Search Results

Search found 212 results on 9 pages for 'tel'.

Page 7/9 | < Previous Page | 3 4 5 6 7 8 9  | Next Page >

  • i need some help with my vb.net codes..plzz

    - by akmalizhar
    currently i need to develop an application that can exctract information from few website.. this is what i have done up until now.. Imports System Imports System.Text.RegularExpressions Imports System.IO Imports System.Net Imports System.Web Imports System.Data.SqlClient Imports System.Threading Imports System.Data.DataSet Imports System.Data.OleDb Module module1 Dim url As String Dim hotelName As String = "" Sub Main() Dim url As String = "" Console.Write("enter url: ") url = Console.ReadLine() extractor(url) End Sub Public Sub extractor(ByVal url As String) Dim strConn As String = "Data Source = localhost; Initial Catalog = knowledgeBase; Integrated Security = True; Connection Timeout = 0;" Dim conn As SqlConnection = New SqlConnection(strConn) conn.Open() Dim strSQL1 As String Dim matchStn1 As String = "" Dim matchstn2 As String = "" Dim matchstn3 As String = "" Dim matchstn4 As String = "" Dim matchstn5 As String = "" Dim matchstn6 As String = "" Dim matchstn7 As String = "" Dim matchstn8 As String = "" Dim matchstn9 As String = "" Dim matchstn10 As String = "" Dim objRequest As WebRequest = HttpWebRequest.Create(url) Dim objResponse As WebResponse = objRequest.GetResponse() Dim objStreamReader As New StreamReader(objResponse.GetResponseStream()) Dim strpage As String = objStreamReader.ReadToEnd Dim RegExStr As String = "<[^>]*>" Dim R As New Regex(RegExStr) Dim sourcestring As String = strpage Dim re As Regex = New Regex("<h2 class=""name hotel""[^>]*>[\s\S]+?</h2>") Dim mc As MatchCollection = re.Matches(sourcestring) Dim mIdx As Integer = 0 For Each m As Match In mc For groupIdx As Integer = 0 To m.Groups.Count - 1 matchStn1 = m.Groups(groupIdx).Value matchStn1 = R.Replace(matchStn1, " ") matchStn1 = matchStn1.Trim() Next mIdx = mIdx + 1 Next Dim re9 As Regex = New Regex("<li class=""cuisine""[^>]*>[^>]+</li>") Dim mc9 As MatchCollection = re9.Matches(sourcestring) Dim mIdx9 As Integer = 0 For Each m As Match In mc9 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn9 = m.Groups(groupIdx).Value matchstn9 = R.Replace(matchstn9, " ") matchstn9 = matchstn9.Trim() Next mIdx = mIdx + 1 Next Dim re2 As Regex = New Regex("<span class=""street-address""[^>]*>[^>]+</span>") Dim mc2 As MatchCollection = re2.Matches(sourcestring) Dim mIdx2 As Integer = 0 For Each m As Match In mc2 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn2 = m.Groups(groupIdx).Value matchstn2 = R.Replace(matchstn2, " ") matchstn2 = matchstn2.Trim() Next mIdx2 = mIdx2 + 1 Next Dim re3 As Regex = New Regex("<span class=""locality""[^>]*>[\s\S]+?</span>") Dim mc3 As MatchCollection = re3.Matches(sourcestring) Dim mIdx3 As Integer = 0 For Each m As Match In mc3 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn3 = m.Groups(groupIdx).Value matchstn3 = R.Replace(matchstn3, " ") matchstn3 = matchstn3.Trim() Next mIdx3 = mIdx3 + 1 Next Dim re4 As Regex = New Regex("<span property=""v:postal-code""[^>]*>[\s\S]+?</span>") Dim mc4 As MatchCollection = re4.Matches(sourcestring) Dim mIdx4 As Integer = 0 For Each m As Match In mc4 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn4 = m.Groups(groupIdx).Value matchstn4 = R.Replace(matchstn4, " ") matchstn4 = matchstn4.Trim() Next mIdx4 = mIdx4 + 1 Next Dim re5 As Regex = New Regex("<span class=""country-name""[^>]*>[\s\S]+?</span>") Dim mc5 As MatchCollection = re5.Matches(sourcestring) Dim mIdx5 As Integer = 0 For Each m As Match In mc5 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn5 = m.Groups(groupIdx).Value matchstn5 = R.Replace(matchstn5, " ") matchstn5 = matchstn5.Trim() Next mIdx5 = mIdx5 + 1 Next Dim re10 As Regex = New Regex("<address class=""adr""[^>]*>[\s\S]+?</address>") Dim mc10 As MatchCollection = re10.Matches(sourcestring) Dim mIdx10 As Integer = 0 For Each m As Match In mc10 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn10 = m.Groups(groupIdx).Value matchstn10 = R.Replace(matchstn10, " ") matchstn10 = matchstn10.Trim() strSQL1 = "insert into infoRestaurant (nameRestaurant, cuisine, streetAddress, locality, postalCode, countryName, addressFull, tel, attractionType) values (N" & _ FormatSqlParam(matchStn1) & ",N" & _ FormatSqlParam(matchstn9) & ",N" & _ FormatSqlParam(matchstn2) & ",N" & _ FormatSqlParam(matchstn3) & ",N" & _ FormatSqlParam(matchstn4) & ",N" & _ FormatSqlParam(matchstn5) & ",N" & _ FormatSqlParam(matchstn10) & ",N" & _ FormatSqlParam(matchstn6) & ",N" & _ FormatSqlParam(matchstn7) & ")" Dim objCommand1 As New SqlCommand(strSQL1, conn) objCommand1.ExecuteNonQuery() Next mIdx4 = mIdx4 + 1 Next Dim re6 As Regex = New Regex("<span class=""tel""[^>]*>[\s\S]+?</span>") Dim mc6 As MatchCollection = re6.Matches(sourcestring) Dim mIdx6 As Integer = 0 For Each m As Match In mc6 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn6 = m.Groups(groupIdx).Value matchstn6 = R.Replace(matchstn6, " ") matchstn6 = matchstn6.Trim() Next mIdx6 = mIdx6 + 1 Next Dim re7 As Regex = New Regex("<div><b>Attraction type:[^>]*>[\s\S]+?</div>") Dim mc7 As MatchCollection = re7.Matches(sourcestring) Dim mIdx7 As Integer = 0 For Each m As Match In mc7 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn7 = m.Groups(groupIdx).Value matchstn7 = R.Replace(matchstn7, " ") matchstn7 = matchstn7.Trim() Next mIdx7 = mIdx7 + 1 Next Dim re8 As Regex = New Regex("(?=<p id).*(?<=</p>)") Dim mc8 As MatchCollection = re8.Matches(sourcestring) Dim mIdx8 As Integer = 0 For Each m As Match In mc8 For groupIdx As Integer = 0 To m.Groups.Count - 1 matchstn8 = m.Groups(groupIdx).Value matchstn8 = R.Replace(matchstn8, " ") matchstn8 = matchstn8.Trim() Dim strSQL2 As String = "insert into feedBackRestaurant (feedBackView) values(N" + FormatSqlParam(matchstn8) + ")" Dim objCommand2 As New SqlCommand(strSQL2, conn) objCommand2.ExecuteNonQuery() Next mIdx8 = mIdx8 + 1 Next objStreamReader.Close() conn.Close() End Sub Public Function FormatSqlParam(ByVal strParam As String) As String Dim newParamFormat As String If strParam = String.Empty Then newParamFormat = "'" & "NA" & "'" Else newParamFormat = strParam.Trim() newParamFormat = "'" & newParamFormat.Replace("'", "''") & "'" End If Return newParamFormat End Function End Module ---problems-- problem that i face are 1. the database foreign key is not working here..someone told me that need some codes to be added..but i dunno how. 2. the data repeats as i run the application. i guest it require update database function.but i hv no idea how. 3. i have to add in multithreading function as well..and last, how to make my application is flexible eventhough the HTML code changes..can anyone help me??plzzz website that i need to extract is http://www.tripadvisor.com/Tourism-g293951-Malaysia-Vacations.html i need the information about hotel, restaurant and attraction place..plzz..i need some help here..

    Read the article

  • Net Neutrality FAIL [closed]

    - by leeand00
    I know I'll get into all kinds of trouble for bringing this up on SO, but considering that nearly all of us programmers depend on the Internet to get our jobs done, I really think it's worth looking into today's failure of our right to use the Internet by way of Lobbying ISPs. Although something tells me there will be retribution for the actions of the ISPs/tel cos/cable and their lobbyist since, lets face it...ISPs/Telcos didn't invent the Internet. I'm not going to be the one to do it, but um I think somebody already has...as everybody I talked to was having Internet connection problems today at work. Just thought this might be relevant to all of our jobs...in the U.S.A. at least. If you work at an Big evil ISPs, by all means...try and close this question. If you don't...and your just a chap who enjoys your Internet access...please RT this: Contact The Democrats Who Are Against Net Neutrality (Full List W/ Contact Info) http://bit.ly/aMSV0W #NetNeutralityFAIL net-neutrality

    Read the article

  • How to get Field Labels from PIMItem - Blackberry

    - by Taha
    How can we get Field Labels from PIMItem. The following code is with PIMList String label = pimList.getAttributeLabel(blackBerryContact.getAttributes(Contact.TEL, i)); But i have PIMItem. There is a method PIMItem.getPIMList() which returns null for me in the code below. THE API at http://www.blackberry.com/developers/docs/5.0.0api/index.html says "getPIMList() Gets the PIMList associated with this item." Below is sample code that i am trying to achive - // Load the address Book and allow the user to select a contact BlackBerryContactList contactList = (BlackBerryContactList) PIM.getInstance().openPIMList(PIM.CONTACT_LIST,PIM.READ_ONLY); PIMItem userSelectedContact = contactList.choose(); // Now get the Field labels for contact numbers for userSelectedContact

    Read the article

  • How to block the possibility to add the same record to a SPList?

    - by truthseeker
    Hi, Is there a possibility to block chance to add the same data to SPList? I know that two records always are different regarding the ID field. I would like to validate other custom fields added previously by me, and don't allow of adding same field's value. Can anybody tell me how to implement this? I can guess that event receivers could be the answer but I couldn't find how to add a receiver to SPList. Can anybody tel me If I'm right and what is step by step procedure to add such event receiver? I would like to know how to build it and install it using Feature file. Best Regards T.S.

    Read the article

  • get data from to tables !

    - by mehdi
    i want to sort my users based on most viewed profile in my user list . i have these two tables but i don't know how to right correct query to make this happen . i used grouping like this : $sql ="select userid , count(*) form profile_visit group by userid " ; but it's not make sense to me , i don't think this query will help me at all . +-----------+---------------+------+-----+-------------------+----------------+ | Field | Type | Null | Key | Default | Extra | +-----------+---------------+------+-----+-------------------+----------------+ | userid | int(11) | NO | PRI | NULL | auto_increment | | username | varchar(128) | NO | | NULL | | | password | char(40) | NO | | NULL | | | email | varchar(128) | NO | | NULL | | | name | varchar(256) | NO | | NULL | | | lastname | varchar(256) | NO | | NULL | | | job | varchar(256) | NO | | NULL | | | birthdate | varchar(100) | NO | | NULL | | | address | varchar(1024) | NO | | NULL | | | website | varchar(100) | NO | | NULL | | | tel | varchar(100) | NO | | NULL | | | role | tinyint(1) | NO | | 0 | | | reg_date | timestamp | NO | | CURRENT_TIMESTAMP | | +-----------+---------------+------+-----+-------------------+----------------+ and profile_visit table like this +------------+-------------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------+-------------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | ip_address | varchar(70) | NO | | NULL | | | userid | int(11) | NO | | NULL | | +------------+-------------+------+-----+---------+----------------+

    Read the article

  • UIActionSheet Cancel button keeps crashing my app

    - by user337174
    I am really puzzeled by this one. I have set up two UIActionSheets in my application. They work perfectly fine until you use the cancel button in the UIActionSheets. When i navigate away from the page the UIAactionSheet returns too it crashes my app. Does anyone have any ideas as too why? -(IBAction) phoneButtonClicked:(id)sender { // open a dialog with just an OK button phoneActionSheet = [[UIActionSheet alloc] initWithTitle:nil delegate:self cancelButtonTitle:@"Cancel" destructiveButtonTitle:nil otherButtonTitles:[NSString stringWithFormat:@"Phone: %@",phone],nil]; phoneActionSheet.actionSheetStyle = UIActionSheetStyleDefault; [phoneActionSheet showInView:self.view]; // show from our table view (pops up in the middle of the table) [phoneActionSheet release]; } -(void)actionSheet:(UIActionSheet *)actionSheet clickedButtonAtIndex:(NSInteger)buttonIndex { if (actionSheet == phoneActionSheet) { if(buttonIndex == 0){ NSString *callPhone = [NSString stringWithFormat:@"tel:%@",phone]; NSLog(@"Calling: %@", callPhone); [[UIApplication sharedApplication] openURL:[NSURL URLWithString:callPhone]]; } } }

    Read the article

  • How to get jSon object in servlet from jsp?

    - by divi
    In jsp page i have written: var sel = document.getElementById("Wimax"); var ip = sel.options[sel.selectedIndex].value; var param; var url = 'ConfigurationServlet?ActionID=Configuration_Physical_Get'; httpRequest = new ActiveXObject("Microsoft.XMLHTTP"); httpRequest.open("POST", url, true); httpRequest.onreadystatechange = handler(){ if (httpRequest.readyState == 4) { if (httpRequest.status == 200) { param = 'ip='+ip; param += 'mmv='+mmv; param += "tab="+tab; }}; httpRequest.send(param); i want this param variable in my configurationServlet. Can any one tel me how to get this json object in servlet???

    Read the article

  • Is there a definitive list of uri patterns for use in android apps made by google?

    - by The Trav
    Apart from http://developer.android.com/guide/appendix/g-app-intents.html (which is quite good but fairly limited in the number of apps/uri's it covers) I've been unable to find a decent reference source for looking up URI's to use when integrating with google apps. I'm currently working on triggering the "add new contact" UI, and have found that the tel: uri pattern seems to work, but what if I only have a name and an email? I wouldn't have expected I'd need to rely on sample code / trial and error, but I really can't see anywhere where the intent/URI interface is supposed to be documented in android apps. Does such a standard exist? Is there some quasi standard / user database that I can consult? On a platform with such a good inter-interoperability architecture it just seems like something so useful I can't believe it's not there

    Read the article

  • how to load Module to control like panel , vbox etc +flex

    - by glory-grace
    Hi All, Im new to this flex. can anybody solve my problem.This is my query- i have home page divided into 3 part like top,left,middle positon. in middle postion -panel and combobox are there. i want to load my module to the middle positon like to panel. i have combobox, when i selected any item based on that im loading module to that panel using Custom moduleloader control.uptohere its working fine. my probelm, i selected one option from combobox. its showing the one module(sam1). when i click(sam1),it should open anothermodule(sam2) in same location(instead of sam1-sam2).so can u tel ur idea and how to resolve it.plz.

    Read the article

  • how to link static cells to Outlet/Actions - E.G tap the call cell to call the number

    - by holtii
    The code I have. By the way, I can't get Call to work and Website does not open either! - (void)tableView:(UITableView *)tableView didSelectRowAtIndexPath:(NSIndexPath *)indexPath { NSString *urlToOpen = @""; if( indexPath.section == 0 ){ // call number urlToOpen = @"tel:442074036933"; } else if( indexPath.section == 1 ){ // open website urlToOpen = @"http://www.designmuseum.org"; } else { // open address urlToOpen = @"http://maps.apple.com/maps?daddr=Design+Museum+London"; } [[UIApplication sharedApplication] openURL:[NSURL URLWithString:urlToOpen]]; NSString *destinationAddress = [NSString stringWithFormat:@"%@+%@+%@", [address street], [address city], [address country]]; NSString *sourceAddress = [LocalizedCurrentLocation currentLocationStringForCurrentLanguage]; NSString *url = [NSString stringWithFormat:@"http://maps.apple.com/maps?saddr=%@&daddr=%@", [sourceAddress stringByAddingPercentEscapesUsingEncoding:NSUTF8StringEncoding], [destinationAddress stringByAddingPercentEscapesUsingEncoding:NSUTF8StringEncoding]]; [[UIApplication sharedApplication] openURL:[NSURL URLWithString:url]]; I need to add destination address which for my App is = 28 Shad Thames, London, United Kingdom. Which format to write it in? because I cant get it to work and really need to sort this problem of my app real quick

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Change Wallpaper in windows mobile

    - by niks86
    Hello Friends, Hey im devloping application in that i want to set images as the wallpaper for that i written below code.when i used remote registry in registry value get updated but the wallpaper of the windows mobile does not changed.Can u plz tel me what i need to do. Here is my code. [DllImport("coredll.dll")] private static extern int SendMessage(IntPtr hWnd, uint msg, int wParam, int lParam); public const int HWND_BROADCAST = 0xffff; public const int WM_WININICHANGE = 0x001A; File.Copy(@"\My Documents\My Pictures\Album Sample_05.jpg", @"\My Documents\My Pictures\Album Sample_09.jpg", true); Registry.SetValue(@"HKEY_CURRENT_USER\Software\Microsoft\Today", "Wall", @"\My Documents\My Pictures\Album Sample_05.jpg"); SendMessage((IntPtr)HWND_BROADCAST, WM_WININICHANGE, 0xF2, 0); plz help me. Thanks.

    Read the article

  • Getting Data Specific to Logged in user

    - by user1770470
    I need to list logged in users active leads,and allow paging and selectable sorting, I cant use the grid because of the layout requirement. I have been searching the web for the last 2 days and cant find any viable solution Any help or direction would be greatly appreciated. var query = db.Query("SELECT a.listingId, a.datetime, c.details, c.buycommercial, c.buyindustrial, c.buyretail, c.buyland, c.tencommercial, c.tenindustrial, c.tenretail, c.tenland, c.investor, c.developer, d.companyname, d.firstname, d.lastname, d.tel, d.cell, d.email FROM dbo.tblactivebroker a JOIN dbo.tblActiveListing b ON a.ListingId = b.ListingId JOIN dbo.tblListings c ON b.ListingId = c.ListingId JOIN dbo.tblContact d ON c.crmid = d.id WHERE b.active = 'True' AND a.ActiveBrokerID = @0",brokerid);

    Read the article

  • What information about a user is available via PHP?

    - by Camran
    This is about a classifieds website, where anyone may post classifieds. I have a security database which I intend to fill with information about the user who posts the classifieds. I intend to record information such as IP, name, tel, email, classified_text, classified_title etc etc. The reason for all this is that sometimes people become victims of fraud (fake classifieds etc). So I wonder, what information is possible to get from the poster which may help in tracking him/her down? IP is a given, but what else could be useful? And I would much like examples of how it would be useful also, as well as the code for it please, like $_SERVER['REMOTE_ADDR']. And btw, I use PHP and have Sql as a database. Thanks

    Read the article

  • [Android] How to launch an Activity without a UI?

    - by fjmustak
    Is it in any way possible to launch an activity from the main function without having a UI? i.e. is there a way to create a sort of "wrapper" around another activity, i.e. by launching the main activity, it takes you to another activity automatically. If that is not possible, is there a way to remove the main activity from the stack so that clicking the back button does not take you to a blank UI? Here's an example of what I'm trying to do: public class WrapperActivity extends Activity { /** Called when the activity is first created. */ @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); final Intent intent = new Intent(Intent.ACTION_DIAL, Uri.parse("tel:555-1212")); startActivity(intent); } }

    Read the article

  • Twitter Bootstrap styling conflicts with plug-ins like jqGrid and other third part libraries

