Search Results

Search found 36874 results on 1475 pages for 'string comparison'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 7/1475 | < Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >

  • String replacement problem.

    - by fastcodejava
    I want to provide some template for a code generator I am developing. A typical pattern for class is : public ${class_type} ${class_name} extends ${super_class} implements ${interfaces} { ${class_body} } Problem is if super_class is blank or interfaces. I replace extends ${super_class} with empty string. But I get extra spaces. So a class with no super_class and interfaces end up like : public class Foo { //see the extra spaces before {? ${class_body} } I know I can replace multiple spaces with single, but is there any better approach?

    Read the article

  • Transforming a string to a valid PDO_MYSQL DSN

    - by Alix Axel
    What is the most concise way to transform a string in the following format: mysql:[/[/]][user[:pass]@]host[:port]/db[/] Into a usuable PDO connection/instance (using the PDO_MYSQL DSN), some possible examples: $conn = new PDO('mysql:host=host;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user'); $conn = new PDO('mysql:host=host;port=3307;dbname=db', 'user', 'pass'); I've been trying some regular expressions (preg_[match|split|replace]) but they either don't work or are too complex, my gut tells me this is not the way to go but nothing else comes to my mind. Any suggestions?

    Read the article

  • PHP String tokenizer not working correctly

    - by asdadas
    I have no clue why strtok decided to break on me. Here is my code. I am tokenizing a string by dollar symbol $. echo 'Tokenizing this by $: ',$aliases,PHP_EOL; if(strlen($aliases) > 0) { //aliases check $token = strtok($aliases, '$'); while($token != NULL) { echo 'Found a token: ',$token,PHP_EOL; if(!isGoodLookup($token)) { echo 'ERROR: Invalid alias found.',PHP_EOL; stop($db); } $goodAliasesList[] = $token; $token = strtok('$'); } if($token == NULL) echo 'Found null token, moving on',PHP_EOL; } And this is my output: Tokenizing this by $: getaways$aaa Found a token: getaways Found null token, moving on str tok is not supposed to do this!! where is my aaa token!!

    Read the article

  • Finding multiple values in a string Jquery / Javascript

    - by user257503
    I have a three strings of categories "SharePoint,Azure,IT"; "BizTalk,Finance"; "SharePoint,Finance"; I need to find a way to check if a string contains for example "SharePoint" and "IT", or "BizTalk" and "Finance". The tests are individual strings themselces. How would i loop through all the category strings (1 - 3) and only return the ones which have ALL instances of the souce. i have tried the following function doesExist(source, filterArray) { var substr = filterArray.split(" "); jQuery.each(substr, function() { var filterTest = this; if(source.indexOf(filterTest) != -1 ) { alert("true"); return true; }else { alert("false"); return false; } }); } with little success...the code above checks one at a time rather than both so the results returned are incorrect. Any help would be great. Thanks Chris UPDATE: here is a link to a work in progress version..http://www.invisiblewebdesign.co.uk/temp/filter/#

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Hash Digest / Array Comparison in C#

    - by Erik Karulf
    Hi All, I'm writing an application that needs to verify HMAC-SHA256 checksums. The code I currently have looks something like this: static bool VerifyIntegrity(string secret, string checksum, string data) { // Verify HMAC-SHA256 Checksum byte[] key = System.Text.Encoding.UTF8.GetBytes(secret); byte[] value = System.Text.Encoding.UTF8.GetBytes(data); byte[] checksum_bytes = System.Text.Encoding.UTF8.GetBytes(checksum); using (var hmac = new HMACSHA256(key)) { byte[] expected_bytes = hmac.ComputeHash(value); return checksum_bytes.SequenceEqual(expected_bytes); } } I know that this is susceptible to timing attacks. Is there a message digest comparison function in the standard library? I realize I could write my own time hardened comparison method, but I have to believe that this is already implemented elsewhere.

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • EBS Seed Data Comparison Reports Now Available

    - by Steven Chan (Oracle Development)
    Earlier this year we released a reporting tool that reports on the differences in E-Business Suite database objects between one release and another.  That's a very useful reference, but EBS defaults are delivered as seed data within the database objects themselves. What about the differences in this seed data between one release and another? I'm pleased to announce the availability of a new tool that provides comparison reports of E-Business Suite seed data between EBS 11.5.10.2, 12.0.4, 12.0.6, 12.1.1, and 12.1.3.  This new tool complements the information in the data model comparison tool.  You can download the new seed data comparison tool here: EBS ATG Seed Data Comparison Report (Note 1327399.1) The EBS ATG Seed Data Comparison Report provides report on the changes between different EBS releases based upon the seed data changes delivered by the product data loader files (.ldt extension) based on EBS ATG loader control (.lct extension) files.  You can use this new tool to report on the differences in the following types of seed data: Concurrent Program definitions Descriptive Flexfield entity definitions Application Object Library profile option definitions Application Object Library (AOL) key flexfield, function, lookups, value set definitions Application Object Library (AOL) menu and responsibility definitions Application Object Library messages Application Object Library request set definitions Application Object Library printer styles definitions Report Manager / WebADI component and integrator entity definitions Business Intelligence Publisher (BI Publisher) entity definitions BIS Request Set Generator entity definitions ... and more Your feedback is welcomeThis new tool was produced by our hard-working EBS Release Management team, and they're actively seeking your feedback.  Please feel free to share your experiences with it by posting a comment here.  You can also request enhancements to this tool via the distribution list address included in Note 1327399.1.Related Articles Oracle E-Business Suite Release 12.1.3 Now Available New Whitepaper: Upgrading EBS 11i Forms + OA Framework Personalizations to EBS 12 EBS 12.0 Minimum Requirements for Extended Support Finalized Five Key Resources for Upgrading to E-Business Suite Release 12 E-Business Suite Release 12.1.1 Consolidated Upgrade Patch 1 Now Available New Whitepaper: Planning Your E-Business Suite Upgrade from Release 11i to 12.1

