Search Results

Search found 37183 results on 1488 pages for 'string conversion'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 7/1488 | < Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • javascript arrays and type conversion inconsistencies

    - by ForYourOwnGood
    I have been playing with javascript arrays and I have run into, what I feel, are some inconsistencies, I hope someone can explain them for me. Lets start with this: var myArray = [1, 2, 3, 4, 5]; document.write("Length: " + myArray.length + "<br />"); for( var i in myArray){ document.write( "myArray[" + i + "] = " + myArray[i] + "<br />"); } document.write(myArray.join(", ") + "<br /><br />"); Length: 5 myArray[0] = 1 myArray[1] = 2 myArray[2] = 3 myArray[3] = 4 myArray[4] = 5 1, 2, 3, 4, 5 There is nothing special about this code, but I understand that a javascript array is an object, so properities may be add to the array, the way these properities are added to an array seems inconsistent to me. Before continuing, let me note how string values are to be converted to number values in javascript. Nonempty string - Numeric value of string or NaN Empty string - 0 So since a javascript array is an object the following is legal: myArray["someThing"] = "someThing"; myArray[""] = "Empty String"; myArray["4"] = "four"; for( var i in myArray){ document.write( "myArray[" + i + "] = " + myArray[i] + "<br />"); } document.write(myArray.join(", ") + "<br /><br />"); Length: 5 myArray[0] = 1 myArray[1] = 2 myArray[2] = 3 myArray[3] = 4 myArray[4] = four myArray[someThing] = someThing myArray[] = Empty String 1, 2, 3, 4, four The output is unexpected. The non empty string "4" is converted into its numeric value when setting the property myArray["4"], this seems right. However the empty string "" is not converted into its numeric value, 0, it is treated as an empty string. Also the non empty string "something" is not converted to its numeric value, NaN, it is treated as a string. So which is it? is the statement inside myArray[] in numeric or string context? Also, why are the two, non numeric, properities of myArray not included in myArray.length and myArray.join(", ")?

    Read the article

  • Is using the .NET Image Conversion enough?

    - by contactmatt
    I've seen a lot of people try to code their own image conversion techniques. It often seems to be very complicated, and ends up using GDI+ function calls, and manipulating bits of the image. This has got me wondering if I am missing something in the simplicity of .NET's image conversion call when saving an image. Here's the code I have: Bitmap tempBmp = new Bitmap("c:\temp\img.jpg"); Bitmap bmp = new Bitmap(tempBmp, 800, 600); bmp.Save(c:\temp\img.bmp, //extension depends on format ImageFormat.Bmp) //These are all the ImageFormats I allow conversion to within the program. Ignore the syntax for a second ;) ImageFormat.Gif) //or ImageFormat.Jpeg) //or ImageFormat.Png) //or ImageFormat.Tiff) //or ImageFormat.Wmf) //or ImageFormat.Bmp)//or ); This is all I'm doing in my image conversion. Just setting the location of where the image should be saved, and passing it an ImageFormat type. I've tested it the best I can, but I'm wondering if I am missing anything in this simple format conversion, or if this is sufficient?

    Read the article

  • C# collection/string .Contains vs collection/string.IndexOf

    - by Daniel
    Is there a reason to use .Contains on a string/list instead of .IndexOf? Most code that I would write using .Contains would shortly after need the index of the item and therefore would have to do both statements. But why not both in one? if ((index = blah.IndexOf(something) = 0) // i know that Contains is true and i also have the index

    Read the article

  • Finding substring of a word found in joining a string from another string

    - by 2er0
    Given a list of words, L, that are all the same length, and a string, S, find the starting position of the substring of S that is a concatenation of each word in L exactly once and without any intervening characters. This substring will occur exactly once in S. Example: L: "fooo", "barr", "wing", "ding", "wing" S: "lingmindraboofooowingdingbarrwingmonkeypoundcake" Word found in joining L and also found in S: "fooowingdingbarrwing" Answer: 13 L: "mon", "key" S: "monkey Word found in joining L and also found in S: "monkey Answer: 0 L: "a", "b", "c", "d", "e" S: "abcdfecdba" Word found in joining L and also found in S: "ecdba Answer: 5

    Read the article

  • Remove characters after specific character in string, then remove substring?

    - by sah302
    I feel kind of dumb posting this when this seems kind of simple and there are tons of questions on strings/characters/regex, but I couldn't find quite what I needed (except in another language: http://stackoverflow.com/questions/2176544/remove-all-text-after-certain-point). I've got the following code: [Test] public void stringManipulation() { String filename = "testpage.aspx"; String currentFullUrl = "http://localhost:2000/somefolder/myrep/test.aspx?q=qvalue"; String fullUrlWithoutQueryString = currentFullUrl.Replace("?.*", ""); String urlWithoutPageName = fullUrlWithoutQueryString.Remove(fullUrlWithoutQueryString.Length - filename.Length); String expected = "http://localhost:2000/somefolder/myrep/"; String actual = urlWithoutPageName; Assert.AreEqual(expected, actual); } I tried the solution in the question above (hoping the syntax would be the same!) but nope. I want to first remove the queryString which could be any variable length, then remove the page name, which again could be any length. How can I get the remove the query string from the full URL such that this test passes?