    - by Renso
    Issues:The concern is that the Twitter Bootstrap framework is that some of their css selectors are simply too generic and have incompatibility issues and conflicts with most third party plug-ins and css libraries, like jQuery-UI and jqGrid.My most pressing concern is only with the generic selector for the styling of "INPUT" controls.Some concerns:So basically anyone using BS (Bootstrap) will have to override styling 100% of the time on all input controls on all their web pages for all the plug-ins they use that render their own styling for input controls. This seems to chisel away any reason for using Bootstrap. Overriding Bootstrap css in this case seems illogical at best as it implies the BS styling is not correct or as granular as it is supposed to be. It also suggests you realize there is an issue here. Any person who has written a fair amount of css will realize that it is a mammoth task to to take an existing app, converting it to BS and then having to find all non-BS input controls and styling them all. The worst part is that there is no generic styling for this as each input control has a different source/context, some are regular tags and some belong to plug-ins, each with their own flavor of styling. For new web apps the challenge is not that different, each time you add a new plug-in you will have to test all facets of it, and I mean all of it, pop-ups, etc, that contain any kind of input control to make sure it is styled correctly. I am having a hard time seeing the benefits of BS in this context. So until the BS team addresses the issue, or not, you may be wondering what is the easiest solution.Help the community to drive this issue home by creating a new issue on github, see my entry here: https://github.com/twitter/bootstrap/issues/4008. As you can see I got some good and some negative feedback, but we all agree it is an issue. I do believe my solution below should be reverse compatible if the proper class declarations were followed as recommended by Bootstrap.The solution:Add a higher-level qualifier to the input selector, which may not break anything.  Add "control-group" and "controls" classes as higher-level selectors, as they have to be declared inside those classes anyway as far as I understand the design approach of BS. So in my example below can modify the css without possible breaking anything, see the css at the bottom. I tested this briefly and seems to render just as expected. May not be complete as I only spent a few minutes on the css. Your feedback will be greatly appreciated. <div class="control-group">    <label title="" for="Contact_FirstName" class="control-label">First Name</label>    <div class="controls">        <input type="text" value="" name="Contact.FirstName" id="Contact_FirstName" data-val-required="The Reader Contact&amp;#39;s First Name is required" data-val-length-min="2" data-val-length-max="250" data-val-length="The maximum length allowed for the Reader Contact&amp;#39;s First Name is 250 characters and must be two or more characters long" data-val="true" class="input-medium">        <span data-valmsg-replace="true" data-valmsg-for="Contact.FirstName" class="field-validation-valid"></span>    </div></div>Here are the SCSS (SASS) updates. In stead of just including the updates I decided to include the entire bootstrap SCSS file so you can just copy-and-paste it in stead of trying to figure out what selectors have changed./*! * Bootstrap v2.0.4 * Enhacement by Renso Hollhumer * Copyright 2012 Twitter, Inc * Licensed under the Apache License v2.0 * http://www.apache.org/licenses/LICENSE-2.0 * * Designed and built with all the love in the world @twitter by @mdo and @fat. * Enhancement by Renso Hollhumer: To isolate styling of INPUT tags to the Bootstrap context only */.clearfix {  *zoom: 1;}.clearfix:before,.clearfix:after {  display: table;  content: "";}.clearfix:after {  clear: both;}.hide-text {  font: 0/0 a;  color: transparent;  text-shadow: none;  background-color: transparent;  border: 0;}.input-block-level {  display: block;  width: 100%;  min-height: 28px;  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;}article,aside,details,figcaption,figure,footer,header,hgroup,nav,section {  display: block;}audio,canvas,video {  display: inline-block;  *display: inline;  *zoom: 1;}audio:not([controls]) {  display: none;}html {  font-size: 100%;  -webkit-text-size-adjust: 100%;  -ms-text-size-adjust: 100%;}a:focus {  outline: thin dotted #333;  outline: 5px auto -webkit-focus-ring-color;  outline-offset: -2px;}a:hover,a:active {  outline: 0;}sub,sup {  position: relative;  font-size: 75%;  line-height: 0;  vertical-align: baseline;}sup {  top: -0.5em;}sub {  bottom: -0.25em;}img {  max-width: 100%;  vertical-align: middle;  border: 0;  -ms-interpolation-mode: bicubic;}#map_canvas img {  max-width: none;}button,input,select,textarea {  margin: 0;  font-size: 100%;  vertical-align: middle;}button,input {  *overflow: visible;  line-height: normal;}button::-moz-focus-inner,input::-moz-focus-inner {  padding: 0;  border: 0;}button,input[type="button"],input[type="reset"],input[type="submit"] {  cursor: pointer;  -webkit-appearance: button;}input[type="search"] {  -webkit-box-sizing: content-box;  -moz-box-sizing: content-box;  box-sizing: content-box;  -webkit-appearance: textfield;}input[type="search"]::-webkit-search-decoration,input[type="search"]::-webkit-search-cancel-button {  -webkit-appearance: none;}textarea {  overflow: auto;  vertical-align: top;}body {  margin: 0;  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;  font-size: 13px;  line-height: 18px;  color: #333333;  background-color: #ffffff;}a {  color: #0088cc;  text-decoration: none;}a:hover {  color: #005580;  text-decoration: underline;}.row {  margin-left: -20px;  *zoom: 1;}.row:before,.row:after {  display: table;  content: "";}.row:after {  clear: both;}[class*="span"] {  float: left;  margin-left: 20px;}.container,.navbar-fixed-top .container,.navbar-fixed-bottom .container {  width: 940px;}.span12 {  width: 940px;}.span11 {  width: 860px;}.span10 {  width: 780px;}.span9 {  width: 700px;}.span8 {  width: 620px;}.span7 {  width: 540px;}.span6 {  width: 460px;}.span5 {  width: 380px;}.span4 {  width: 300px;}.span3 {  width: 220px;}.span2 {  width: 140px;}.span1 {  width: 60px;}.offset12 {  margin-left: 980px;}.offset11 {  margin-left: 900px;}.offset10 {  margin-left: 820px;}.offset9 {  margin-left: 740px;}.offset8 {  margin-left: 660px;}.offset7 {  margin-left: 580px;}.offset6 {  margin-left: 500px;}.offset5 {  margin-left: 420px;}.offset4 {  margin-left: 340px;}.offset3 {  margin-left: 260px;}.offset2 {  margin-left: 180px;}.offset1 {  margin-left: 100px;}.row-fluid {  width: 100%;  *zoom: 1;}.row-fluid:before,.row-fluid:after {  display: table;  content: "";}.row-fluid:after {  clear: both;}.row-fluid [class*="span"] {  display: block;  width: 100%;  min-height: 28px;  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;  float: left;  margin-left: 2.127659574%;  *margin-left: 2.0744680846382977%;}.row-fluid [class*="span"]:first-child {  margin-left: 0;}.row-fluid .span12 {  width: 99.99999998999999%;  *width: 99.94680850063828%;}.row-fluid .span11 {  width: 91.489361693%;  *width: 91.4361702036383%;}.row-fluid .span10 {  width: 82.97872339599999%;  *width: 82.92553190663828%;}.row-fluid .span9 {  width: 74.468085099%;  *width: 74.4148936096383%;}.row-fluid .span8 {  width: 65.95744680199999%;  *width: 65.90425531263828%;}.row-fluid .span7 {  width: 57.446808505%;  *width: 57.3936170156383%;}.row-fluid .span6 {  width: 48.93617020799999%;  *width: 48.88297871863829%;}.row-fluid .span5 {  width: 40.425531911%;  *width: 40.3723404216383%;}.row-fluid .span4 {  width: 31.914893614%;  *width: 31.8617021246383%;}.row-fluid .span3 {  width: 23.404255317%;  *width: 23.3510638276383%;}.row-fluid .span2 {  width: 14.89361702%;  *width: 14.8404255306383%;}.row-fluid .span1 {  width: 6.382978723%;  *width: 6.329787233638298%;}.container {  margin-right: auto;  margin-left: auto;  *zoom: 1;}.container:before,.container:after {  display: table;  content: "";}.container:after {  clear: both;}.container-fluid {  padding-right: 20px;  padding-left: 20px;  *zoom: 1;}.container-fluid:before,.container-fluid:after {  display: table;  content: "";}.container-fluid:after {  clear: both;}p {  margin: 0 0 9px;}p small {  font-size: 11px;  color: #999999;}.lead {  margin-bottom: 18px;  font-size: 20px;  font-weight: 200;  line-height: 27px;}h1,h2,h3,h4,h5,h6 {  margin: 0;  font-family: inherit;  font-weight: bold;  color: inherit;  text-rendering: optimizelegibility;}h1 small,h2 small,h3 small,h4 small,h5 small,h6 small {  font-weight: normal;  color: #999999;}h1 {  font-size: 30px;  line-height: 36px;}h1 small {  font-size: 18px;}h2 {  font-size: 24px;  line-height: 36px;}h2 small {  font-size: 18px;}h3 {  font-size: 18px;  line-height: 27px;}h3 small {  font-size: 14px;}h4,h5,h6 {  line-height: 18px;}h4 {  font-size: 14px;}h4 small {  font-size: 12px;}h5 {  font-size: 12px;}h6 {  font-size: 11px;  color: #999999;  text-transform: uppercase;}.page-header {  padding-bottom: 17px;  margin: 18px 0;  border-bottom: 1px solid #eeeeee;}.page-header h1 {  line-height: 1;}ul,ol {  padding: 0;  margin: 0 0 9px 25px;}ul ul,ul ol,ol ol,ol ul {  margin-bottom: 0;}ul {  list-style: disc;}ol {  list-style: decimal;}li {  line-height: 18px;}ul.unstyled,ol.unstyled {  margin-left: 0;  list-style: none;}dl {  margin-bottom: 18px;}dt,dd {  line-height: 18px;}dt {  font-weight: bold;  line-height: 17px;}dd {  margin-left: 9px;}.dl-horizontal dt {  float: left;  width: 120px;  clear: left;  text-align: right;  overflow: hidden;  text-overflow: ellipsis;  white-space: nowrap;}.dl-horizontal dd {  margin-left: 130px;}hr {  margin: 18px 0;  border: 0;  border-top: 1px solid #eeeeee;  border-bottom: 1px solid #ffffff;}strong {  font-weight: bold;}em {  font-style: italic;}.muted {  color: #999999;}abbr[title] {  cursor: help;  border-bottom: 1px dotted #999999;}abbr.initialism {  font-size: 90%;  text-transform: uppercase;}blockquote {  padding: 0 0 0 15px;  margin: 0 0 18px;  border-left: 5px solid #eeeeee;}blockquote p {  margin-bottom: 0;  font-size: 16px;  font-weight: 300;  line-height: 22.5px;}blockquote small {  display: block;  line-height: 18px;  color: #999999;}blockquote small:before {  content: '\2014 \00A0';}blockquote.pull-right {  float: right;  padding-right: 15px;  padding-left: 0;  border-right: 5px solid #eeeeee;  border-left: 0;}blockquote.pull-right p,blockquote.pull-right small {  text-align: right;}q:before,q:after,blockquote:before,blockquote:after {  content: "";}address {  display: block;  margin-bottom: 18px;  font-style: normal;  line-height: 18px;}small {  font-size: 100%;}cite {  font-style: normal;}code,pre {  padding: 0 3px 2px;  font-family: Menlo, Monaco, Consolas, "Courier New", monospace;  font-size: 12px;  color: #333333;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}code {  padding: 2px 4px;  color: #d14;  background-color: #f7f7f9;  border: 1px solid #e1e1e8;}pre {  display: block;  padding: 8.5px;  margin: 0 0 9px;  font-size: 12.025px;  line-height: 18px;  word-break: break-all;  word-wrap: break-word;  white-space: pre;  white-space: pre-wrap;  background-color: #f5f5f5;  border: 1px solid #ccc;  border: 1px solid rgba(0, 0, 0, 0.15);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}pre.prettyprint {  margin-bottom: 18px;}pre code {  padding: 0;  color: inherit;  background-color: transparent;  border: 0;}.pre-scrollable {  max-height: 340px;  overflow-y: scroll;}.label,.badge {  font-size: 10.998px;  font-weight: bold;  line-height: 14px;  color: #ffffff;  vertical-align: baseline;  white-space: nowrap;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);  background-color: #999999;}.label {  padding: 1px 4px 2px;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}.badge {  padding: 1px 9px 2px;  -webkit-border-radius: 9px;  -moz-border-radius: 9px;  border-radius: 9px;}a.label:hover,a.badge:hover {  color: #ffffff;  text-decoration: none;  cursor: pointer;}.label-important,.badge-important {  background-color: #b94a48;}.label-important[href],.badge-important[href] {  background-color: #953b39;}.label-warning,.badge-warning {  background-color: #f89406;}.label-warning[href],.badge-warning[href] {  background-color: #c67605;}.label-success,.badge-success {  background-color: #468847;}.label-success[href],.badge-success[href] {  background-color: #356635;}.label-info,.badge-info {  background-color: #3a87ad;}.label-info[href],.badge-info[href] {  background-color: #2d6987;}.label-inverse,.badge-inverse {  background-color: #333333;}.label-inverse[href],.badge-inverse[href] {  background-color: #1a1a1a;}table {  max-width: 100%;  background-color: transparent;  border-collapse: collapse;  border-spacing: 0;}.table {  width: 100%;  margin-bottom: 18px;}.table th,.table td {  padding: 8px;  line-height: 18px;  text-align: left;  vertical-align: top;  border-top: 1px solid #dddddd;}.table th {  font-weight: bold;}.table thead th {  vertical-align: bottom;}.table caption + thead tr:first-child th,.table caption + thead tr:first-child td,.table colgroup + thead tr:first-child th,.table colgroup + thead tr:first-child td,.table thead:first-child tr:first-child th,.table thead:first-child tr:first-child td {  border-top: 0;}.table tbody + tbody {  border-top: 2px solid #dddddd;}.table-condensed th,.table-condensed td {  padding: 4px 5px;}.table-bordered {  border: 1px solid #dddddd;  border-collapse: separate;  *border-collapse: collapsed;  border-left: 0;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.table-bordered th,.table-bordered td {  border-left: 1px solid #dddddd;}.table-bordered caption + thead tr:first-child th,.table-bordered caption + tbody tr:first-child th,.table-bordered caption + tbody tr:first-child td,.table-bordered colgroup + thead tr:first-child th,.table-bordered colgroup + tbody tr:first-child th,.table-bordered colgroup + tbody tr:first-child td,.table-bordered thead:first-child tr:first-child th,.table-bordered tbody:first-child tr:first-child th,.table-bordered tbody:first-child tr:first-child td {  border-top: 0;}.table-bordered thead:first-child tr:first-child th:first-child,.table-bordered tbody:first-child tr:first-child td:first-child {  -webkit-border-top-left-radius: 4px;  border-top-left-radius: 4px;  -moz-border-radius-topleft: 4px;}.table-bordered thead:first-child tr:first-child th:last-child,.table-bordered tbody:first-child tr:first-child td:last-child {  -webkit-border-top-right-radius: 4px;  border-top-right-radius: 4px;  -moz-border-radius-topright: 4px;}.table-bordered thead:last-child tr:last-child th:first-child,.table-bordered tbody:last-child tr:last-child td:first-child {  -webkit-border-radius: 0 0 0 4px;  -moz-border-radius: 0 0 0 4px;  border-radius: 0 0 0 4px;  -webkit-border-bottom-left-radius: 4px;  border-bottom-left-radius: 4px;  -moz-border-radius-bottomleft: 4px;}.table-bordered thead:last-child tr:last-child th:last-child,.table-bordered tbody:last-child tr:last-child td:last-child {  -webkit-border-bottom-right-radius: 4px;  border-bottom-right-radius: 4px;  -moz-border-radius-bottomright: 4px;}.table-striped tbody tr:nth-child(odd) td,.table-striped tbody tr:nth-child(odd) th {  background-color: #f9f9f9;}.table tbody tr:hover td,.table tbody tr:hover th {  background-color: #f5f5f5;}table .span1 {  float: none;  width: 44px;  margin-left: 0;}table .span2 {  float: none;  width: 124px;  margin-left: 0;}table .span3 {  float: none;  width: 204px;  margin-left: 0;}table .span4 {  float: none;  width: 284px;  margin-left: 0;}table .span5 {  float: none;  width: 364px;  margin-left: 0;}table .span6 {  float: none;  width: 444px;  margin-left: 0;}table .span7 {  float: none;  width: 524px;  margin-left: 0;}table .span8 {  float: none;  width: 604px;  margin-left: 0;}table .span9 {  float: none;  width: 684px;  margin-left: 0;}table .span10 {  float: none;  width: 764px;  margin-left: 0;}table .span11 {  float: none;  width: 844px;  margin-left: 0;}table .span12 {  float: none;  width: 924px;  margin-left: 0;}table .span13 {  float: none;  width: 1004px;  margin-left: 0;}table .span14 {  float: none;  width: 1084px;  margin-left: 0;}table .span15 {  float: none;  width: 1164px;  margin-left: 0;}table .span16 {  float: none;  width: 1244px;  margin-left: 0;}table .span17 {  float: none;  width: 1324px;  margin-left: 0;}table .span18 {  float: none;  width: 1404px;  margin-left: 0;}table .span19 {  float: none;  width: 1484px;  margin-left: 0;}table .span20 {  float: none;  width: 1564px;  margin-left: 0;}table .span21 {  float: none;  width: 1644px;  margin-left: 0;}table .span22 {  float: none;  width: 1724px;  margin-left: 0;}table .span23 {  float: none;  width: 1804px;  margin-left: 0;}table .span24 {  float: none;  width: 1884px;  margin-left: 0;}form {  margin: 0 0 18px;}fieldset {  padding: 0;  margin: 0;  border: 0;}legend {  display: block;  width: 100%;  padding: 0;  margin-bottom: 27px;  font-size: 19.5px;  line-height: 36px;  color: #333333;  border: 0;  border-bottom: 1px solid #e5e5e5;}legend small {  font-size: 13.5px;  color: #999999;}.control-group .controls {    label,    input,    button,    select,    textarea {      font-size: 13px;      font-weight: normal;      line-height: 18px;    }}.control-group .controls {    input,    button,    select,    textarea {      font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;    }}label {  display: block;  margin-bottom: 5px;}.control-group .controls {    select,    textarea,    input[type="text"],    input[type="password"],    input[type="datetime"],    input[type="datetime-local"],    input[type="date"],    input[type="month"],    input[type="time"],    input[type="week"],    input[type="number"],    input[type="email"],    input[type="url"],    input[type="search"],    input[type="tel"],    input[type="color"],    .uneditable-input {      display: inline-block;      height: 18px;      padding: 4px;      margin-bottom: 9px;      font-size: 13px;      line-height: 18px;      color: #555555;    }}.control-group .controls {    input,    textarea {      width: 210px;    }}.control-group .controls {    textarea {      height: auto;    }}.control-group .controls {    textarea,    input[type="text"],    input[type="password"],    input[type="datetime"],    input[type="datetime-local"],    input[type="date"],    input[type="month"],    input[type="time"],    input[type="week"],    input[type="number"],    input[type="email"],    input[type="url"],    input[type="search"],    input[type="tel"],    input[type="color"],    .uneditable-input {      background-color: #ffffff;      border: 1px solid #cccccc;      -webkit-border-radius: 3px;      -moz-border-radius: 3px;      border-radius: 3px;      -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      -moz-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.075);      -webkit-transition: border linear 0.2s, box-shadow linear 0.2s;      -moz-transition: border linear 0.2s, box-shadow linear 0.2s;      -ms-transition: border linear 0.2s, box-shadow linear 0.2s;      -o-transition: border linear 0.2s, box-shadow linear 0.2s;      transition: border linear 0.2s, box-shadow linear 0.2s;    }}.control-group .controls {    textarea:focus,    input[type="text"]:focus,    input[type="password"]:focus,    input[type="datetime"]:focus,    input[type="datetime-local"]:focus,    input[type="date"]:focus,    input[type="month"]:focus,    input[type="time"]:focus,    input[type="week"]:focus,    input[type="number"]:focus,    input[type="email"]:focus,    input[type="url"]:focus,    input[type="search"]:focus,    input[type="tel"]:focus,    input[type="color"]:focus,    .uneditable-input:focus {      border-color: rgba(82, 168, 236, 0.8);      outline: 0;      outline: thin dotted \9;      /* IE6-9 */      -webkit-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);      -moz-box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);      box-shadow: inset 0 1px 1px rgba(0,0,0,.075), 0 0 8px rgba(82,168,236,.6);    }}.control-group .controls {    input[type="radio"],    input[type="checkbox"] {      margin: 3px 0;      *margin-top: 0;      /* IE7 */      line-height: normal;      cursor: pointer;    }}.control-group .controls {    input[type="submit"],    input[type="reset"],    input[type="button"],    input[type="radio"],    input[type="checkbox"] {      width: auto;    }}.uneditable-textarea {  width: auto;  height: auto;}.control-group .controls {    select,    input[type="file"] {      height: 28px;      /* In IE7, the height of the select element cannot be changed by height, only font-size */      *margin-top: 4px;      /* For IE7, add top margin to align select with labels */      line-height: 28px;    }}.control-group .controls {    select {      width: 220px;      border: 1px solid #bbb;    }}.control-group .controls {    select[multiple],    select[size] {      height: auto;    }}.control-group .controls {    select:focus,    input[type="file"]:focus,    input[type="radio"]:focus,    input[type="checkbox"]:focus {      outline: thin dotted #333;      outline: 5px auto -webkit-focus-ring-color;      outline-offset: -2px;    }}.radio,.checkbox {  min-height: 18px;  padding-left: 18px;}.radio input[type="radio"],.checkbox input[type="checkbox"] {  float: left;  margin-left: -18px;}.controls > .radio:first-child,.controls > .checkbox:first-child {  padding-top: 5px;}.radio.inline,.checkbox.inline {  display: inline-block;  padding-top: 5px;  margin-bottom: 0;  vertical-align: middle;}.radio.inline + .radio.inline,.checkbox.inline + .checkbox.inline {  margin-left: 10px;}.control-group .controls {    .input-mini {      width: 60px;    }}.control-group .controls {    .input-small {      width: 90px;    }}.control-group .controls {    .input-medium {      width: 150px;    }}.control-group .controls {    .input-large {      width: 210px;    }}.input-xlarge {    .input-xlarge {      width: 270px;    }}.input-xxlarge {    .input-xxlarge {      width: 530px;    }}.control-group .controls {    input[class*="span"],    select[class*="span"],    textarea[class*="span"],    .uneditable-input[class*="span"],    .row-fluid input[class*="span"],    .row-fluid select[class*="span"],    .row-fluid textarea[class*="span"],    .row-fluid .uneditable-input[class*="span"] {      float: none;      margin-left: 0;    }}.input-append input[class*="span"],.input-append .uneditable-input[class*="span"],.input-prepend input[class*="span"],.input-prepend .uneditable-input[class*="span"],.row-fluid .input-prepend [class*="span"],.row-fluid .input-append [class*="span"] {  display: inline-block;}.control-group .controls {    input,    textarea,    .uneditable-input {      margin-left: 0;    }}input.span12, textarea.span12, .uneditable-input.span12 {  width: 930px;}input.span11, textarea.span11, .uneditable-input.span11 {  width: 850px;}input.span10, textarea.span10, .uneditable-input.span10 {  width: 770px;}input.span9, textarea.span9, .uneditable-input.span9 {  width: 690px;}input.span8, textarea.span8, .uneditable-input.span8 {  width: 610px;}input.span7, textarea.span7, .uneditable-input.span7 {  width: 530px;}input.span6, textarea.span6, .uneditable-input.span6 {  width: 450px;}input.span5, textarea.span5, .uneditable-input.span5 {  width: 370px;}input.span4, textarea.span4, .uneditable-input.span4 {  width: 290px;}input.span3, textarea.span3, .uneditable-input.span3 {  width: 210px;}input.span2, textarea.span2, .uneditable-input.span2 {  width: 130px;}input.span1, textarea.span1, .uneditable-input.span1 {  width: 50px;}input[disabled],select[disabled],textarea[disabled],input[readonly],select[readonly],textarea[readonly] {  cursor: not-allowed;  background-color: #eeeeee;  border-color: #ddd;}input[type="radio"][disabled],input[type="checkbox"][disabled],input[type="radio"][readonly],input[type="checkbox"][readonly] {  background-color: transparent;}.control-group.warning > label,.control-group.warning .help-block,.control-group.warning .help-inline {  color: #c09853;}.control-group.warning .checkbox,.control-group.warning .radio,.control-group.warning input,.control-group.warning select,.control-group.warning textarea {  color: #c09853;  border-color: #c09853;}.control-group.warning .checkbox:focus,.control-group.warning .radio:focus,.control-group.warning input:focus,.control-group.warning select:focus,.control-group.warning textarea:focus {  border-color: #a47e3c;  -webkit-box-shadow: 0 0 6px #dbc59e;  -moz-box-shadow: 0 0 6px #dbc59e;  box-shadow: 0 0 6px #dbc59e;}.control-group.warning .input-prepend .add-on,.control-group.warning .input-append .add-on {  color: #c09853;  background-color: #fcf8e3;  border-color: #c09853;}.control-group.error > label,.control-group.error .help-block,.control-group.error .help-inline {  color: #b94a48;}.control-group.error .checkbox,.control-group.error .radio,.control-group.error input,.control-group.error select,.control-group.error textarea {  color: #b94a48;  border-color: #b94a48;}.control-group.error .checkbox:focus,.control-group.error .radio:focus,.control-group.error input:focus,.control-group.error select:focus,.control-group.error textarea:focus {  border-color: #953b39;  -webkit-box-shadow: 0 0 6px #d59392;  -moz-box-shadow: 0 0 6px #d59392;  box-shadow: 0 0 6px #d59392;}.control-group.error .input-prepend .add-on,.control-group.error .input-append .add-on {  color: #b94a48;  background-color: #f2dede;  border-color: #b94a48;}.control-group.success > label,.control-group.success .help-block,.control-group.success .help-inline {  color: #468847;}.control-group.success .checkbox,.control-group.success .radio,.control-group.success input,.control-group.success select,.control-group.success textarea {  color: #468847;  border-color: #468847;}.control-group.success .checkbox:focus,.control-group.success .radio:focus,.control-group.success input:focus,.control-group.success select:focus,.control-group.success textarea:focus {  border-color: #356635;  -webkit-box-shadow: 0 0 6px #7aba7b;  -moz-box-shadow: 0 0 6px #7aba7b;  box-shadow: 0 0 6px #7aba7b;}.control-group.success .input-prepend .add-on,.control-group.success .input-append .add-on {  color: #468847;  background-color: #dff0d8;  border-color: #468847;}input:focus:required:invalid,textarea:focus:required:invalid,select:focus:required:invalid {  color: #b94a48;  border-color: #ee5f5b;}input:focus:required:invalid:focus,textarea:focus:required:invalid:focus,select:focus:required:invalid:focus {  border-color: #e9322d;  -webkit-box-shadow: 0 0 6px #f8b9b7;  -moz-box-shadow: 0 0 6px #f8b9b7;  box-shadow: 0 0 6px #f8b9b7;}.form-actions {  padding: 17px 20px 18px;  margin-top: 18px;  margin-bottom: 18px;  background-color: #f5f5f5;  border-top: 1px solid #e5e5e5;  *zoom: 1;}.form-actions:before,.form-actions:after {  display: table;  content: "";}.form-actions:after {  clear: both;}.uneditable-input {  overflow: hidden;  white-space: nowrap;  cursor: not-allowed;  background-color: #ffffff;  border-color: #eee;  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);  -moz-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.025);}:-moz-placeholder {  color: #999999;}:-ms-input-placeholder {  color: #999999;}::-webkit-input-placeholder {  color: #999999;}.help-block,.help-inline {  color: #555555;}.help-block {  display: block;  margin-bottom: 9px;}.help-inline {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  vertical-align: middle;  padding-left: 5px;}.input-prepend,.input-append {  margin-bottom: 5px;}.input-prepend input,.input-append input,.input-prepend select,.input-append select,.input-prepend .uneditable-input,.input-append .uneditable-input {  position: relative;  margin-bottom: 0;  *margin-left: 0;  vertical-align: middle;  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.input-prepend input:focus,.input-append input:focus,.input-prepend select:focus,.input-append select:focus,.input-prepend .uneditable-input:focus,.input-append .uneditable-input:focus {  z-index: 2;}.input-prepend .uneditable-input,.input-append .uneditable-input {  border-left-color: #ccc;}.input-prepend .add-on,.input-append .add-on {  display: inline-block;  width: auto;  height: 18px;  min-width: 16px;  padding: 4px 5px;  font-weight: normal;  line-height: 18px;  text-align: center;  text-shadow: 0 1px 0 #ffffff;  vertical-align: middle;  background-color: #eeeeee;  border: 1px solid #ccc;}.input-prepend .add-on,.input-append .add-on,.input-prepend .btn,.input-append .btn {  margin-left: -1px;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.input-prepend .active,.input-append .active {  background-color: #a9dba9;  border-color: #46a546;}.input-prepend .add-on,.input-prepend .btn {  margin-right: -1px;}.input-prepend .add-on:first-child,.input-prepend .btn:first-child {  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-append input,.input-append select,.input-append .uneditable-input {  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-append .uneditable-input {  border-right-color: #ccc;  border-left-color: #eee;}.input-append .add-on:last-child,.input-append .btn:last-child {  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.input-prepend.input-append input,.input-prepend.input-append select,.input-prepend.input-append .uneditable-input {  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.input-prepend.input-append .add-on:first-child,.input-prepend.input-append .btn:first-child {  margin-right: -1px;  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.input-prepend.input-append .add-on:last-child,.input-prepend.input-append .btn:last-child {  margin-left: -1px;  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.search-query {  padding-right: 14px;  padding-right: 4px \9;  padding-left: 14px;  padding-left: 4px \9;  /* IE7-8 doesn't have border-radius, so don't indent the padding */  margin-bottom: 0;  -webkit-border-radius: 14px;  -moz-border-radius: 14px;  border-radius: 14px;}.form-search input,.form-inline input,.form-horizontal input,.form-search textarea,.form-inline textarea,.form-horizontal textarea,.form-search select,.form-inline select,.form-horizontal select,.form-search .help-inline,.form-inline .help-inline,.form-horizontal .help-inline,.form-search .uneditable-input,.form-inline .uneditable-input,.form-horizontal .uneditable-input,.form-search .input-prepend,.form-inline .input-prepend,.form-horizontal .input-prepend,.form-search .input-append,.form-inline .input-append,.form-horizontal .input-append {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  margin-bottom: 0;}.form-search .hide,.form-inline .hide,.form-horizontal .hide {  display: none;}.form-search label,.form-inline label {  display: inline-block;}.form-search .input-append,.form-inline .input-append,.form-search .input-prepend,.form-inline .input-prepend {  margin-bottom: 0;}.form-search .radio,.form-search .checkbox,.form-inline .radio,.form-inline .checkbox {  padding-left: 0;  margin-bottom: 0;  vertical-align: middle;}.form-search .radio input[type="radio"],.form-search .checkbox input[type="checkbox"],.form-inline .radio input[type="radio"],.form-inline .checkbox input[type="checkbox"] {  float: left;  margin-right: 3px;  margin-left: 0;}.control-group {  margin-bottom: 9px;}legend + .control-group {  margin-top: 18px;  -webkit-margin-top-collapse: separate;}.form-horizontal .control-group {  margin-bottom: 18px;  *zoom: 1;}.form-horizontal .control-group:before,.form-horizontal .control-group:after {  display: table;  content: "";}.form-horizontal .control-group:after {  clear: both;}.form-horizontal .control-label {  float: left;  width: 140px;  padding-top: 5px;  text-align: right;}.form-horizontal .controls {  *display: inline-block;  *padding-left: 20px;  margin-left: 160px;  *margin-left: 0;}.form-horizontal .controls:first-child {  *padding-left: 160px;}.form-horizontal .help-block {  margin-top: 9px;  margin-bottom: 0;}.form-horizontal .form-actions {  padding-left: 160px;}.btn {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  padding: 4px 10px 4px;  margin-bottom: 0;  font-size: 13px;  line-height: 18px;  *line-height: 20px;  color: #333333;  text-align: center;  text-shadow: 0 1px 1px rgba(255, 255, 255, 0.75);  vertical-align: middle;  cursor: pointer;  background-color: #f5f5f5;  background-image: -moz-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -ms-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#e6e6e6));  background-image: -webkit-linear-gradient(top, #ffffff, #e6e6e6);  background-image: -o-linear-gradient(top, #ffffff, #e6e6e6);  background-image: linear-gradient(top, #ffffff, #e6e6e6);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#e6e6e6', GradientType=0);  border-color: #e6e6e6 #e6e6e6 #bfbfbf;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #e6e6e6;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);  border: 1px solid #cccccc;  *border: 0;  border-bottom-color: #b3b3b3;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  *margin-left: .3em;  -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);}.btn:hover,.btn:active,.btn.active,.btn.disabled,.btn[disabled] {  background-color: #e6e6e6;  *background-color: #d9d9d9;}.btn:active,.btn.active {  background-color: #cccccc \9;}.btn:first-child {  *margin-left: 0;}.btn:hover {  color: #333333;  text-decoration: none;  background-color: #e6e6e6;  *background-color: #d9d9d9;  /* Buttons in IE7 don't get borders, so darken on hover */  background-position: 0 -15px;  -webkit-transition: background-position 0.1s linear;  -moz-transition: background-position 0.1s linear;  -ms-transition: background-position 0.1s linear;  -o-transition: background-position 0.1s linear;  transition: background-position 0.1s linear;}.btn:focus {  outline: thin dotted #333;  outline: 5px auto -webkit-focus-ring-color;  outline-offset: -2px;}.btn.active,.btn:active {  background-color: #e6e6e6;  background-color: #d9d9d9 \9;  background-image: none;  outline: 0;  -webkit-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);}.btn.disabled,.btn[disabled] {  cursor: default;  background-color: #e6e6e6;  background-image: none;  opacity: 0.65;  filter: alpha(opacity=65);  -webkit-box-shadow: none;  -moz-box-shadow: none;  box-shadow: none;}.btn-large {  padding: 9px 14px;  font-size: 15px;  line-height: normal;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;}.btn-large [class^="icon-"] {  margin-top: 1px;}.btn-small {  padding: 5px 9px;  font-size: 11px;  line-height: 16px;}.btn-small [class^="icon-"] {  margin-top: -1px;}.btn-mini {  padding: 2px 6px;  font-size: 11px;  line-height: 14px;}.btn-primary,.btn-primary:hover,.btn-warning,.btn-warning:hover,.btn-danger,.btn-danger:hover,.btn-success,.btn-success:hover,.btn-info,.btn-info:hover,.btn-inverse,.btn-inverse:hover {  color: #ffffff;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);}.btn-primary.active,.btn-warning.active,.btn-danger.active,.btn-success.active,.btn-info.active,.btn-inverse.active {  color: rgba(255, 255, 255, 0.75);}.btn {  border-color: #ccc;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);}.btn-primary {  background-color: #0074cc;  background-image: -moz-linear-gradient(top, #0088cc, #0055cc);  background-image: -ms-linear-gradient(top, #0088cc, #0055cc);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#0088cc), to(#0055cc));  background-image: -webkit-linear-gradient(top, #0088cc, #0055cc);  background-image: -o-linear-gradient(top, #0088cc, #0055cc);  background-image: linear-gradient(top, #0088cc, #0055cc);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#0088cc', endColorstr='#0055cc', GradientType=0);  border-color: #0055cc #0055cc #003580;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #0055cc;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-primary:hover,.btn-primary:active,.btn-primary.active,.btn-primary.disabled,.btn-primary[disabled] {  background-color: #0055cc;  *background-color: #004ab3;}.btn-primary:active,.btn-primary.active {  background-color: #004099 \9;}.btn-warning {  background-color: #faa732;  background-image: -moz-linear-gradient(top, #fbb450, #f89406);  background-image: -ms-linear-gradient(top, #fbb450, #f89406);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#fbb450), to(#f89406));  background-image: -webkit-linear-gradient(top, #fbb450, #f89406);  background-image: -o-linear-gradient(top, #fbb450, #f89406);  background-image: linear-gradient(top, #fbb450, #f89406);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#fbb450', endColorstr='#f89406', GradientType=0);  border-color: #f89406 #f89406 #ad6704;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #f89406;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-warning:hover,.btn-warning:active,.btn-warning.active,.btn-warning.disabled,.btn-warning[disabled] {  background-color: #f89406;  *background-color: #df8505;}.btn-warning:active,.btn-warning.active {  background-color: #c67605 \9;}.btn-danger {  background-color: #da4f49;  background-image: -moz-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -ms-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ee5f5b), to(#bd362f));  background-image: -webkit-linear-gradient(top, #ee5f5b, #bd362f);  background-image: -o-linear-gradient(top, #ee5f5b, #bd362f);  background-image: linear-gradient(top, #ee5f5b, #bd362f);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ee5f5b', endColorstr='#bd362f', GradientType=0);  border-color: #bd362f #bd362f #802420;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #bd362f;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-danger:hover,.btn-danger:active,.btn-danger.active,.btn-danger.disabled,.btn-danger[disabled] {  background-color: #bd362f;  *background-color: #a9302a;}.btn-danger:active,.btn-danger.active {  background-color: #942a25 \9;}.btn-success {  background-color: #5bb75b;  background-image: -moz-linear-gradient(top, #62c462, #51a351);  background-image: -ms-linear-gradient(top, #62c462, #51a351);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#51a351));  background-image: -webkit-linear-gradient(top, #62c462, #51a351);  background-image: -o-linear-gradient(top, #62c462, #51a351);  background-image: linear-gradient(top, #62c462, #51a351);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#51a351', GradientType=0);  border-color: #51a351 #51a351 #387038;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #51a351;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-success:hover,.btn-success:active,.btn-success.active,.btn-success.disabled,.btn-success[disabled] {  background-color: #51a351;  *background-color: #499249;}.btn-success:active,.btn-success.active {  background-color: #408140 \9;}.btn-info {  background-color: #49afcd;  background-image: -moz-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -ms-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#2f96b4));  background-image: -webkit-linear-gradient(top, #5bc0de, #2f96b4);  background-image: -o-linear-gradient(top, #5bc0de, #2f96b4);  background-image: linear-gradient(top, #5bc0de, #2f96b4);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#2f96b4', GradientType=0);  border-color: #2f96b4 #2f96b4 #1f6377;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #2f96b4;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-info:hover,.btn-info:active,.btn-info.active,.btn-info.disabled,.btn-info[disabled] {  background-color: #2f96b4;  *background-color: #2a85a0;}.btn-info:active,.btn-info.active {  background-color: #24748c \9;}.btn-inverse {  background-color: #414141;  background-image: -moz-linear-gradient(top, #555555, #222222);  background-image: -ms-linear-gradient(top, #555555, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#555555), to(#222222));  background-image: -webkit-linear-gradient(top, #555555, #222222);  background-image: -o-linear-gradient(top, #555555, #222222);  background-image: linear-gradient(top, #555555, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#555555', endColorstr='#222222', GradientType=0);  border-color: #222222 #222222 #000000;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #222222;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);}.btn-inverse:hover,.btn-inverse:active,.btn-inverse.active,.btn-inverse.disabled,.btn-inverse[disabled] {  background-color: #222222;  *background-color: #151515;}.btn-inverse:active,.btn-inverse.active {  background-color: #080808 \9;}button.btn,input[type="submit"].btn {  *padding-top: 2px;  *padding-bottom: 2px;}button.btn::-moz-focus-inner,input[type="submit"].btn::-moz-focus-inner {  padding: 0;  border: 0;}button.btn.btn-large,input[type="submit"].btn.btn-large {  *padding-top: 7px;  *padding-bottom: 7px;}button.btn.btn-small,input[type="submit"].btn.btn-small {  *padding-top: 3px;  *padding-bottom: 3px;}button.btn.btn-mini,input[type="submit"].btn.btn-mini {  *padding-top: 1px;  *padding-bottom: 1px;}.btn-group {  position: relative;  *zoom: 1;  *margin-left: .3em;}.btn-group:before,.btn-group:after {  display: table;  content: "";}.btn-group:after {  clear: both;}.btn-group:first-child {  *margin-left: 0;}.btn-group + .btn-group {  margin-left: 5px;}.btn-toolbar {  margin-top: 9px;  margin-bottom: 9px;}.btn-toolbar .btn-group {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;}.btn-group > .btn {  position: relative;  float: left;  margin-left: -1px;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.btn-group > .btn:first-child {  margin-left: 0;  -webkit-border-top-left-radius: 4px;  -moz-border-radius-topleft: 4px;  border-top-left-radius: 4px;  -webkit-border-bottom-left-radius: 4px;  -moz-border-radius-bottomleft: 4px;  border-bottom-left-radius: 4px;}.btn-group > .btn:last-child,.btn-group > .dropdown-toggle {  -webkit-border-top-right-radius: 4px;  -moz-border-radius-topright: 4px;  border-top-right-radius: 4px;  -webkit-border-bottom-right-radius: 4px;  -moz-border-radius-bottomright: 4px;  border-bottom-right-radius: 4px;}.btn-group > .btn.large:first-child {  margin-left: 0;  -webkit-border-top-left-radius: 6px;  -moz-border-radius-topleft: 6px;  border-top-left-radius: 6px;  -webkit-border-bottom-left-radius: 6px;  -moz-border-radius-bottomleft: 6px;  border-bottom-left-radius: 6px;}.btn-group > .btn.large:last-child,.btn-group > .large.dropdown-toggle {  -webkit-border-top-right-radius: 6px;  -moz-border-radius-topright: 6px;  border-top-right-radius: 6px;  -webkit-border-bottom-right-radius: 6px;  -moz-border-radius-bottomright: 6px;  border-bottom-right-radius: 6px;}.btn-group > .btn:hover,.btn-group > .btn:focus,.btn-group > .btn:active,.btn-group > .btn.active {  z-index: 2;}.btn-group .dropdown-toggle:active,.btn-group.open .dropdown-toggle {  outline: 0;}.btn-group > .dropdown-toggle {  padding-left: 8px;  padding-right: 8px;  -webkit-box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 1px 0 0 rgba(255,255,255,.125), inset 0 1px 0 rgba(255,255,255,.2), 0 1px 2px rgba(0,0,0,.05);  *padding-top: 4px;  *padding-bottom: 4px;}.btn-group > .btn-mini.dropdown-toggle {  padding-left: 5px;  padding-right: 5px;}.btn-group > .btn-small.dropdown-toggle {  *padding-top: 4px;  *padding-bottom: 4px;}.btn-group > .btn-large.dropdown-toggle {  padding-left: 12px;  padding-right: 12px;}.btn-group.open .dropdown-toggle {  background-image: none;  -webkit-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  -moz-box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);  box-shadow: inset 0 2px 4px rgba(0,0,0,.15), 0 1px 2px rgba(0,0,0,.05);}.btn-group.open .btn.dropdown-toggle {  background-color: #e6e6e6;}.btn-group.open .btn-primary.dropdown-toggle {  background-color: #0055cc;}.btn-group.open .btn-warning.dropdown-toggle {  background-color: #f89406;}.btn-group.open .btn-danger.dropdown-toggle {  background-color: #bd362f;}.btn-group.open .btn-success.dropdown-toggle {  background-color: #51a351;}.btn-group.open .btn-info.dropdown-toggle {  background-color: #2f96b4;}.btn-group.open .btn-inverse.dropdown-toggle {  background-color: #222222;}.btn .caret {  margin-top: 7px;  margin-left: 0;}.btn:hover .caret,.open.btn-group .caret {  opacity: 1;  filter: alpha(opacity=100);}.btn-mini .caret {  margin-top: 5px;}.btn-small .caret {  margin-top: 6px;}.btn-large .caret {  margin-top: 6px;  border-left-width: 5px;  border-right-width: 5px;  border-top-width: 5px;}.dropup .btn-large .caret {  border-bottom: 5px solid #000000;  border-top: 0;}.btn-primary .caret,.btn-warning .caret,.btn-danger .caret,.btn-info .caret,.btn-success .caret,.btn-inverse .