    Read the article

  • Use Your Android Phone to Comparison Shop: 4 Scanner Apps Reviewed

    - by Jason Fitzpatrick
    A smart phone in your pocket is great for on the go news, web browsing, and—of course—mobile gaming. It’s also fantastic for comparison shopping. Today we take a look at four Android scanners and price comparison engines. It’s quite a neat time to be a consumer. Historically if you wanted to do serious price comparisons you had to haul yourself around town, gather flyers from the newspapers, and otherwise invest way too much energy into potential savings that might not even break into double digits. Now you can comparison shop with an ease that borders on magic: by simply pulling out your smart phone and scanning the barcode or typing in the name of the item you wish to compare. Today we’re taking a look at some of the more popular and powerful barcode scanners and price comparison engines available for the Android platform. Before we get to that, a word on our methodology. To test the barcode scanners and the resulting search results we wandered around and rounded up some relatively random items from around the How-To Geek offices. This included a children’s graphic novel, a Wii game, a board game, a pack of razors, a box of tea, and a bottle of nail polish. It’s a decent spread of consumer items that covers several genres. For each application we scanned all the items, looked for the best price at the time, and noted any other relevant benefits of using one scanner over another. It’s worth noting that our primary focus was on the speed and ease of use. You may find that certain scanners have specific features that best suit your needs. What we focused on was how fast you could scan, compare prices, and purchase items if you desired. Since all the scanners are free-as-in-beer, feel free to download them all and run your own tests to confirm our conclusions. Use Your Android Phone to Comparison Shop: 4 Scanner Apps Reviewed How to Run Android Apps on Your Desktop the Easy Way HTG Explains: Do You Really Need to Defrag Your PC?

    Read the article

  • Remove characters after specific character in string, then remove substring?

    - by sah302
    I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • String formatting error

    - by wrongusername
    Using the code print('{0} is not'.format('That that is not')) in Python 3.1.1, I get the following error: AttributeError: 'str' object has no attribute 'format' when I delete the line Netbeans automatically inserted at the beginning: from distutils.command.bdist_dumb import format which itself causes an error of ImportError: cannot import name format What am I doing wrong here?

    Read the article

  • How to replace round bracket tag in javascript string

    - by tomaszs
    I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

    Read the article

  • Problem with Replacing special characters in a string

    - by Hossein
    Hi, I am trying to feed some text to a special pupose parser. The problem with this parser is that it is sensitive to ()[] characters and in my sentence in the text have quite a lot of these characters. The manual for the parser suggests that all the ()[] get replaced with \( \) \[ \]. So using str.replace i am using to attach \ to all of those charcaters. I use the code below: a = 'abcdef(1234)' a.replace('(','\(') however i get this as my output: 'abcdef\\(1234)' What is wrong with my code? can anyone provide me a solution to solve this for these characters?

    Read the article

  • Replacing substring in a string

    - by user177785
    I am uploading a image file to the server. Now after uploading the file to the server I need to rename the file with an id, but the extension of the file should be retained. Eg: if I upload the file image1.png then my server script should retain the extension .png. But I need to change the substring to some other substring (primary key of db). image1.png should be renamed to 123.png image2.jpg should be renamed to somevalue.jpg The image can be of any extension like .png, .jpg, .jpeg etc. I want to rename then in such a way that the image/file extension should be retained.

    Read the article

  • String to array or Array to string tips on formats, etc

    - by user316841
    hi, first of all thanks for taking your time! I'm a junior Dev, working with PHP + mysql. My issue: I'm saving data from a form to my database. From this form, there's only need to save the contacts: Name, phone number, address. But, it would be nice to have a small reference to the user answers. Let's say for each question we've got a value betwee 1 and 4. Since there's no need to create a table just for it, because what's needed is just the personal contacts. I'm thinking of recording each question/answer, as a letter and its correspondent value. Example (A2, B1, C5, D3, etc). My question is: Is there a format I could afterwards, handle easily ? Convert to array (string to array) in case the client change ideas, and ask this data, placed in table columns ? Just to prevent this situation! Example, From (A2, B1, C5 ) to array( "A" = "1", "B" = "1", "C" = "5" ) For now I guess, Regex is the answer, but it's allways hard to figure it out and I'm allways getting in troubles =) Thanks!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >