruby on Rails. I do not know Ruby on Rails, and am designing front-end using XHTML, CSS, jQuery, 960.gs CSS Framework. My developer is supposed to take my design and connect the elements of back-end to it, with Ajax too. What are the things that I should know while designing the template/view so that I won't kick my developers' asses with my design? How to help the connecting of elements painless? I understand I must avoid . Some Ruby on Rails developers also prefer Blueprint CSS Framework over 960.gs. Any guidance? Thanks.

  Read the article

• Efficient file buffering & scanning methods for large files in python

  - by eblume

  The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

  Read the article

• drupal: so many js and css files ?

  - by Patrick

  hi, I've realized I'm loading a lot of resources (24 css and 17 js files) using Drupal. I've several modules installed and they all come with a css and js file. For my website I'm only using 1 additional js plugin (all the other 16 come with Drupal modules). I've not installed useless modules. They are all necessary, and they require js such as swfobject, ajax_views, jquery.media, spamspan, lightbox (modal, video and default js files), etc Same thing with css files: ckeditor, filefield, lightbox, tagadelic, uploadfield, fieldgroup, vews, taxonomy_super_select, html-element, tabs, messages... etc For my website, I only use my theme css zen.css of course. So.. is this normal ? Or I should remove all this stuff? Are drupal websites normally heavy ? thanks

  Read the article

• The pros and cons of use JSON for WCF service

  - by brz dot net

  What are the pros and cons of the following 2 cases: Case I: Traditional way: Add service reference in project. Create object and Get data from service on server side and bind to asp.net grid. Case II: Update Service for JSON behavior. Add service reference in project. Call service from javascript to get data. Bind data to jquery grid. Which one is the best approach and why?(Not developer point of view) If there is another approach which is more optimized, please explain it.

  Read the article

• problem with drupal view and php code

  - by czuroski

  Hello, I have a view set up in drupal and I am using some jquery code within the view which hides some data based upon a text box value. Everything is working fine for me when I am logged in. When I log out and access the block anonymously, it doesn't work correctly. I am somewhat new to drupal, and don't know where to begin troubleshooting. I assume it is a permissions issue, but on the view, on the content type, where? If anyone could give me some direction on where to start looking, I would greatly appreciate it. Thanks

  Read the article

• Specify only the second parameter in a javascript function

  - by Ben McCormack

  The spec for the jQuery ajax.error function is: error(XMLHttpRequest, textStatus, errorThrown)Function I'm trying to catch the error and display the textStatus, but I can't figure out how to specify only the textStatus without having to put in a variable name for XMLHttpRequest and errorThrown. My code currently looks like this: $.ajax({ type: "POST", contentType: "application/json; charset=utf-8", url: hbAddressValidation.webServiceUrl, data: this.jsonRequest, dataType: "json", timeout: 5, success: function (msgd) { //... }, error: function (a,textStatus,b) { $("#txtAjaxError").val("There was an error in the AJAX call: " + textStatus); } }); You can see in my code that I'm putting variables a and b as placeholders for the first and last variables in the error function. I know that in my success function, I'm only providing one parameter and it works fine, but in that case data is the first parameter. In the case of error, textStatus is the second parameter, but that's the only one I want to specify. Is this possible?

  Read the article

• How to make a cross browser, W3C valid, semantic, non-javascript ROUND corner?

  - by jitendra

  I want to make a cross-browser (FF3, IE6, Safari, Opera), W3C valid (HTML and CSS both), stretchable (horizontally vertically), without JavaScript and with Semantic and lesser HTML markup Round CORNER. Images can be used for IE6. I've tried and tested many techniques available on community. But everything has one of the problems mentioned above . If anyone knows what I want please share with me? Remember I want to make it without any type of JavaScript, jquery or any type of js.

  Read the article

• Which faces technology for use with GlassFish 2.1 and NetBeans 6.7?

  - by SteJav

  I'm running GlassFish 2.1 and using NetBeans 6.7. I'd like to create a web interface to my data using JSF 1.2. Trouble is, I'm not sure which 'faces' technology to learn (that includes some good documentation). JBoss/RichFaces seem pretty good on documentation, but I'm using GlassFish. Any thoughts? The choices appear overwhelming: Tomahawk Tobago Trinidad ICEfaces RCFaces Netadvantage WebGalileoFaces QuipuKit BluePrints Woodstock JBoss RichFaces Ajax4jsf ILOG Oracle ADF G4JSF Simplica Backbase jenia4faces VisualWebPack DynaFaces IBM Impl Dinamica Mojarra PrimeFaces jQuery OpenFaces ZK ExtJS Anybody had any experience with any of the above and found the documentation to be clear to a beginner? Being a JSF/Web beginner, I tried some ICEFaces, Mojarra tutorials and had a go at getting RichFaces working with NBeans and GlassFish, but no luck. Lots of XML complaints. I'm clearly missing some huge chunks of configuration, but I can't find any documentation to help me. Any suggestions would be much appreciated :-)

  Read the article

• JavaScript helper libraries? No DOM or AJAX stuff

  - by Melmacian

  As I'm writing JavaScript I'm always missing some fairly basic language features that JavaScript just don't have. So is there any library that would bring such features as trim, sprintf, str.endwith and etc. functions to JavaScript ? I just have written those functions too many times and I'm also tired of copy/pasting them from my old code. It would be nice to have some library which has those implemented and tested in one place. Note that I'm not talking about Ajax/DOM-libraries like jQuery or Dojo and such. I know that those libraries bring some of the features that I'm talking here, but not all. And I would like to have also an environment independent library so that same library could be used with server side JavaScript . Best library so far that I've found is php.js, but I don't like how it is polluting the global namespace. I'm also not too fond of how PHP-functions are named.

  Read the article

• What is the easiest way to send a Javascript array via JSON to PHP?

  - by dscher

  I have a few arrays that I want to send to process with PHP. Using json2.js I will stringify the arrays like so: var JSONlinks = JSON.stringify(link_array); var JSONnotes = JSON.stringify(note_array); but then I'm confused. Do I need to use a XMLHttpRequest object? Is there another way? If that is the simplest way, could someone please just share the most basic instance of the code needed in order to send to PHP where I can then use JSON decode? I think it might help others in the future really. I'm currently using Jquery and I know there are many options out there for frameworks and each one may or may not make this process any easier. If you're using a framework in your reply please mention why you'd choose that framework rather than just javascript.

  Read the article

• How to enable/create elements on the fly

  - by Simon S

  Hi all I am using a combination of PHP, jQuery and Spry to serve a series of listboxes in which a user will select first the type of vehicle, then the make, then the model and finally the specific model. All my listboxes (SELECT) are working fine, and they update properly using the Spry elements. Each listbox is populated from a different Spry XML Dataset, and this is my problem. If I present all four listboxes to the user, the script has to go and fetch all four lots of XML to populate all four listboxes, taking several seconds. What I want to do is to create/enable the listboxes in order, so at the user selects from the first listbox, the second is created/enabled, when they select from the second, the third is created/enabled... and so on. Setting the disabled attribute is no good because the script has already fetched the XML before this is processed. Any ideas?? Si

  Read the article

• Simple ASP.NET MVC Routing question

  - by Robert

  Hi there, I have two pages in my simple MVC App with two defined routes: routes.MapRoute( "Results", // Route name "Results/{id}", // URL with parameters new { controller = "Results", action = "Index", id = "" } // Parameter defaults ); routes.MapRoute( "Default", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Main", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); I needed to have the results page load with just a product ID such as this: [MyDomain....]/Results/12345. But also the main page does a POST (using JQuery) to the Results Controller for updates using this route: [MyDomain....]/Main/Update along with a data bag. This works fine when I only have the "Default" route. But when I added the other "Results" route, all the POST calls to update are failing. Any ideas what I'm doing wrong??? Thanks a lot.

  Read the article

• update element in knockout template which was changed by 3td party library

  - by yakov

  I have 'div' element (recaptchaDiv) in knockout template which is not bound to any observable field: <div id="recaptchaDiv"></div> On the other hand, I update this 'div' by 3rd party library. In particular, this is google recaptcha. This is my code: Recaptcha.create("[my private key]", "recaptchaDiv", { theme: "clean", callback: Recaptcha.ToTest }); And it doesn't work (I see nothing). What I know: trying on FF console: $("#recaptchaDiv").html() - it shows the expected html code, I just can't see it in the browser What I tried: to move recaptchaDiv outside of the template and it works: I can see the captcha in the browser to bind recaptchaDiv on html property: in the template: <div id="recaptchaDiv" data-bind="html: recaptcha"></div> in the model: Recaptcha.create("[my private key]", "recaptchaDiv", { theme: "clean", callback: Recaptcha.ToTest }); recaptcha($("#recaptchaDiv").html()); and it doesn't work (replacing jquery on document.getElementById doesn't help) Any help will be very much appreciated!!! Thank you in advance.

  Read the article

• Can I access the function body of an event listener using nodeJS jsdom

  - by Zhami

  I am using jsdom with nodeJS. I load in a large HTML document, and am using jQuery to navigate the DOM. I have a case where I have an element, and I need to access the function body of an event listener (onclick). The event listener was added in the source HTML: <a href="#" onclick="javascript:window.open('http://<rest-of-url>'); return false;"></a> The onclick attribute of the DOM element is undefined. btw: what I really want to do is get the URL (please note that <rest-of-url> is not what is in the source, a real URL spec is there) that is specified in the source.

  Read the article

• Can a Javascript bookmarklet overlay an image on a web page?

  - by songdogtech

  Can a bookmarklet be used to overlay an image on a web page? Not as a pop-up, but as a image positioned by CSS and with a high z-index to display on top of other elements. And without a mask i.e., Shadowbox or similar jQuery effect. Just an image from a URL and positioned in the bottom left hand corner of the browser window. This is what I have so far, but it may be the wrong direction to be going: javascript:(function(){document.write("body {background-image:url(http://mydomain.com/image.png); position: absolute; left:50px; top:300px; z-index:9999;}");})() I have a JS function that works as a bookmarklet to change the case of text on the page, and now I'd like to be able to show an image when the bookmarklet is used.

  Read the article

• Ajax DragPanelExtender drag an item from one panel to another

  - by Morgeh

  I have a panel called "ItemPot" and several panels called "ItemBank1", "ItemBank2" etc. Currently I have dynamically added 5 items to the pot and given each one a DragPanelExtender so that those items can be moved around within the panel, however what I wan't to be able to do is to move those items into the banks and then save there new parent ID ("itembank1") to the database using C#. Does anyone know of an easy way of doing that? I have looked around the internet and I have found loads of ways of doing similar things using JQuery or Mootools but I would rather not have to use Javascript if possible, I know that might be wishful thinking lol.

  Read the article

• network error 414 when using google translate with wordpress

  - by zac

  I am using a jQuery and google translate on a wordpress site. It works well unless I call a div that is repeated in the loop like in an archives page. On these pages I get a network error 414 that the request URI is too large. The archives page I have are short and the php is only generating about 5 paragraphs for each category archive. Does anyone know how I can correct this error? Is this a serverfault question?

  Read the article

• What states does my route travel through?

  - by Bert Smith

  I've got a page that has a map with a starting and ending location. I run a route between them to get the nifty line showing the route. I'm currently using Bing but have attempted with Google as well. I'd like to know which states this route passes through so I can then overlay those states with specific information. Any suggestions on how to obtain this would be most appreciated. I'm using the AJAX SDK's for both Bing and Google. Handling all the local stuff with js/jquery.

  Read the article

• Bootstrap Modal & rails remote

  - by Kevin Brown

  Using this bootstrap modal extension and animate.css for fun, how can I take a make an easy ajax modal using :remote => true to fill in the modal box? Also, how would I use the bootstrap modal default "submit/cancel" buttons to interact with a form that's loaded? I'm looking for a more dynamic solution instead of hard-html-ing every modal into the page or using a bunch of jquery ajax calls for each dialog. I've done a few quick searches, but they've turned up nil for this particular solution.

  Read the article

• Where is a Web Development Career fueled by Passion? [closed]

  - by JMC Creative

  Quick Background Since learning basic html 5 years ago, I've become completely obsessed with the technology, the logic, and the thrill of solving problems involved with building websites. I am still stuck at a thoroughly non-programming type job, but would really like to move into the field of web programming/design. I have no educational background in the field (was trained as a fine artist and tutor), but in the past few years have progressed fully self-taught (and self-motivated) from html to css to php, mysql, jquery, and am now building rich web applications. The Question How can I prove to a company that even though I have no education, I have a passion to learn whatever is thrown my way? ...That essentially I would come at every issue with not only knowledge, but with a passionate desire to solve it, whether that means tackling a new language or debugging code for hours at a time? p.s. Sorry for the stupid title.

  Read the article

• Where would I use a bitwise operator in JavaScript?