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;  opacity: 0.75;  filter: alpha(opacity=75);}.nav {  margin-left: 0;  margin-bottom: 18px;  list-style: none;}.nav > li > a {  display: block;}.nav > li > a:hover {  text-decoration: none;  background-color: #eeeeee;}.nav > .pull-right {  float: right;}.nav .nav-header {  display: block;  padding: 3px 15px;  font-size: 11px;  font-weight: bold;  line-height: 18px;  color: #999999;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);  text-transform: uppercase;}.nav li + .nav-header {  margin-top: 9px;}.nav-list {  padding-left: 15px;  padding-right: 15px;  margin-bottom: 0;}.nav-list > li > a,.nav-list .nav-header {  margin-left: -15px;  margin-right: -15px;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);}.nav-list > li > a {  padding: 3px 15px;}.nav-list > .active > a,.nav-list > .active > a:hover {  color: #ffffff;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.2);  background-color: #0088cc;}.nav-list [class^="icon-"] {  margin-right: 2px;}.nav-list .divider {  *width: 100%;  height: 1px;  margin: 8px 1px;  *margin: -5px 0 5px;  overflow: hidden;  background-color: #e5e5e5;  border-bottom: 1px solid #ffffff;}.nav-tabs,.nav-pills {  *zoom: 1;}.nav-tabs:before,.nav-pills:before,.nav-tabs:after,.nav-pills:after {  display: table;  content: "";}.nav-tabs:after,.nav-pills:after {  clear: both;}.nav-tabs > li,.nav-pills > li {  float: left;}.nav-tabs > li > a,.nav-pills > li > a {  padding-right: 12px;  padding-left: 12px;  margin-right: 2px;  line-height: 14px;}.nav-tabs {  border-bottom: 1px solid #ddd;}.nav-tabs > li {  margin-bottom: -1px;}.nav-tabs > li > a {  padding-top: 8px;  padding-bottom: 8px;  line-height: 18px;  border: 1px solid transparent;  -webkit-border-radius: 4px 4px 0 0;  -moz-border-radius: 4px 4px 0 0;  border-radius: 4px 4px 0 0;}.nav-tabs > li > a:hover {  border-color: #eeeeee #eeeeee #dddddd;}.nav-tabs > .active > a,.nav-tabs > .active > a:hover {  color: #555555;  background-color: #ffffff;  border: 1px solid #ddd;  border-bottom-color: transparent;  cursor: default;}.nav-pills > li > a {  padding-top: 8px;  padding-bottom: 8px;  margin-top: 2px;  margin-bottom: 2px;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;}.nav-pills > .active > a,.nav-pills > .active > a:hover {  color: #ffffff;  background-color: #0088cc;}.nav-stacked > li {  float: none;}.nav-stacked > li > a {  margin-right: 0;}.nav-tabs.nav-stacked {  border-bottom: 0;}.nav-tabs.nav-stacked > li > a {  border: 1px solid #ddd;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.nav-tabs.nav-stacked > li:first-child > a {  -webkit-border-radius: 4px 4px 0 0;  -moz-border-radius: 4px 4px 0 0;  border-radius: 4px 4px 0 0;}.nav-tabs.nav-stacked > li:last-child > a {  -webkit-border-radius: 0 0 4px 4px;  -moz-border-radius: 0 0 4px 4px;  border-radius: 0 0 4px 4px;}.nav-tabs.nav-stacked > li > a:hover {  border-color: #ddd;  z-index: 2;}.nav-pills.nav-stacked > li > a {  margin-bottom: 3px;}.nav-pills.nav-stacked > li:last-child > a {  margin-bottom: 1px;}.nav-tabs .dropdown-menu {  -webkit-border-radius: 0 0 5px 5px;  -moz-border-radius: 0 0 5px 5px;  border-radius: 0 0 5px 5px;}.nav-pills .dropdown-menu {  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.nav-tabs .dropdown-toggle .caret,.nav-pills .dropdown-toggle .caret {  border-top-color: #0088cc;  border-bottom-color: #0088cc;  margin-top: 6px;}.nav-tabs .dropdown-toggle:hover .caret,.nav-pills .dropdown-toggle:hover .caret {  border-top-color: #005580;  border-bottom-color: #005580;}.nav-tabs .active .dropdown-toggle .caret,.nav-pills .active .dropdown-toggle .caret {  border-top-color: #333333;  border-bottom-color: #333333;}.nav > .dropdown.active > a:hover {  color: #000000;  cursor: pointer;}.nav-tabs .open .dropdown-toggle,.nav-pills .open .dropdown-toggle,.nav > li.dropdown.open.active > a:hover {  color: #ffffff;  background-color: #999999;  border-color: #999999;}.nav li.dropdown.open .caret,.nav li.dropdown.open.active .caret,.nav li.dropdown.open a:hover .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;  opacity: 1;  filter: alpha(opacity=100);}.tabs-stacked .open > a:hover {  border-color: #999999;}.tabbable {  *zoom: 1;}.tabbable:before,.tabbable:after {  display: table;  content: "";}.tabbable:after {  clear: both;}.tab-content {  overflow: auto;}.tabs-below > .nav-tabs,.tabs-right > .nav-tabs,.tabs-left > .nav-tabs {  border-bottom: 0;}.tab-content > .tab-pane,.pill-content > .pill-pane {  display: none;}.tab-content > .active,.pill-content > .active {  display: block;}.tabs-below > .nav-tabs {  border-top: 1px solid #ddd;}.tabs-below > .nav-tabs > li {  margin-top: -1px;  margin-bottom: 0;}.tabs-below > .nav-tabs > li > a {  -webkit-border-radius: 0 0 4px 4px;  -moz-border-radius: 0 0 4px 4px;  border-radius: 0 0 4px 4px;}.tabs-below > .nav-tabs > li > a:hover {  border-bottom-color: transparent;  border-top-color: #ddd;}.tabs-below > .nav-tabs > .active > a,.tabs-below > .nav-tabs > .active > a:hover {  border-color: transparent #ddd #ddd #ddd;}.tabs-left > .nav-tabs > li,.tabs-right > .nav-tabs > li {  float: none;}.tabs-left > .nav-tabs > li > a,.tabs-right > .nav-tabs > li > a {  min-width: 74px;  margin-right: 0;  margin-bottom: 3px;}.tabs-left > .nav-tabs {  float: left;  margin-right: 19px;  border-right: 1px solid #ddd;}.tabs-left > .nav-tabs > li > a {  margin-right: -1px;  -webkit-border-radius: 4px 0 0 4px;  -moz-border-radius: 4px 0 0 4px;  border-radius: 4px 0 0 4px;}.tabs-left > .nav-tabs > li > a:hover {  border-color: #eeeeee #dddddd #eeeeee #eeeeee;}.tabs-left > .nav-tabs .active > a,.tabs-left > .nav-tabs .active > a:hover {  border-color: #ddd transparent #ddd #ddd;  *border-right-color: #ffffff;}.tabs-right > .nav-tabs {  float: right;  margin-left: 19px;  border-left: 1px solid #ddd;}.tabs-right > .nav-tabs > li > a {  margin-left: -1px;  -webkit-border-radius: 0 4px 4px 0;  -moz-border-radius: 0 4px 4px 0;  border-radius: 0 4px 4px 0;}.tabs-right > .nav-tabs > li > a:hover {  border-color: #eeeeee #eeeeee #eeeeee #dddddd;}.tabs-right > .nav-tabs .active > a,.tabs-right > .nav-tabs .active > a:hover {  border-color: #ddd #ddd #ddd transparent;  *border-left-color: #ffffff;}.navbar {  *position: relative;  *z-index: 2;  overflow: visible;  margin-bottom: 18px;}.navbar-inner {  min-height: 40px;  padding-left: 20px;  padding-right: 20px;  background-color: #2c2c2c;  background-image: -moz-linear-gradient(top, #333333, #222222);  background-image: -ms-linear-gradient(top, #333333, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#333333), to(#222222));  background-image: -webkit-linear-gradient(top, #333333, #222222);  background-image: -o-linear-gradient(top, #333333, #222222);  background-image: linear-gradient(top, #333333, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#333333', endColorstr='#222222', GradientType=0);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);  -moz-box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);  box-shadow: 0 1px 3px rgba(0,0,0,.25), inset 0 -1px 0 rgba(0,0,0,.1);}.navbar .container {  width: auto;}.nav-collapse.collapse {  height: auto;}.navbar {  color: #999999;}.navbar .brand:hover {  text-decoration: none;}.navbar .brand {  float: left;  display: block;  padding: 8px 20px 12px;  margin-left: -20px;  font-size: 20px;  font-weight: 200;  line-height: 1;  color: #999999;}.navbar .navbar-text {  margin-bottom: 0;  line-height: 40px;}.navbar .navbar-link {  color: #999999;}.navbar .navbar-link:hover {  color: #ffffff;}.navbar .btn,.navbar .btn-group {  margin-top: 5px;}.navbar .btn-group .btn {  margin: 0;}.navbar-form {  margin-bottom: 0;  *zoom: 1;}.navbar-form:before,.navbar-form:after {  display: table;  content: "";}.navbar-form:after {  clear: both;}.navbar-form input,.navbar-form select,.navbar-form .radio,.navbar-form .checkbox {  margin-top: 5px;}.navbar-form input,.navbar-form select {  display: inline-block;  margin-bottom: 0;}.navbar-form input[type="image"],.navbar-form input[type="checkbox"],.navbar-form input[type="radio"] {  margin-top: 3px;}.navbar-form .input-append,.navbar-form .input-prepend {  margin-top: 6px;  white-space: nowrap;}.navbar-form .input-append input,.navbar-form .input-prepend input {  margin-top: 0;}.navbar-search {  position: relative;  float: left;  margin-top: 6px;  margin-bottom: 0;}.navbar-search .search-query {  padding: 4px 9px;  font-family: "Helvetica Neue", Helvetica, Arial, sans-serif;  font-size: 13px;  font-weight: normal;  line-height: 1;  color: #ffffff;  background-color: #626262;  border: 1px solid #151515;  -webkit-box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  -moz-box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  box-shadow: inset 0 1px 2px rgba(0,0,0,.1), 0 1px 0 rgba(255,255,255,.15);  -webkit-transition: none;  -moz-transition: none;  -ms-transition: none;  -o-transition: none;  transition: none;}.navbar-search .search-query:-moz-placeholder {  color: #cccccc;}.navbar-search .search-query:-ms-input-placeholder {  color: #cccccc;}.navbar-search .search-query::-webkit-input-placeholder {  color: #cccccc;}.navbar-search .search-query:focus,.navbar-search .search-query.focused {  padding: 5px 10px;  color: #333333;  text-shadow: 0 1px 0 #ffffff;  background-color: #ffffff;  border: 0;  -webkit-box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  -moz-box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  box-shadow: 0 0 3px rgba(0, 0, 0, 0.15);  outline: 0;}.navbar-fixed-top,.navbar-fixed-bottom {  position: fixed;  right: 0;  left: 0;  z-index: 1030;  margin-bottom: 0;}.navbar-fixed-top .navbar-inner,.navbar-fixed-bottom .navbar-inner {  padding-left: 0;  padding-right: 0;  -webkit-border-radius: 0;  -moz-border-radius: 0;  border-radius: 0;}.navbar-fixed-top .container,.navbar-fixed-bottom .container {  width: 940px;}.navbar-fixed-top {  top: 0;}.navbar-fixed-bottom {  bottom: 0;}.navbar .nav {  position: relative;  left: 0;  display: block;  float: left;  margin: 0 10px 0 0;}.navbar .nav.pull-right {  float: right;}.navbar .nav > li {  display: block;  float: left;}.navbar .nav > li > a {  float: none;  padding: 9px 10px 11px;  line-height: 19px;  color: #999999;  text-decoration: none;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);}.navbar .btn {  display: inline-block;  padding: 4px 10px 4px;  margin: 5px 5px 6px;  line-height: 18px;}.navbar .btn-group {  margin: 0;  padding: 5px 5px 6px;}.navbar .nav > li > a:hover {  background-color: transparent;  color: #ffffff;  text-decoration: none;}.navbar .nav .active > a,.navbar .nav .active > a:hover {  color: #ffffff;  text-decoration: none;  background-color: #222222;}.navbar .divider-vertical {  height: 40px;  width: 1px;  margin: 0 9px;  overflow: hidden;  background-color: #222222;  border-right: 1px solid #333333;}.navbar .nav.pull-right {  margin-left: 10px;  margin-right: 0;}.navbar .btn-navbar {  display: none;  float: right;  padding: 7px 10px;  margin-left: 5px;  margin-right: 5px;  background-color: #2c2c2c;  background-image: -moz-linear-gradient(top, #333333, #222222);  background-image: -ms-linear-gradient(top, #333333, #222222);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#333333), to(#222222));  background-image: -webkit-linear-gradient(top, #333333, #222222);  background-image: -o-linear-gradient(top, #333333, #222222);  background-image: linear-gradient(top, #333333, #222222);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#333333', endColorstr='#222222', GradientType=0);  border-color: #222222 #222222 #000000;  border-color: rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.1) rgba(0, 0, 0, 0.25);  *background-color: #222222;  /* Darken IE7 buttons by default so they stand out more given they won't have borders */  filter: progid:DXImageTransform.Microsoft.gradient(enabled = false);  -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);  -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);  box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.075);}.navbar .btn-navbar:hover,.navbar .btn-navbar:active,.navbar .btn-navbar.active,.navbar .btn-navbar.disabled,.navbar .btn-navbar[disabled] {  background-color: #222222;  *background-color: #151515;}.navbar .btn-navbar:active,.navbar .btn-navbar.active {  background-color: #080808 \9;}.navbar .btn-navbar .icon-bar {  display: block;  width: 18px;  height: 2px;  background-color: #f5f5f5;  -webkit-border-radius: 1px;  -moz-border-radius: 1px;  border-radius: 1px;  -webkit-box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);  -moz-box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);  box-shadow: 0 1px 0 rgba(0, 0, 0, 0.25);}.btn-navbar .icon-bar + .icon-bar {  margin-top: 3px;}.navbar .dropdown-menu:before {  content: '';  display: inline-block;  border-left: 7px solid transparent;  border-right: 7px solid transparent;  border-bottom: 7px solid #ccc;  border-bottom-color: rgba(0, 0, 0, 0.2);  position: absolute;  top: -7px;  left: 9px;}.navbar .dropdown-menu:after {  content: '';  display: inline-block;  border-left: 6px solid transparent;  border-right: 6px solid transparent;  border-bottom: 6px solid #ffffff;  position: absolute;  top: -6px;  left: 10px;}.navbar-fixed-bottom .dropdown-menu:before {  border-top: 7px solid #ccc;  border-top-color: rgba(0, 0, 0, 0.2);  border-bottom: 0;  bottom: -7px;  top: auto;}.navbar-fixed-bottom .dropdown-menu:after {  border-top: 6px solid #ffffff;  border-bottom: 0;  bottom: -6px;  top: auto;}.navbar .nav li.dropdown .dropdown-toggle .caret,.navbar .nav li.dropdown.open .caret {  border-top-color: #ffffff;  border-bottom-color: #ffffff;}.navbar .nav li.dropdown.active .caret {  opacity: 1;  filter: alpha(opacity=100);}.navbar .nav li.dropdown.open > .dropdown-toggle,.navbar .nav li.dropdown.active > .dropdown-toggle,.navbar .nav li.dropdown.open.active > .dropdown-toggle {  background-color: transparent;}.navbar .nav li.dropdown.active > .dropdown-toggle:hover {  color: #ffffff;}.navbar .pull-right .dropdown-menu,.navbar .dropdown-menu.pull-right {  left: auto;  right: 0;}.navbar .pull-right .dropdown-menu:before,.navbar .dropdown-menu.pull-right:before {  left: auto;  right: 12px;}.navbar .pull-right .dropdown-menu:after,.navbar .dropdown-menu.pull-right:after {  left: auto;  right: 13px;}.breadcrumb {  padding: 7px 14px;  margin: 0 0 18px;  list-style: none;  background-color: #fbfbfb;  background-image: -moz-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -ms-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ffffff), to(#f5f5f5));  background-image: -webkit-linear-gradient(top, #ffffff, #f5f5f5);  background-image: -o-linear-gradient(top, #ffffff, #f5f5f5);  background-image: linear-gradient(top, #ffffff, #f5f5f5);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ffffff', endColorstr='#f5f5f5', GradientType=0);  border: 1px solid #ddd;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;  -webkit-box-shadow: inset 0 1px 0 #ffffff;  -moz-box-shadow: inset 0 1px 0 #ffffff;  box-shadow: inset 0 1px 0 #ffffff;}.breadcrumb li {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  text-shadow: 0 1px 0 #ffffff;}.breadcrumb .divider {  padding: 0 5px;  color: #999999;}.breadcrumb .active a {  color: #333333;}.pagination {  height: 36px;  margin: 18px 0;}.pagination ul {  display: inline-block;  *display: inline;  /* IE7 inline-block hack */  *zoom: 1;  margin-left: 0;  margin-bottom: 0;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;  -webkit-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);  -moz-box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);  box-shadow: 0 1px 2px rgba(0, 0, 0, 0.05);}.pagination li {  display: inline;}.pagination a {  float: left;  padding: 0 14px;  line-height: 34px;  text-decoration: none;  border: 1px solid #ddd;  border-left-width: 0;}.pagination a:hover,.pagination .active a {  background-color: #f5f5f5;}.pagination .active a {  color: #999999;  cursor: default;}.pagination .disabled span,.pagination .disabled a,.pagination .disabled a:hover {  color: #999999;  background-color: transparent;  cursor: default;}.pagination li:first-child a {  border-left-width: 1px;  -webkit-border-radius: 3px 0 0 3px;  -moz-border-radius: 3px 0 0 3px;  border-radius: 3px 0 0 3px;}.pagination li:last-child a {  -webkit-border-radius: 0 3px 3px 0;  -moz-border-radius: 0 3px 3px 0;  border-radius: 0 3px 3px 0;}.pagination-centered {  text-align: center;}.pagination-right {  text-align: right;}.pager {  margin-left: 0;  margin-bottom: 18px;  list-style: none;  text-align: center;  *zoom: 1;}.pager:before,.pager:after {  display: table;  content: "";}.pager:after {  clear: both;}.pager li {  display: inline;}.pager a {  display: inline-block;  padding: 5px 14px;  background-color: #fff;  border: 1px solid #ddd;  -webkit-border-radius: 15px;  -moz-border-radius: 15px;  border-radius: 15px;}.pager a:hover {  text-decoration: none;  background-color: #f5f5f5;}.pager .next a {  float: right;}.pager .previous a {  float: left;}.pager .disabled a,.pager .disabled a:hover {  color: #999999;  background-color: #fff;  cursor: default;}.thumbnails {  margin-left: -20px;  list-style: none;  *zoom: 1;}.thumbnails:before,.thumbnails:after {  display: table;  content: "";}.thumbnails:after {  clear: both;}.row-fluid .thumbnails {  margin-left: 0;}.thumbnails > li {  float: left;  margin-bottom: 18px;  margin-left: 20px;}.thumbnail {  display: block;  padding: 4px;  line-height: 1;  border: 1px solid #ddd;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);  -moz-box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);  box-shadow: 0 1px 1px rgba(0, 0, 0, 0.075);}a.thumbnail:hover {  border-color: #0088cc;  -webkit-box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);  -moz-box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);  box-shadow: 0 1px 4px rgba(0, 105, 214, 0.25);}.thumbnail > img {  display: block;  max-width: 100%;  margin-left: auto;  margin-right: auto;}.thumbnail .caption {  padding: 9px;}.alert {  padding: 8px 35px 8px 14px;  margin-bottom: 18px;  text-shadow: 0 1px 0 rgba(255, 255, 255, 0.5);  background-color: #fcf8e3;  border: 1px solid #fbeed5;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  color: #c09853;}.alert-heading {  color: inherit;}.alert .close {  position: relative;  top: -2px;  right: -21px;  line-height: 18px;}.alert-success {  background-color: #dff0d8;  border-color: #d6e9c6;  color: #468847;}.alert-danger,.alert-error {  background-color: #f2dede;  border-color: #eed3d7;  color: #b94a48;}.alert-info {  background-color: #d9edf7;  border-color: #bce8f1;  color: #3a87ad;}.alert-block {  padding-top: 14px;  padding-bottom: 14px;}.alert-block > p,.alert-block > ul {  margin-bottom: 0;}.alert-block p + p {  margin-top: 5px;}@-webkit-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-moz-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-ms-keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}@-o-keyframes progress-bar-stripes {  from {    background-position: 0 0;  }  to {    background-position: 40px 0;  }}@keyframes progress-bar-stripes {  from {    background-position: 40px 0;  }  to {    background-position: 0 0;  }}.progress {  overflow: hidden;  height: 18px;  margin-bottom: 18px;  background-color: #f7f7f7;  background-image: -moz-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -ms-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#f5f5f5), to(#f9f9f9));  background-image: -webkit-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: -o-linear-gradient(top, #f5f5f5, #f9f9f9);  background-image: linear-gradient(top, #f5f5f5, #f9f9f9);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#f5f5f5', endColorstr='#f9f9f9', GradientType=0);  -webkit-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  -moz-box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  box-shadow: inset 0 1px 2px rgba(0, 0, 0, 0.1);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.progress .bar {  width: 0%;  height: 18px;  color: #ffffff;  font-size: 12px;  text-align: center;  text-shadow: 0 -1px 0 rgba(0, 0, 0, 0.25);  background-color: #0e90d2;  background-image: -moz-linear-gradient(top, #149bdf, #0480be);  background-image: -ms-linear-gradient(top, #149bdf, #0480be);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#149bdf), to(#0480be));  background-image: -webkit-linear-gradient(top, #149bdf, #0480be);  background-image: -o-linear-gradient(top, #149bdf, #0480be);  background-image: linear-gradient(top, #149bdf, #0480be);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#149bdf', endColorstr='#0480be', GradientType=0);  -webkit-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  -moz-box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  box-shadow: inset 0 -1px 0 rgba(0, 0, 0, 0.15);  -webkit-box-sizing: border-box;  -moz-box-sizing: border-box;  -ms-box-sizing: border-box;  box-sizing: border-box;  -webkit-transition: width 0.6s ease;  -moz-transition: width 0.6s ease;  -ms-transition: width 0.6s ease;  -o-transition: width 0.6s ease;  transition: width 0.6s ease;}.progress-striped .bar {  background-color: #149bdf;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  -webkit-background-size: 40px 40px;  -moz-background-size: 40px 40px;  -o-background-size: 40px 40px;  background-size: 40px 40px;}.progress.active .bar {  -webkit-animation: progress-bar-stripes 2s linear infinite;  -moz-animation: progress-bar-stripes 2s linear infinite;  -ms-animation: progress-bar-stripes 2s linear infinite;  -o-animation: progress-bar-stripes 2s linear infinite;  animation: progress-bar-stripes 2s linear infinite;}.progress-danger .bar {  background-color: #dd514c;  background-image: -moz-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -ms-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#ee5f5b), to(#c43c35));  background-image: -webkit-linear-gradient(top, #ee5f5b, #c43c35);  background-image: -o-linear-gradient(top, #ee5f5b, #c43c35);  background-image: linear-gradient(top, #ee5f5b, #c43c35);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#ee5f5b', endColorstr='#c43c35', GradientType=0);}.progress-danger.progress-striped .bar {  background-color: #ee5f5b;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-success .bar {  background-color: #5eb95e;  background-image: -moz-linear-gradient(top, #62c462, #57a957);  background-image: -ms-linear-gradient(top, #62c462, #57a957);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#62c462), to(#57a957));  background-image: -webkit-linear-gradient(top, #62c462, #57a957);  background-image: -o-linear-gradient(top, #62c462, #57a957);  background-image: linear-gradient(top, #62c462, #57a957);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#62c462', endColorstr='#57a957', GradientType=0);}.progress-success.progress-striped .bar {  background-color: #62c462;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-info .bar {  background-color: #4bb1cf;  background-image: -moz-linear-gradient(top, #5bc0de, #339bb9);  background-image: -ms-linear-gradient(top, #5bc0de, #339bb9);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#5bc0de), to(#339bb9));  background-image: -webkit-linear-gradient(top, #5bc0de, #339bb9);  background-image: -o-linear-gradient(top, #5bc0de, #339bb9);  background-image: linear-gradient(top, #5bc0de, #339bb9);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#5bc0de', endColorstr='#339bb9', GradientType=0);}.progress-info.progress-striped .bar {  background-color: #5bc0de;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.progress-warning .bar {  background-color: #faa732;  background-image: -moz-linear-gradient(top, #fbb450, #f89406);  background-image: -ms-linear-gradient(top, #fbb450, #f89406);  background-image: -webkit-gradient(linear, 0 0, 0 100%, from(#fbb450), to(#f89406));  background-image: -webkit-linear-gradient(top, #fbb450, #f89406);  background-image: -o-linear-gradient(top, #fbb450, #f89406);  background-image: linear-gradient(top, #fbb450, #f89406);  background-repeat: repeat-x;  filter: progid:DXImageTransform.Microsoft.gradient(startColorstr='#fbb450', endColorstr='#f89406', GradientType=0);}.progress-warning.progress-striped .bar {  background-color: #fbb450;  background-image: -webkit-gradient(linear, 0 100%, 100% 0, color-stop(0.25, rgba(255, 255, 255, 0.15)), color-stop(0.25, transparent), color-stop(0.5, transparent), color-stop(0.5, rgba(255, 255, 255, 0.15)), color-stop(0.75, rgba(255, 255, 255, 0.15)), color-stop(0.75, transparent), to(transparent));  background-image: -webkit-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -moz-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -ms-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: -o-linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);  background-image: linear-gradient(-45deg, rgba(255, 255, 255, 0.15) 25%, transparent 25%, transparent 50%, rgba(255, 255, 255, 0.15) 50%, rgba(255, 255, 255, 0.15) 75%, transparent 75%, transparent);}.hero-unit {  padding: 60px;  margin-bottom: 30px;  background-color: #eeeeee;  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;}.hero-unit h1 {  margin-bottom: 0;  font-size: 60px;  line-height: 1;  color: inherit;  letter-spacing: -1px;}.hero-unit p {  font-size: 18px;  font-weight: 200;  line-height: 27px;  color: inherit;}.tooltip {  