    Read the article

  • How to extract specific variables from a string?

    - by David
    Hi, let's say i have the following: $vars="name=david&age=26&sport=soccer&birth=1984"; I want to turn this into real php variables but not everything. By example, the functions that i need : $thename=getvar($vars,"name"); $theage=getvar($vars,"age"); $newvars=cleanup($vars,"name,age"); // Output $vars="name=david&age=26" How can i get only the variables that i need . And how i clean up the $vars from the other variables if possible? Thanks

    Read the article

  • String formatting error

    - by wrongusername
    Using the code print('{0} is not'.format('That that is not')) in Python 3.1.1, I get the following error: AttributeError: 'str' object has no attribute 'format' when I delete the line Netbeans automatically inserted at the beginning: from distutils.command.bdist_dumb import format which itself causes an error of ImportError: cannot import name format What am I doing wrong here?

    Read the article

  • How to replace round bracket tag in javascript string

    - by tomaszs
    I have trouble with changing round bracket tag in Javascript. I try to do this: var K = 1; var Text = "This a value for letter K: {ValueOfLetterK}"; Text = Text.replace("{ValueOfLetterK}", K); and after that I get: Text = "This a value for letter K: {ValueOfLetterK}" What can be done to make this work? When I remove round brackets it works fine.

    Read the article

  • Problem with Replacing special characters in a string

    - by Hossein
    Hi, I am trying to feed some text to a special pupose parser. The problem with this parser is that it is sensitive to ()[] characters and in my sentence in the text have quite a lot of these characters. The manual for the parser suggests that all the ()[] get replaced with \( \) \[ \]. So using str.replace i am using to attach \ to all of those charcaters. I use the code below: a = 'abcdef(1234)' a.replace('(','\(') however i get this as my output: 'abcdef\\(1234)' What is wrong with my code? can anyone provide me a solution to solve this for these characters?

    Read the article

  • Replacing substring in a string

    - by user177785
    I am uploading a image file to the server. Now after uploading the file to the server I need to rename the file with an id, but the extension of the file should be retained. Eg: if I upload the file image1.png then my server script should retain the extension .png. But I need to change the substring to some other substring (primary key of db). image1.png should be renamed to 123.png image2.jpg should be renamed to somevalue.jpg The image can be of any extension like .png, .jpg, .jpeg etc. I want to rename then in such a way that the image/file extension should be retained.

    Read the article

  • SQL SERVER – Automated Type Conversion using Expressor Studio

    - by pinaldave
    Recently I had an interesting situation during my consultation project. Let me share to you how I solved the problem using Expressor Studio. Consider a situation in which you need to read a field, such as customer_identifier, from a text file and pass that field into a database table. In the source file’s metadata structure, customer_identifier is described as a string; however, in the target database table, customer_identifier is described as an integer. Legitimately, all the source values for customer_identifier are valid numbers, such as “109380”. To implement this in an ETL application, you probably would have hard-coded a type conversion function call, such as: output.customer_identifier=stringToInteger(input.customer_identifier) That wasn’t so bad, was it? For this instance, programming this hard-coded type conversion function call was relatively easy. However, hard-coding, whether type conversion code or other business rule code, almost always means that the application containing hard-coded fields, function calls, and values is: a) specific to an instance of use; b) is difficult to adapt to new situations; and c) doesn’t contain many reusable sub-parts. Therefore, in the long run, applications with hard-coded type conversion function calls don’t scale well. In addition, they increase the overall level of effort and degree of difficulty to write and maintain the ETL applications. To get around the trappings of hard-coding type conversion function calls, developers need an access to smarter typing systems. Expressor Studio product offers this feature exactly, by providing developers with a type conversion automation engine based on type abstraction. The theory behind the engine is quite simple. A user specifies abstract data fields in the engine, and then writes applications against the abstractions (whereas in most ETL software, developers develop applications against the physical model). When a Studio-built application is run, Studio’s engine automatically converts the source type to the abstracted data field’s type and converts the abstracted data field’s type to the target type. The engine can do this because it has a couple of built-in rules for type conversions. So, using the example above, a developer could specify customer_identifier as an abstract data field with a type of integer when using Expressor Studio. Upon reading the string value from the text file, Studio’s type conversion engine automatically converts the source field from the type specified in the source’s metadata structure to the abstract field’s type. At the time of writing the data value to the target database, the engine doesn’t have any work to do because the abstract data type and the target data type are just the same. Had they been different, the engine would have automatically provided the conversion. ?Reference: Pinal Dave (http://blog.SQLAuthority.com) Filed under: Database, Pinal Dave, SQL, SQL Authority, SQL Query, SQL Scripts, SQL Server, SQL Tips and Tricks, SQLAuthority News, T SQL, Technology Tagged: SSIS

    Read the article

  • String to array or Array to string tips on formats, etc

    - by user316841
    hi, first of all thanks for taking your time! I'm a junior Dev, working with PHP + mysql. My issue: I'm saving data from a form to my database. From this form, there's only need to save the contacts: Name, phone number, address. But, it would be nice to have a small reference to the user answers. Let's say for each question we've got a value betwee 1 and 4. Since there's no need to create a table just for it, because what's needed is just the personal contacts. I'm thinking of recording each question/answer, as a letter and its correspondent value. Example (A2, B1, C5, D3, etc). My question is: Is there a format I could afterwards, handle easily ? Convert to array (string to array) in case the client change ideas, and ask this data, placed in table columns ? Just to prevent this situation! Example, From (A2, B1, C5 ) to array( "A" = "1", "B" = "1", "C" = "5" ) For now I guess, Regex is the answer, but it's allways hard to figure it out and I'm allways getting in troubles =) Thanks!

    Read the article

  • SQL SERVER – Find First Non-Numeric Character from String

    - by pinaldave
    It is fun when you have to deal with simple problems and there are no out of the box solution. I am sure there are many cases when we needed the first non-numeric character from the string but there is no function available to identify that right away. Here is the quick script I wrote down using PATINDEX. The function PATINDEX exists for quite a long time in SQL Server but I hardly see it being used. Well, at least I use it and I am comfortable using it. Here is a simple script which I use when I have to identify first non-numeric character. -- How to find first non numberic character USE tempdb GO CREATE TABLE MyTable (ID INT, Col1 VARCHAR(100)) GO INSERT INTO MyTable (ID, Col1) SELECT 1, '1one' UNION ALL SELECT 2, '11eleven' UNION ALL SELECT 3, '2two' UNION ALL SELECT 4, '22twentytwo' UNION ALL SELECT 5, '111oneeleven' GO -- Use of PATINDEX SELECT PATINDEX('%[^0-9]%',Col1) 'Position of NonNumeric Character', SUBSTRING(Col1,PATINDEX('%[^0-9]%',Col1),1) 'NonNumeric Character', Col1 'Original Character' FROM MyTable GO DROP TABLE MyTable GO Here is the resultset: Where do I use in the real world – well there are lots of examples. In one of the future blog posts I will cover that as well. Meanwhile, do you have any better way to achieve the same. Do share it here. I will write a follow up blog post with due credit to you. Reference : Pinal Dave (http://blog.SQLAuthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Function, SQL Query, SQL Server, SQL String, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • String Length Evaluating Incorrectly

    - by Justin R.
    My coworker and I are debugging an issue in a WCF service he's working on where a string's length isn't being evaluated correctly. He is running this method to unit test a method in his WCF service: // Unit test method public void RemoveAppGroupTest() { string addGroup = "TestGroup"; string status = string.Empty; string message = string.Empty; appActiveDirectoryServicesClient.RemoveAppGroup("AOD", addGroup, ref status, ref message); } // Inside the WCF service [OperationBehavior(Impersonation = ImpersonationOption.Required)] public void RemoveAppGroup(string AppName, string GroupName, ref string Status, ref string Message) { string accessOnDemandDomain = "MyDomain"; RemoveAppGroupFromDomain(AppName, accessOnDemandDomain, GroupName, ref Status, ref Message); } public AppActiveDirectoryDomain(string AppName, string DomainName) { if (string.IsNullOrEmpty(AppName)) { throw new ArgumentNullException("AppName", "You must specify an application name"); } } We tried to step into the .NET source code to see what value string.IsNullOrEmpty was receiving, but the IDE printed this message when we attempted to evaluate the variable: 'Cannot obtain value of local or argument 'value' as it is not available at this instruction pointer, possibly because it has been optimized away.' (None of the projects involved have optimizations enabled). So, we decided to try explicitly setting the value of the variable inside the method itself, immediately before the length check -- but that didn't help. // Lets try this again. public AppActiveDirectoryDomain(string AppName, string DomainName) { // Explicitly set the value for testing purposes. AppName = "AOD"; if (AppName == null) { throw new ArgumentNullException("AppName", "You must specify an application name"); } if (AppName.Length == 0) { // This exception gets thrown, even though it obviously isn't a zero length string. throw new ArgumentNullException("AppName", "You must specify an application name"); } } We're really pulling our hair out on this one. Has anyone else experienced behavior like this? Any tips on debugging it?

    Read the article

  • PHP mySQL - replace some string inside string

    - by apis17
    i want to replace ALL comma , into ,<space> in all address table in my mysql table. For example, +----------------+----------------+ | Name | Address | +----------------+----------------+ | Someone name | A1,Street Name | +----------------+----------------+ Into +----------------+----------------+ | Name | Address | +----------------+----------------+ | Someone name | A1, Street Name| +----------------+----------------+ Thanks in advance.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 3 4 5 6 7 8 9 10 11 12 13 14  | Next Page >