  - by J-P

  I've read this (http://stackoverflow.com/quest...), so I know what bitwise operators are but I'm still not clear on how one might use them... Can anyone offer any real-world examples of where a bitwise operator would be useful in JavaScript? Thanks. Edit: Just digging into the jQuery source I've found a couple of places where bitwise operators are used, for example: (only the & operator) // Line 2756: event.which = (event.button & 1 ? 1 : ( event.button & 2 ? 3 : ( event.button & 4 ? 2 : 0 ) )); // Line 2101 var ret = a.compareDocumentPosition(b) & 4 ? -1 : a === b ? 0 : 1;

  Read the article

• Finding Line Beginning using Regular expression in Notepad++

  - by Michel Merlin

  Finding Line Beginning using Regular expression in Notepad++ (Sorry if this is a newbie question) I want to strip a 4000-line HTML file from all the jQuery "done" stuff, e.g.: <DIV class=menu done27="1" done26="0" done9="1" done8="0" done7="1" done6="0" done4="20"> should be replaced with: <DIV class=menu> In http://www.zytrax.com/tech/web/regex.htm#experiment I can do it with RE: [ ^]done[0-9]+="[0-9]+" but in Notepad++ 5.6.8 UNICODE, in a .HTM file encoded in ANSI, Search Find, Search mode = Regular expression, putting this RE in the "Find what" field won't work (it will only find the 5 occurrences starting with a space, it will miss the 2 occurrences starting at the beginning of a line; IOW, the caret for line beginning, or the alternating it with a space, fails). How do I? TIA, Versailles, Wed 21 Apr 2010 10:42:20 +0200

  Read the article

• Finding Line Beginning using Regular expression in Notepad++

  - by Michel Merlin

  Finding Line Beginning using Regular expression in Notepad++ (Sorry for this newbie question) I want to strip a 4000-line HTML file from all the jQuery "done" stuff, e.g.: <DIV class=menu done27="1" done26="0" done9="1" done8="0" done7="1" done6="0" done4="20"> should be replaced with: <DIV class=menu> In http://www.zytrax.com/tech/web/regex.htm#experiment I can do it with RE: [ ^]done[0-9]+="[0-9]+" but in Notepad++ 5.6.8 UNICODE Search Find, Search mode = Regular expression, putting this RE in the "Find what" field won't work (it will only find the 5 occurrences starting with a space, it will miss the 2 occurrences starting at the beginning of a line; IOW, the caret for line beginning, or the alternating it with a space, fails). How do I? TIA, Versailles, Wed 21 Apr 2010 10:18:20 +0200

  Read the article

• Is it me or is developing web based data entry GUIs a big pain?

  - by GregH

  Maybe it's me or maybe it isn't. I don't have a huge amount of experience of developing web based data entry software but do have some. I used to do it quite a bit years ago. Used to use Oracle Forms, Visual Studio, various 4th generation languages, and performing the user interface layout used to be a snap. Now doing the user interface for developing web applications seems to be a huge pain in the rear. Just trying to get text entry fields and widgets to go where they are supposed to go on the screen is a total pain. You have to know Javascript, CSS, JQuery, HTML, etc. There must be an easier way to develop data entry forms that produce the needed underlying code for a web page. Maybe I'm just not looking in the right place. There must be some WYSIWYG GUI development tools for the web for developing data entry forms out there. Anybody know of any?

  Read the article

• Javascript hasOwnProperty does not work under Google Chrome

  - by WebRookie

  I am currently working with some help and it has been going well, until this incident. function runCommand(commandString) { commands = new Object(); commands.clear = function(){ $('#terminal').html('') } parameters = commandString.split(" "); command = parameters.shift(); if( commands.hasOwnProperty(command)){ commandscommand; } else { $('#terminal').append(command+' command not recognized.'+''); } } The person who was helping me made this function, so I could run the "terminal-like" browsers that I needed to work on. It works fine when using Firefox, heres an example: guest@shell:/$ sudo make me sandwich sudo command not recognized. guest@shell:/$ clear *clears* guest@shell:/$ clear But under google chrome this happen: guest@shell:/$ sudo make me sandwich sudo command not recognized. guest@shell:/$ clear clear command not recognized. I believe that it has something to do with "commands.hasOwnProperty(command)" that is preventing it from working properly. I am using JQuery the javascript library to build the website, and I need to know how to solve this problem, or an alternative.

  Read the article

< Previous Page | 680 681 682 683 684 685 686 687 688 689 690 691  | Next Page >