position: absolute;  z-index: 1020;  display: block;  visibility: visible;  padding: 5px;  font-size: 11px;  opacity: 0;  filter: alpha(opacity=0);}.tooltip.in {  opacity: 0.8;  filter: alpha(opacity=80);}.tooltip.top {  margin-top: -2px;}.tooltip.right {  margin-left: 2px;}.tooltip.bottom {  margin-top: 2px;}.tooltip.left {  margin-left: -2px;}.tooltip.top .tooltip-arrow {  bottom: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-top: 5px solid #000000;}.tooltip.left .tooltip-arrow {  top: 50%;  right: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-left: 5px solid #000000;}.tooltip.bottom .tooltip-arrow {  top: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-bottom: 5px solid #000000;}.tooltip.right .tooltip-arrow {  top: 50%;  left: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-right: 5px solid #000000;}.tooltip-inner {  max-width: 200px;  padding: 3px 8px;  color: #ffffff;  text-align: center;  text-decoration: none;  background-color: #000000;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.tooltip-arrow {  position: absolute;  width: 0;  height: 0;}.popover {  position: absolute;  top: 0;  left: 0;  z-index: 1010;  display: none;  padding: 5px;}.popover.top {  margin-top: -5px;}.popover.right {  margin-left: 5px;}.popover.bottom {  margin-top: 5px;}.popover.left {  margin-left: -5px;}.popover.top .arrow {  bottom: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-top: 5px solid #000000;}.popover.right .arrow {  top: 50%;  left: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-right: 5px solid #000000;}.popover.bottom .arrow {  top: 0;  left: 50%;  margin-left: -5px;  border-left: 5px solid transparent;  border-right: 5px solid transparent;  border-bottom: 5px solid #000000;}.popover.left .arrow {  top: 50%;  right: 0;  margin-top: -5px;  border-top: 5px solid transparent;  border-bottom: 5px solid transparent;  border-left: 5px solid #000000;}.popover .arrow {  position: absolute;  width: 0;  height: 0;}.popover-inner {  padding: 3px;  width: 280px;  overflow: hidden;  background: #000000;  background: rgba(0, 0, 0, 0.8);  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;  -webkit-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -moz-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);}.popover-title {  padding: 9px 15px;  line-height: 1;  background-color: #f5f5f5;  border-bottom: 1px solid #eee;  -webkit-border-radius: 3px 3px 0 0;  -moz-border-radius: 3px 3px 0 0;  border-radius: 3px 3px 0 0;}.popover-content {  padding: 14px;  background-color: #ffffff;  -webkit-border-radius: 0 0 3px 3px;  -moz-border-radius: 0 0 3px 3px;  border-radius: 0 0 3px 3px;  -webkit-background-clip: padding-box;  -moz-background-clip: padding-box;  background-clip: padding-box;}.popover-content p,.popover-content ul,.popover-content ol {  margin-bottom: 0;}.modal-open .dropdown-menu {  z-index: 2050;}.modal-open .dropdown.open {  *z-index: 2050;}.modal-open .popover {  z-index: 2060;}.modal-open .tooltip {  z-index: 2070;}.modal-backdrop {  position: fixed;  top: 0;  right: 0;  bottom: 0;  left: 0;  z-index: 1040;  background-color: #000000;}.modal-backdrop.fade {  opacity: 0;}.modal-backdrop,.modal-backdrop.fade.in {  opacity: 0.8;  filter: alpha(opacity=80);}.modal {  position: fixed;  top: 50%;  left: 50%;  z-index: 1050;  overflow: auto;  width: 560px;  margin: -250px 0 0 -280px;  background-color: #ffffff;  border: 1px solid #999;  border: 1px solid rgba(0, 0, 0, 0.3);  *border: 1px solid #999;  /* IE6-7 */  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;  -webkit-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -moz-box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  box-shadow: 0 3px 7px rgba(0, 0, 0, 0.3);  -webkit-background-clip: padding-box;  -moz-background-clip: padding-box;  background-clip: padding-box;}.modal.fade {  -webkit-transition: opacity .3s linear, top .3s ease-out;  -moz-transition: opacity .3s linear, top .3s ease-out;  -ms-transition: opacity .3s linear, top .3s ease-out;  -o-transition: opacity .3s linear, top .3s ease-out;  transition: opacity .3s linear, top .3s ease-out;  top: -25%;}.modal.fade.in {  top: 50%;}.modal-header {  padding: 9px 15px;  border-bottom: 1px solid #eee;}.modal-header .close {  margin-top: 2px;}.modal-body {  overflow-y: auto;  max-height: 400px;  padding: 15px;}.modal-form {  margin-bottom: 0;}.modal-footer {  padding: 14px 15px 15px;  margin-bottom: 0;  text-align: right;  background-color: #f5f5f5;  border-top: 1px solid #ddd;  -webkit-border-radius: 0 0 6px 6px;  -moz-border-radius: 0 0 6px 6px;  border-radius: 0 0 6px 6px;  -webkit-box-shadow: inset 0 1px 0 #ffffff;  -moz-box-shadow: inset 0 1px 0 #ffffff;  box-shadow: inset 0 1px 0 #ffffff;  *zoom: 1;}.modal-footer:before,.modal-footer:after {  display: table;  content: "";}.modal-footer:after {  clear: both;}.modal-footer .btn + .btn {  margin-left: 5px;  margin-bottom: 0;}.modal-footer .btn-group .btn + .btn {  margin-left: -1px;}.dropup,.dropdown {  position: relative;}.dropdown-toggle {  *margin-bottom: -3px;}.dropdown-toggle:active,.open .dropdown-toggle {  outline: 0;}.caret {  display: inline-block;  width: 0;  height: 0;  vertical-align: top;  border-top: 4px solid #000000;  border-right: 4px solid transparent;  border-left: 4px solid transparent;  content: "";  opacity: 0.3;  filter: alpha(opacity=30);}.dropdown .caret {  margin-top: 8px;  margin-left: 2px;}.dropdown:hover .caret,.open .caret {  opacity: 1;  filter: alpha(opacity=100);}.dropdown-menu {  position: absolute;  top: 100%;  left: 0;  z-index: 1000;  display: none;  float: left;  min-width: 160px;  padding: 4px 0;  margin: 1px 0 0;  list-style: none;  background-color: #ffffff;  border: 1px solid #ccc;  border: 1px solid rgba(0, 0, 0, 0.2);  *border-right-width: 2px;  *border-bottom-width: 2px;  -webkit-border-radius: 5px;  -moz-border-radius: 5px;  border-radius: 5px;  -webkit-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  -moz-box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  box-shadow: 0 5px 10px rgba(0, 0, 0, 0.2);  -webkit-background-clip: padding-box;  -moz-background-clip: padding;  background-clip: padding-box;}.dropdown-menu.pull-right {  right: 0;  left: auto;}.dropdown-menu .divider {  *width: 100%;  height: 1px;  margin: 8px 1px;  *margin: -5px 0 5px;  overflow: hidden;  background-color: #e5e5e5;  border-bottom: 1px solid #ffffff;}.dropdown-menu a {  display: block;  padding: 3px 15px;  clear: both;  font-weight: normal;  line-height: 18px;  color: #333333;  white-space: nowrap;}.dropdown-menu li > a:hover,.dropdown-menu .active > a,.dropdown-menu .active > a:hover {  color: #ffffff;  text-decoration: none;  background-color: #0088cc;}.open {  *z-index: 1000;}.open  > .dropdown-menu {  display: block;}.pull-right > .dropdown-menu {  right: 0;  left: auto;}.dropup .caret,.navbar-fixed-bottom .dropdown .caret {  border-top: 0;  border-bottom: 4px solid #000000;  content: "\2191";}.dropup .dropdown-menu,.navbar-fixed-bottom .dropdown .dropdown-menu {  top: auto;  bottom: 100%;  margin-bottom: 1px;}.typeahead {  margin-top: 2px;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.accordion {  margin-bottom: 18px;}.accordion-group {  margin-bottom: 2px;  border: 1px solid #e5e5e5;  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;}.accordion-heading {  border-bottom: 0;}.accordion-heading .accordion-toggle {  display: block;  padding: 8px 15px;}.accordion-toggle {  cursor: pointer;}.accordion-inner {  padding: 9px 15px;  border-top: 1px solid #e5e5e5;}.carousel {  position: relative;  margin-bottom: 18px;  line-height: 1;}.carousel-inner {  overflow: hidden;  width: 100%;  position: relative;}.carousel .item {  display: none;  position: relative;  -webkit-transition: 0.6s ease-in-out left;  -moz-transition: 0.6s ease-in-out left;  -ms-transition: 0.6s ease-in-out left;  -o-transition: 0.6s ease-in-out left;  transition: 0.6s ease-in-out left;}.carousel .item > img {  display: block;  line-height: 1;}.carousel .active,.carousel .next,.carousel .prev {  display: block;}.carousel .active {  left: 0;}.carousel .next,.carousel .prev {  position: absolute;  top: 0;  width: 100%;}.carousel .next {  left: 100%;}.carousel .prev {  left: -100%;}.carousel .next.left,.carousel .prev.right {  left: 0;}.carousel .active.left {  left: -100%;}.carousel .active.right {  left: 100%;}.carousel-control {  position: absolute;  top: 40%;  left: 15px;  width: 40px;  height: 40px;  margin-top: -20px;  font-size: 60px;  font-weight: 100;  line-height: 30px;  color: #ffffff;  text-align: center;  background: #222222;  border: 3px solid #ffffff;  -webkit-border-radius: 23px;  -moz-border-radius: 23px;  border-radius: 23px;  opacity: 0.5;  filter: alpha(opacity=50);}.carousel-control.right {  left: auto;  right: 15px;}.carousel-control:hover {  color: #ffffff;  text-decoration: none;  opacity: 0.9;  filter: alpha(opacity=90);}.carousel-caption {  position: absolute;  left: 0;  right: 0;  bottom: 0;  padding: 10px 15px 5px;  background: #333333;  background: rgba(0, 0, 0, 0.75);}.carousel-caption h4,.carousel-caption p {  color: #ffffff;}.well {  min-height: 20px;  padding: 19px;  margin-bottom: 20px;  background-color: #f5f5f5;  border: 1px solid #eee;  border: 1px solid rgba(0, 0, 0, 0.05);  -webkit-border-radius: 4px;  -moz-border-radius: 4px;  border-radius: 4px;  -webkit-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);  -moz-box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);  box-shadow: inset 0 1px 1px rgba(0, 0, 0, 0.05);}.well blockquote {  border-color: #ddd;  border-color: rgba(0, 0, 0, 0.15);}.well-large {  padding: 24px;  -webkit-border-radius: 6px;  -moz-border-radius: 6px;  border-radius: 6px;}.well-small {  padding: 9px;  -webkit-border-radius: 3px;  -moz-border-radius: 3px;  border-radius: 3px;}.close {  float: right;  font-size: 20px;  font-weight: bold;  line-height: 18px;  color: #000000;  text-shadow: 0 1px 0 #ffffff;  opacity: 0.2;  filter: alpha(opacity=20);}.close:hover {  color: #000000;  text-decoration: none;  cursor: pointer;  opacity: 0.4;  filter: alpha(opacity=40);}button.close {  padding: 0;  cursor: pointer;  background: transparent;  border: 0;  -webkit-appearance: none;}.pull-right {  float: right;}.pull-left {  float: left;}.hide {  display: none;}.show {  display: block;}.invisible {  visibility: hidden;}.fade {  opacity: 0;  -webkit-transition: opacity 0.15s linear;  -moz-transition: opacity 0.15s linear;  -ms-transition: opacity 0.15s linear;  -o-transition: opacity 0.15s linear;  transition: opacity 0.15s linear;}.fade.in {  opacity: 1;}.collapse {  position: relative;  height: 0;  overflow: hidden;  -webkit-transition: height 0.35s ease;  -moz-transition: height 0.35s ease;  -ms-transition: height 0.35s ease;  -o-transition: height 0.35s ease;  transition: height 0.35s ease;}.collapse.in {  height: auto;}.hidden {  display: none;  visibility: hidden;}.visible-phone {  display: none !important;}.visible-tablet {  display: none !important;}.hidden-desktop {  display: none !important;}@media (max-width: 767px) {  .visible-phone {    display: inherit !important;  }  .hidden-phone {    display: none !important;  }  .hidden-desktop {    display: inherit !important;  }  .visible-desktop {    display: none !important;  }}@media (min-width: 768px) and (max-width: 979px) {  .visible-tablet {    display: inherit !important;  }  .hidden-tablet {    display: none !important;  }  .hidden-desktop {    display: inherit !important;  }  .visible-desktop {    display: none !important ;  }}@media (max-width: 480px) {  .nav-collapse {    -webkit-transform: translate3d(0, 0, 0);  }  .page-header h1 small {    display: block;    line-height: 18px;  }  input[type="checkbox"],  input[type="radio"] {    border: 1px solid #ccc;  }  .form-horizontal .control-group > label {    float: none;    width: auto;    padding-top: 0;    text-align: left;  }  .form-horizontal .controls {    margin-left: 0;  }  .form-horizontal .control-list {    padding-top: 0;  }  .form-horizontal .form-actions {    padding-left: 10px;    padding-right: 10px;  }  .modal {    position: absolute;    top: 10px;    left: 10px;    right: 10px;    width: auto;    margin: 0;  }  .modal.fade.in {    top: auto;  }  .modal-header .close {    padding: 10px;    margin: -10px;  }  .carousel-caption {    position: static;  }}@media (max-width: 767px) {  body {    padding-left: 20px;    padding-right: 20px;  }  .navbar-fixed-top,  .navbar-fixed-bottom {    margin-left: -20px;    margin-right: -20px;  }  .container-fluid {    padding: 0;  }  .dl-horizontal dt {    float: none;    clear: none;    width: auto;    text-align: left;  }  .dl-horizontal dd {    margin-left: 0;  }  .container {    width: auto;  }  .row-fluid {    width: 100%;  }  .row,  .thumbnails {    margin-left: 0;  }  [class*="span"],  .row-fluid [class*="span"] {    float: none;    display: block;    width: auto;    margin-left: 0;  }  .input-large,  .input-xlarge,  .input-xxlarge,  input[class*="span"],  select[class*="span"],  textarea[class*="span"],  .uneditable-input {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;  }  .input-prepend input,  .input-append input,  .input-prepend input[class*="span"],  .input-append input[class*="span"] {    display: inline-block;    width: auto;  }}@media (min-width: 768px) and (max-width: 979px) {  .row {    margin-left: -20px;    *zoom: 1;  }  .row:before,  .row:after {    display: table;    content: "";  }  .row:after {    clear: both;  }  [class*="span"] {    float: left;    margin-left: 20px;  }  .container,  .navbar-fixed-top .container,  .navbar-fixed-bottom .container {    width: 724px;  }  .span12 {    width: 724px;  }  .span11 {    width: 662px;  }  .span10 {    width: 600px;  }  .span9 {    width: 538px;  }  .span8 {    width: 476px;  }  .span7 {    width: 414px;  }  .span6 {    width: 352px;  }  .span5 {    width: 290px;  }  .span4 {    width: 228px;  }  .span3 {    width: 166px;  }  .span2 {    width: 104px;  }  .span1 {    width: 42px;  }  .offset12 {    margin-left: 764px;  }  .offset11 {    margin-left: 702px;  }  .offset10 {    margin-left: 640px;  }  .offset9 {    margin-left: 578px;  }  .offset8 {    margin-left: 516px;  }  .offset7 {    margin-left: 454px;  }  .offset6 {    margin-left: 392px;  }  .offset5 {    margin-left: 330px;  }  .offset4 {    margin-left: 268px;  }  .offset3 {    margin-left: 206px;  }  .offset2 {    margin-left: 144px;  }  .offset1 {    margin-left: 82px;  }  .row-fluid {    width: 100%;    *zoom: 1;  }  .row-fluid:before,  .row-fluid:after {    display: table;    content: "";  }  .row-fluid:after {    clear: both;  }  .row-fluid [class*="span"] {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;    float: left;    margin-left: 2.762430939%;    *margin-left: 2.709239449638298%;  }  .row-fluid [class*="span"]:first-child {    margin-left: 0;  }  .row-fluid .span12 {    width: 99.999999993%;    *width: 99.9468085036383%;  }  .row-fluid .span11 {    width: 91.436464082%;    *width: 91.38327259263829%;  }  .row-fluid .span10 {    width: 82.87292817100001%;    *width: 82.8197366816383%;  }  .row-fluid .span9 {    width: 74.30939226%;    *width: 74.25620077063829%;  }  .row-fluid .span8 {    width: 65.74585634900001%;    *width: 65.6926648596383%;  }  .row-fluid .span7 {    width: 57.182320438000005%;    *width: 57.129128948638304%;  }  .row-fluid .span6 {    width: 48.618784527%;    *width: 48.5655930376383%;  }  .row-fluid .span5 {    width: 40.055248616%;    *width: 40.0020571266383%;  }  .row-fluid .span4 {    width: 31.491712705%;    *width: 31.4385212156383%;  }  .row-fluid .span3 {    width: 22.928176794%;    *width: 22.874985304638297%;  }  .row-fluid .span2 {    width: 14.364640883%;    *width: 14.311449393638298%;  }  .row-fluid .span1 {    width: 5.801104972%;    *width: 5.747913482638298%;  }  input,  textarea,  .uneditable-input {    margin-left: 0;  }  input.span12, textarea.span12, .uneditable-input.span12 {    width: 714px;  }  input.span11, textarea.span11, .uneditable-input.span11 {    width: 652px;  }  input.span10, textarea.span10, .uneditable-input.span10 {    width: 590px;  }  input.span9, textarea.span9, .uneditable-input.span9 {    width: 528px;  }  input.span8, textarea.span8, .uneditable-input.span8 {    width: 466px;  }  input.span7, textarea.span7, .uneditable-input.span7 {    width: 404px;  }  input.span6, textarea.span6, .uneditable-input.span6 {    width: 342px;  }  input.span5, textarea.span5, .uneditable-input.span5 {    width: 280px;  }  input.span4, textarea.span4, .uneditable-input.span4 {    width: 218px;  }  input.span3, textarea.span3, .uneditable-input.span3 {    width: 156px;  }  input.span2, textarea.span2, .uneditable-input.span2 {    width: 94px;  }  input.span1, textarea.span1, .uneditable-input.span1 {    width: 32px;  }}@media (min-width: 1200px) {  .row {    margin-left: -30px;    *zoom: 1;  }  .row:before,  .row:after {    display: table;    content: "";  }  .row:after {    clear: both;  }  [class*="span"] {    float: left;    margin-left: 30px;  }  .container,  .navbar-fixed-top .container,  .navbar-fixed-bottom .container {    width: 1170px;  }  .span12 {    width: 1170px;  }  .span11 {    width: 1070px;  }  .span10 {    width: 970px;  }  .span9 {    width: 870px;  }  .span8 {    width: 770px;  }  .span7 {    width: 670px;  }  .span6 {    width: 570px;  }  .span5 {    width: 470px;  }  .span4 {    width: 370px;  }  .span3 {    width: 270px;  }  .span2 {    width: 170px;  }  .span1 {    width: 70px;  }  .offset12 {    margin-left: 1230px;  }  .offset11 {    margin-left: 1130px;  }  .offset10 {    margin-left: 1030px;  }  .offset9 {    margin-left: 930px;  }  .offset8 {    margin-left: 830px;  }  .offset7 {    margin-left: 730px;  }  .offset6 {    margin-left: 630px;  }  .offset5 {    margin-left: 530px;  }  .offset4 {    margin-left: 430px;  }  .offset3 {    margin-left: 330px;  }  .offset2 {    margin-left: 230px;  }  .offset1 {    margin-left: 130px;  }  .row-fluid {    width: 100%;    *zoom: 1;  }  .row-fluid:before,  .row-fluid:after {    display: table;    content: "";  }  .row-fluid:after {    clear: both;  }  .row-fluid [class*="span"] {    display: block;    width: 100%;    min-height: 28px;    -webkit-box-sizing: border-box;    -moz-box-sizing: border-box;    -ms-box-sizing: border-box;    box-sizing: border-box;    float: left;    margin-left: 2.564102564%;    *margin-left: 2.510911074638298%;  }  .row-fluid [class*="span"]:first-child {    margin-left: 0;  }  .row-fluid .span12 {    width: 100%;    *width: 99.94680851063829%;  }  .row-fluid .span11 {    width: 91.45299145300001%;    *width: 91.3997999636383%;  }  .row-fluid .span10 {    width: 82.905982906%;    *width: 82.8527914166383%;  }  .row-fluid .span9 {    width: 74.358974359%;    *width: 74.30578286963829%;  }  .row-fluid .span8 {    width: 65.81196581200001%;    *width: 65.7587743226383%;  }  .row-fluid .span7 {    width: 57.264957265%;    *width: 57.2117657756383%;  }  .row-fluid .span6 {    width: 48.717948718%;    *width: 48.6647572286383%;  }  .row-fluid .span5 {    width: 40.170940171000005%;    *width: 40.117748681638304%;  }  .row-fluid .span4 {    width: 31.623931624%;    *width: 31.5707401346383%;  }  .row-fluid .span3 {    width: 23.076923077%;    *width: 23.0237315876383%;  }  .row-fluid .span2 {    width: 14.529914530000001%;    *width: 14.4767230406383%;  }  .row-fluid .span1 {    width: 5.982905983%;    *width: 5.929714493638298%;  }  input,  textarea,  .uneditable-input {    margin-left: 0;  }  input.span12, textarea.span12, .uneditable-input.span12 {    width: 1160px;  }  input.span11, textarea.span11, .uneditable-input.span11 {    width: 1060px;  }  input.span10, textarea.span10, .uneditable-input.span10 {    width: 960px;  }  input.span9, textarea.span9, .uneditable-input.span9 {    width: 860px;  }  input.span8, textarea.span8, .uneditable-input.span8 {    width: 760px;  }  input.span7, textarea.span7, .uneditable-input.span7 {    width: 660px;  }  input.span6, textarea.span6, .uneditable-input.span6 {    width: 560px;  }  input.span5, textarea.span5, .uneditable-input.span5 {    width: 460px;  }  input.span4, textarea.span4, .uneditable-input.span4 {    width: 360px;  }  input.span3, textarea.span3, .uneditable-input.span3 {    width: 260px;  }  input.span2, textarea.span2, .uneditable-input.span2 {    width: 160px;  }  input.span1, textarea.span1, .uneditable-input.span1 {    width: 60px;  }  .thumbnails {    margin-left: -30px;  }  .thumbnails > li {    margin-left: 30px;  }  .row-fluid .thumbnails {    margin-left: 0;  }}@media (max-width: 979px) {  body {    padding-top: 0;  }  .navbar-fixed-top,  .navbar-fixed-bottom {    position: static;  }  .navbar-fixed-top {    margin-bottom: 18px;  }  .navbar-fixed-bottom {    margin-top: 18px;  }  .navbar-fixed-top .navbar-inner,  .navbar-fixed-bottom .navbar-inner {    padding: 5px;  }  .navbar .container {    width: auto;    padding: 0;  }  .navbar .brand {    padding-left: 10px;    padding-right: 10px;    margin: 0 0 0 -5px;  }  .nav-collapse {    clear: both;  }  .nav-collapse .nav {    float: none;    margin: 0 0 9px;  }  .nav-collapse .nav > li {    float: none;  }  .nav-collapse .nav > li > a {    margin-bottom: 2px;  }  .nav-collapse .nav > .divider-vertical {    display: none;  }  .nav-collapse .nav .nav-header {    color: #999999;    text-shadow: none;  }  .nav-collapse .nav > li > a,  .nav-collapse .dropdown-menu a {    padding: 6px 15px;    font-weight: bold;    color: #999999;    -webkit-border-radius: 3px;    -moz-border-radius: 3px;    border-radius: 3px;  }  .nav-collapse .btn {    padding: 4px 10px 4px;    font-weight: normal;    -webkit-border-radius: 4px;    -moz-border-radius: 4px;    border-radius: 4px;  }  .nav-collapse .dropdown-menu li + li a {    margin-bottom: 2px;  }  .nav-collapse .nav > li > a:hover,  .nav-collapse .dropdown-menu a:hover {    background-color: #222222;  }  .nav-collapse.in .btn-group {    margin-top: 5px;    padding: 0;  }  .nav-collapse .dropdown-menu {    position: static;    top: auto;    left: auto;    float: none;    display: block;    max-width: none;    margin: 0 15px;    padding: 0;    background-color: transparent;    border: none;    -webkit-border-radius: 0;    -moz-border-radius: 0;    border-radius: 0;    -webkit-box-shadow: none;    -moz-box-shadow: none;    box-shadow: none;  }  .nav-collapse .dropdown-menu:before,  .nav-collapse .dropdown-menu:after {    display: none;  }  .nav-collapse .dropdown-menu .divider {    display: none;  }  .nav-collapse .navbar-form,  .nav-collapse .navbar-search {    float: none;    padding: 9px 15px;    margin: 9px 0;    border-top: 1px solid #222222;    border-bottom: 1px solid #222222;    -webkit-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);    -moz-box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);    box-shadow: inset 0 1px 0 rgba(255,255,255,.1), 0 1px 0 rgba(255,255,255,.1);  }  .navbar .nav-collapse .nav.pull-right {    float: none;    margin-left: 0;  }  .nav-collapse,  .nav-collapse.collapse {    overflow: hidden;    height: 0;  }  .navbar .btn-navbar {    display: block;  }  .navbar-static .navbar-inner {    padding-left: 10px;    padding-right: 10px;  }}@media (min-width: 980px) {  .nav-collapse.collapse {    height: auto !important;    overflow: visible !important;  }}

    Read the article

  • NGINX MIME TYPE

    - by justanotherprogrammer
    I have my nginx conf file so that when ever a mobile device visits my site the url gets rewritten to m.mysite.com I did it by adding the following set $mobile_rewrite do_not_perform; if ($http_user_agent ~* "android.+mobile|avantgo|bada\/|blackberry|blazer|compal|elaine|fennec|hiptop|iemobile|ip(hone|od)|iris|kindle|lge |maemo|midp|mmp|netfront|opera m(ob|in)i|palm( os)?|phone|p(ixi|re)\/|plucker|pocket|psp|symbian|treo|up\.(browser|link)|vodafone|wap|windows (ce|phone)|xda|xiino") { set $mobile_rewrite perform; } if ($http_user_agent ~* "^(1207|6310|6590|3gso|4thp|50[1-6]i|770s|802s|a wa|abac|ac(er|oo|s\-)|ai(ko|rn)|al(av|ca|co)|amoi|an(ex|ny|yw)|aptu|ar(ch|go)|as(te|us)|attw|au(di|\-m|r |s )|avan|be(ck|ll|nq)|bi(lb|rd)|bl(ac|az)|br(e|v)w|bumb|bw\-(n|u)|c55\/|capi|ccwa|cdm\-|cell|chtm|cldc|cmd\-|co(mp|nd)|craw|da(it|ll|ng)|dbte|dc\-s|devi|dica|dmob|do(c|p)o|ds(12|\-d)|el(49|ai)|em(l2|ul)|er(ic|k0)|esl8|ez([4-7]0|os|wa|ze)|fetc|fly(\-|_)|g1 u|g560|gene|gf\-5|g\-mo|go(\.w|od)|gr(ad|un)|haie|hcit|hd\-(m|p|t)|hei\-|hi(pt|ta)|hp( i|ip)|hs\-c|ht(c(\-| |_|a|g|p|s|t)|tp)|hu(aw|tc)|i\-(20|go|ma)|i230|iac( |\-|\/)|ibro|idea|ig01|ikom|im1k|inno|ipaq|iris|ja(t|v)a|jbro|jemu|jigs|kddi|keji|kgt( |\/)|klon|kpt |kwc\-|kyo(c|k)|le(no|xi)|lg( g|\/(k|l|u)|50|54|e\-|e\/|\-[a-w])|libw|lynx|m1\-w|m3ga|m50\/|ma(te|ui|xo)|mc(01|21|ca)|m\-cr|me(di|rc|ri)|mi(o8|oa|ts)|mmef|mo(01|02|bi|de|do|t(\-| |o|v)|zz)|mt(50|p1|v )|mwbp|mywa|n10[0-2]|n20[2-3]|n30(0|2)|n50(0|2|5)|n7(0(0|1)|10)|ne((c|m)\-|on|tf|wf|wg|wt)|nok(6|i)|nzph|o2im|op(ti|wv)|oran|owg1|p800|pan(a|d|t)|pdxg|pg(13|\-([1-8]|c))|phil|pire|pl(ay|uc)|pn\-2|po(ck|rt|se)|prox|psio|pt\-g|qa\-a|qc(07|12|21|32|60|\-[2-7]|i\-)|qtek|r380|r600|raks|rim9|ro(ve|zo)|s55\/|sa(ge|ma|mm|ms|ny|va)|sc(01|h\-|oo|p\-)|sdk\/|se(c(\-|0|1)|47|mc|nd|ri)|sgh\-|shar|sie(\-|m)|sk\-0|sl(45|id)|sm(al|ar|b3|it|t5)|so(ft|ny)|sp(01|h\-|v\-|v )|sy(01|mb)|t2(18|50)|t6(00|10|18)|ta(gt|lk)|tcl\-|tdg\-|tel(i|m)|tim\-|t\-mo|to(pl|sh)|ts(70|m\-|m3|m5)|tx\-9|up(\.b|g1|si)|utst|v400|v750|veri|vi(rg|te)|vk(40|5[0-3]|\-v)|vm40|voda|vulc|vx(52|53|60|61|70|80|81|83|85|98)|w3c(\-| )|webc|whit|wi(g |nc|nw)|wmlb|wonu|x700|xda(\-|2|g)|yas\-|your|zeto|zte\-)") { set $mobile_rewrite perform; } if ($mobile_rewrite = perform) { rewrite ^ http://m.mywebsite.com redirect; break; } I got it from http://detectmobilebrowsers.com/ IT WORKS.But none of my images/js/css files load only the HTML. And I know its the chunk of code I mentioned above because when I remove it and visit m.mywebsite.com from my mobile device everything loads up.So this bit of code does SOMETHING to my css/img/js MIME TYPES. I found this out through the the console error messages from safari with the user agent set to iphone. text.cssResource interpreted as stylesheet but transferred with MIME type text/html. 960_16_col.cssResource interpreted as stylesheet but transferred with MIME type text/html. design.cssResource interpreted as stylesheet but transferred with MIME type text/html. navigation_menu.cssResource interpreted as stylesheet but transferred with MIME type text/html. reset.cssResource interpreted as stylesheet but transferred with MIME type text/html. slide_down_panel.cssResource interpreted as stylesheet but transferred with MIME type text/html. myrealtorpage_view.cssResource interpreted as stylesheet but transferred with MIME type text/html. head.jsResource interpreted as script but transferred with MIME type text/html. head.js:1SyntaxError: Parse error isaac:208ReferenceError: Can't find variable: head mrp_home_icon.pngResource interpreted as image but transferred with MIME type text/html. M_1_L_289_I_499_default_thumb.jpgResource interpreted as image but transferred with MIME type text/html. M_1_L_290_I_500_default_thumb.jpgResource interpreted as image but transferred with MIME type text/html. M_1_default.jpgResource interpreted as image but transferred with MIME type text/html. default_listing_image.pngResource interpreted as image but transferred with MIME type text/html. here is my whole nginx conf file just incase... worker_processes 1; events { worker_connections 1024; } http { include mime.types; include /etc/nginx/conf/fastcgi.conf; default_type application/octet-stream; sendfile on; keepalive_timeout 65; #server1 server { listen 80; server_name mywebsite.com www.mywebsite.com ; index index.html index.htm index.php; root /srv/http/mywebsite.com/public; access_log /srv/http/mywebsite.com/logs/access.log; error_log /srv/http/mywebsite.com/logs/error.log; #---------------- For CodeIgniter ----------------# # canonicalize codeigniter url end points # if your default controller is something other than "welcome" you should change the following if ($request_uri ~* ^(/main(/index)?|/index(.php)?)/?$) { rewrite ^(.*)$ / permanent; } # removes trailing "index" from all controllers if ($request_uri ~* index/?$) { rewrite ^/(.*)/index/?$ /$1 permanent; } # removes trailing slashes (prevents SEO duplicate content issues) if (!-d $request_filename) { rewrite ^/(.+)/$ /$1 permanent; } # unless the request is for a valid file (image, js, css, etc.), send to bootstrap if (!-e $request_filename) { rewrite ^/(.*)$ /index.php?/$1 last; break; } #---------------------------------------------------# #--------------- For Mobile Devices ----------------# set $mobile_rewrite do_not_perform; if ($http_user_agent ~* "android.+mobile|avantgo|bada\/|blackberry|blazer|compal|elaine|fennec|hiptop|iemobile|ip(hone|od)|iris|kindle|lge |maemo|midp|mmp|netfront|opera m(ob|in)i|palm( os)?|phone|p(ixi|re)\/|plucker|pocket|psp|symbian|treo|up\.(browser|link)|vodafone|wap|windows (ce|phone)|xda|xiino") { set $mobile_rewrite perform; } if ($http_user_agent ~* "^(1207|6310|6590|3gso|4thp|50[1-6]i|770s|802s|a wa|abac|ac(er|oo|s\-)|ai(ko|rn)|al(av|ca|co)|amoi|an(ex|ny|yw)|aptu|ar(ch|go)|as(te|us)|attw|au(di|\-m|r |s )|avan|be(ck|ll|nq)|bi(lb|rd)|bl(ac|az)|br(e|v)w|bumb|bw\-(n|u)|c55\/|capi|ccwa|cdm\-|cell|chtm|cldc|cmd\-|co(mp|nd)|craw|da(it|ll|ng)|dbte|dc\-s|devi|dica|dmob|do(c|p)o|ds(12|\-d)|el(49|ai)|em(l2|ul)|er(ic|k0)|esl8|ez([4-7]0|os|wa|ze)|fetc|fly(\-|_)|g1 u|g560|gene|gf\-5|g\-mo|go(\.w|od)|gr(ad|un)|haie|hcit|hd\-(m|p|t)|hei\-|hi(pt|ta)|hp( i|ip)|hs\-c|ht(c(\-| |_|a|g|p|s|t)|tp)|hu(aw|tc)|i\-(20|go|ma)|i230|iac( |\-|\/)|ibro|idea|ig01|ikom|im1k|inno|ipaq|iris|ja(t|v)a|jbro|jemu|jigs|kddi|keji|kgt( |\/)|klon|kpt |kwc\-|kyo(c|k)|le(no|xi)|lg( g|\/(k|l|u)|50|54|e\-|e\/|\-[a-w])|libw|lynx|m1\-w|m3ga|m50\/|ma(te|ui|xo)|mc(01|21|ca)|m\-cr|me(di|rc|ri)|mi(o8|oa|ts)|mmef|mo(01|02|bi|de|do|t(\-| |o|v)|zz)|mt(50|p1|v )|mwbp|mywa|n10[0-2]|n20[2-3]|n30(0|2)|n50(0|2|5)|n7(0(0|1)|10)|ne((c|m)\-|on|tf|wf|wg|wt)|nok(6|i)|nzph|o2im|op(ti|wv)|oran|owg1|p800|pan(a|d|t)|pdxg|pg(13|\-([1-8]|c))|phil|pire|pl(ay|uc)|pn\-2|po(ck|rt|se)|prox|psio|pt\-g|qa\-a|qc(07|12|21|32|60|\-[2-7]|i\-)|qtek|r380|r600|raks|rim9|ro(ve|zo)|s55\/|sa(ge|ma|mm|ms|ny|va)|sc(01|h\-|oo|p\-)|sdk\/|se(c(\-|0|1)|47|mc|nd|ri)|sgh\-|shar|sie(\-|m)|sk\-0|sl(45|id)|sm(al|ar|b3|it|t5)|so(ft|ny)|sp(01|h\-|v\-|v )|sy(01|mb)|t2(18|50)|t6(00|10|18)|ta(gt|lk)|tcl\-|tdg\-|tel(i|m)|tim\-|t\-mo|to(pl|sh)|ts(70|m\-|m3|m5)|tx\-9|up(\.b|g1|si)|utst|v400|v750|veri|vi(rg|te)|vk(40|5[0-3]|\-v)|vm40|voda|vulc|vx(52|53|60|61|70|80|81|83|85|98)|w3c(\-| )|webc|whit|wi(g |nc|nw)|wmlb|wonu|x700|xda(\-|2|g)|yas\-|your|zeto|zte\-)") { set $mobile_rewrite perform; } if ($mobile_rewrite = perform) { rewrite ^ http://m.mywebsite.com redirect; #rewrite ^(.*)$ $scheme://mywebsite.com/mobile/$1; #return 301 http://m.mywebsite.com; #break; } #---------------------------------------------------# location / { index index.html index.htm index.php; } error_page 500 502 503 504 /50x.html; location = /50x.html { root html; } location ~ \.php$ { try_files $uri =404; fastcgi_pass 127.0.0.1:9000; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME $document_root$fastcgi_script_name; fastcgi_param PATH_INFO $fastcgi_script_name; include /etc/nginx/conf/fastcgi_params; } }#sever1 #server 2 server { listen 80; server_name m.mywebsite.com; index index.html index.htm index.php; root /srv/http/mywebsite.com/public; access_log /srv/http/mywebsite.com/logs/access.log; error_log /srv/http/mywebsite.com/logs/error.log; #---------------- For CodeIgniter ----------------# # canonicalize codeigniter url end points # if your default controller is something other than "welcome" you should change the following if ($request_uri ~* ^(/main(/index)?|/index(.php)?)/?$) { rewrite ^(.*)$ / permanent; } # removes trailing "index" from all controllers if ($request_uri ~* index/?$) { rewrite ^/(.*)/index/?$ /$1 permanent; } # removes trailing slashes (prevents SEO duplicate content issues) if (!-d $request_filename) { rewrite ^/(.+)/$ /$1 permanent; } # unless the request is for a valid file (image, js, css, etc.), send to bootstrap if (!-e $request_filename) { rewrite ^/(.*)$ /index.php?/$1 last; break; } #---------------------------------------------------# location / { index index.html index.htm index.php; } error_page 500 502 503 504 /50x.html; location = /50x.html { root html; } location ~ \.php$ { try_files $uri =404; fastcgi_pass 127.0.0.1:9000; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME $document_root$fastcgi_script_name; fastcgi_param PATH_INFO $fastcgi_script_name; include /etc/nginx/conf/fastcgi_params; } }#sever2 }#http I could just detect the mobile browsers with php or javascript but i need to make the detection at the server level so that i can use the 'm' in m.mywebsite.com as a flag in my controllers (codeigniter) to serve up the right view. I hope someone can help me! Thank you!

    Read the article

  • How do i tell if my drivers are up to date on Acer?

    - by joe
    Hoping some kind souls can help me out ? I got a blue screen the other day after trying to load sandboxie. So its obviously conflicting with something. I checked if my drivers were up to date on my acer aspire one AOD270 on this intel based site; http://www.drivermanager.com/en/down...tel&Logo=intel Its showing i have 2 drivers that need updating ; Intel NM10 Express chipset and the Realtek PCIE Cardreader. I have no idea whether to do the update via the Intel Driver update site or the Acer drivers download page? I then ran Bluescreenview and on the dump file its showing ; ''caused by driver'' igdkmd32.sys ''file description'' Intel (R) WDDM Kernel mode driver ''product name''Intel Graphics Accelerator Drivers for Windows 7(R) I bought the laptop here in SE Asia about a year ago. The ''HOT!! NEW download tool'' on the acer drivers site (below) doesnt seem to work and the info about removing and installing drivers is limited. Not sure what to trust on non acer/manufacturer sites. http://support.acer.com/us/en/produc...1&modelId=4040 I've located the igdkmd32.sys file inside the INTEL GRAPHICS MEDIA ACCELERATOR 3600 SERIES 8.14.8.1064. When i click on ''update driver'' in control panel it searches and says its up to date. In windows maintenance it says this intel had a problem, but no solution. For all i know my drivers could be up to date and its something else. Can anybody advise a dummy step by step the process i should follow ? I've never done this before. eg do i delete the old driver first and then download the new one.how much of a problem i could cause by downloading this type of thing wrongly? As yet i havent downloaded any drivers. I've asked on other forums but no luck as yet. Thanks for any help!

    Read the article

  • How can I set Vim to obey accents of my spoken language?

    - by naxa
    When pressing w or e in sentences with accents (written in my native language), such as the first one (marked **) here: **Éj-mélybol fölzengo** - csing-ling-ling - száncsengo. Száncsengo - csing-ling-ling - tél csendjén halkan ring. [1] the characters o, ö, among others [2], make my gVim think they are word-ends so it stops on them (in Normal mode). gVim stops on the positions marked with _ where it shouldn't: Éj-mélyb_ol f_ölzeng_o. I would like to set gVim so it properly handle words even when containing accents and other local characters. But where do I set this? I use it on Win32, vim v 7.3.46. [1] - excerpt of a poem by Weöres Sándor [2] - "others", not mentioned here :) like í, u are also a problem. On the other hand, gVim seems to already work with é and á. gVim version info: VIM - Vi IMproved 7.3 (2010 Aug 15, compiled Oct 27 2010 17:59:02) Included patches: 1-46 Compiled by Bram@KIBAALE Big version with GUI. Features included (+) or not (-): +arabic +autocmd +balloon_eval +browse ++builtin_terms +byte_offset +cindent +clientserver +clipboard +cmdline_compl +cmdline_hist +cmdline_info +comments +conceal +cryptv +cscope +cursorbind +cursorshape +dialog_con_gui +diff +digraphs -dnd -ebcdic +emacs_tags +eval +ex_extra +extra_search +farsi +file_in_path +find_in_path +float +folding -footer +gettext/dyn -hangul_input +iconv/dyn +insert_expand +jumplist +keymap +langmap +libcall +linebreak +lispindent +listcmds +localmap -lua +menu +mksession +modify_fname +mouse +mouseshape +multi_byte_ime/dyn +multi_lang -mzscheme +netbeans_intg +ole -osfiletype +path_extra +perl/dyn +persistent_undo -postscript +printer -profile +python/dyn +python3/dyn +quickfix +reltime +rightleft +ruby/dyn +scrollbind +signs +smartindent -sniff +startuptime +statusline -sun_workshop +syntax +tag_binary +tag_old_static -tag_any_white +tcl/dyn -tgetent -termresponse +textobjects +title +toolbar +user_commands +vertsplit +virtualedit +visual +visualextra +viminfo +vreplace +wildignore +wildmenu +windows +writebackup -xfontset -xim -xterm_save +xpm_w32

    Read the article

  • Question about domain name registration

    - by Obay
    I received the following email from a certain [email protected] YYY is a company name ZZZ is OUR company name Dear Manager, We are a professional intellectual property rights consultant organization, mainly deal with the global domain name registration and internet intellectual property rights protection. On March. 24th, 2010, we formally received an application from YYY, they applied to register the internet brand “ZZZ” and some relevant domain names with our organization. During our preliminary investigation, we found that these domain names' keyword is fully identical with your trademark. Therefore, we need to confirm with you, whether you consigned YYY to register these domain names with us or not? Or, is YYY your business partner or distributor? If you have no relationship with this company, we assume that they have other purposes to obtain these domain names. Currently, we have already suspended this company's application temporarily due to the seriousness of this isuue. In order to avoid the vicious domain name grabbing, please let the relevant person make a confirmation with me via telephone or email as soon as possible. Thank you for your support to our work! Best Regards XXX Tel: xxxxx-xxxx xxxx Fax: xxxxx-xxxx xxxx Email: [email protected] www.world-wtc.cn This seems legit, or is it? By the way, XXX is just a first name, not a complete name.

    Read the article

  • Falsification of an email sent from lotus notes

    - by thejumper
    I needed from a person an important email with an attachment (I give the person a fictious name here: Name familyname) . The person sent me an email in the format below (I changed the content but respected the format). In the email he sent me there is two parts, first below the email he sent, and after that above the answer he received. I told the person that he didn't give me the true information because the first part of the email is falsified. Please tell me what you think. Thanks a lot. From: abc efg To: Name familyname Date: 2012-03-09 12:14 AM Subject: Lorem ipsum dolor Nam dictum feugiat neque, euismod convallis mi euismod ut. Mauris at vulputate enim. Nunc posuere tortor vitae justo volutpat luctus. Sed ut ligula id magna dictum blandit id vitae erat. Nunc dignissim eleifend vulputate. 2012/3/4 Name familyname Lorem ipsum dolor sit amet, consectetur adipiscing elit. Fusce aliquam ligula in elit blandit porta. Vestibulum facilisis, elit ut aliquam euismod, erat elit tempor mi, et pulvinar velit neque ac nibh. Nullam fringilla viverra erat sed laoreet. Aenean elementum enim ac elit ultricies luctus. Name Adress. Tel. Thanks for your help.

    Read the article

  • Welcome to the SOA &amp; E2.0 Partner Community Forum

    - by Jürgen Kress
    With more than 200 registrations the SOA & E2.0 Partner Community Forum is a huge success!   Conference program Is available online: http://tinyurl.com/soaforumagenda Agenda Tuesday March 15th 2011 12:15 Welcome & Introduction – Hans Blaas & Jürgen Kress, Oracle 12:30 Oracle Middleware Strategy and Information on Application Grid and Exalogic - Andrew Sutherland, Oracle 13:15 Managing Online Customer, Partner and Employee Engagement Oracle E2.0 Solutions - Andrew Gilboy, Oracle 14:00 Coffee Break 14:30 Partner SOA/ BPM Reference Case – Leon Smiers, Capgemini 15:15 Partner WebCenter/ UCM Reference Case – Vikram Setia, Infomentum 16.00 Break 16.30 SOA and BPM 11gR1 PS3 Update – David Shaffer 17:00 Why specialization is important for Partners – Nick Kritikos, Hans Blaas & Jürgen Kress 17:45 Social Event   Wednesday March 16th 2011 09.00 Welcome & Introduction Day II 09.15 Breakout sessions Round 1 SOA Suite 11g PS3 & OSB Importance of ADF & Jdeveloper SOA Security IDM WebCenter PS3, Whats New E2.0 Sales Plays 10.30 Break 10.45 Breakout sessions Round 2 WebCenter PS3, Whats New Applications Management Enterprise Manager and Amberpoint ADF/WebCenter 11g integration with BPM Suite 11g Importance of ADF & Jdeveloper JCAPS & OC4J migration opportunities for service business 12.00 Lunch 13.00 Breakout sessions Round 3 BPM 11g, Whats New Universal Content Management! 11g SOA Security IDM E2.0 Surrounding Products: ATG, Documaker, Primavera Middleware Industry Value Propositions & Sales Plays 14.30 Break 14.45 Fusion Applications, Rajan Krishnan, Oracle 15.30 SOA & E2.0 Summary & Closing, Hans Blaas & Jürgen Kress, Oracle 15.45 Finish & Departure 16:00 Bus departure   Capgemini Nederland BV Papendorpseweg 100 3500 GN Utrecht The Netherlands Tel: +31 30 689 00 00 For a detailed routedescription by car or public transport please visit: http://www.nl.capgemini.com/pdf/Papendorp_UK.pdf Hotel In case you have not booked your hotel yet, please make your own hotel reservation. You can book your hotel room at the 'Hotel Vianen' at a special rate, by using the Oracle booking code: DDG VIA-GF41422. One night package € 110,- for a single room, including breakfast. Kindly secure your hotel room as soon as possible. The number of rooms is limited! Hotel Vianen Prins Bernhardstraat 75 4132 XE Vianen [email protected] The Netherlands [email protected] Arrival on 14th of March and staying at Hotel Vianen. On 15th of March we have arranged a transfer from Hotel Vianen to the Capgemini Offices. The bus is parked in front of the hotel and will leave at 10.15AM (UTC/GMT+1). Logistics Pass with barcode At your arrival you will receive a pass with a barcode. This pass will give you access to the conference building and the different floors within the building. Please make sure to hand in your pass at the registration desk at the end of the day. Arrival by plane Transfer from Schiphol Airport to Capgemini on 15th of March will be arranged by Oracle. A hostess will be welcoming you at the Meeting Point at Schiphol Airport (this is a red and white large cubicle situated next to Delifrance) The buses will depart from Schiphol Airport at 09.00AM, 09.45AM and 10.30AM (UTC/GMT+1).     For future SOA Partner Community Forums  become a member for registration please visit www.oracle.com/goto/emea/soa (OPN account required) Blog Twitter LinkedIn Mix Forum Wiki Website Technorati Tags: SOA Partner Community Forum,Community,SOA Partner Community,Utrecht 03.2011,OPN,Oracle,Jürgen Kress

    Read the article

  • SQLAuthority News – Speaking at Southeast Asia SharePoint Conference 2013 – Singapore

    - by pinaldave
    Two years ago I spoke at Southeast Asia SharePoint Conference 2011, Singapore and I had a fantastic time to present to the Singapore audience. The session was very well received and lots of interest was generated. The event is back again this year and with much bigger scale. I will be presenting on SQL Server and Sharepoint subject at the conference. Session Details: Title: Performance in 60 Seconds – Database Tricks Every SharePoint Developer & Admin MUST Know Abstract: SharePoint Developers and System Administrators often come across situations where they face a slow server response, even though their hardware specifications are above  par. This session is for all the SharePoint Developers who want their server to perform at blazing fast speed but want to invest very little time to make it happen. We will go over various database tricks which require absolutely no time to master and require practically no SQL coding at all. After attending this session, Developers will only need 60 seconds to improve performance of their database server in their SharePoint implementation. Date and Time: January 18, 20013 - 3:15 PM-4:15 PM Location: Max Atria is located at Singapore Expo, 1 Expo Drive, Singapore Tel 65 6403 2160 This session will cover lots of interesting tips and tricks about SQL Server and SharePoint co-exists together. I promise that every attendee will walk out with a trick which they can walk out of session and directly apply to their production server to improve its performance. The event is going to be again fantastic event – if you are in Singapore – you must not miss this event. If you are planning vacation – this is the right time to take days off and travel to Singapore for vacation. The event features over 30 sessions to choose from, focus on three areas of business gain: Exploring Information, Improving Productivity and Making it Work. This event has an excellent line up of international speakers (speakers traveling from the USA, Australia, New Zealand, Sri Lanka and India). Register early to reserve a spot at your choice of more than 30 classes taught by Microsoft Certified Masters, MVPs, and other top SharePoint experts! Here I have attempted to answer a few of the questions which every SharePoint professional half: Which sessions suit my skill level? Click here. What sessions are right for me? Click here. Which sessions are of my interests? Click here. Which sessions are on when? Click here. If you register by next Friday, 14, December – you can save $126 on the regular price of the conference. Prizes, Giveaways and … I love conference goodies – I collect them as a souvenir . This event is known for its generous prizes. The first 100 people to register on the day will get a SPECIAL gift at the event. Additionally there are exhibitor booth give away too. Here is the page listing all the prizes and giveaways. Do leave a comment or send me email if you are going to the event, we can sit together and have a coffee. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, SQLAuthority News, T SQL, Technology

    Read the article

  • Please Help - PHP Form, when no text is entered [migrated]

    - by Joe Turner
    I'm creating a mobile landing page and I have also created a form that allows me to create more, by duplicating a folder that's host to a template file. The script then takes you to a page where you input the company details one by one and press submit. Then the page is created. My problem is, when a field is left out (YouTube for instance), the button is created and is blank. I would like there to be a default text for when there is no text. I've tried a few things and have been struggling to make this work for DAYS! <?php $company = $_POST["company"]; $phone = $_POST["phone"]; $colour = $_POST["colour"]; $email = $_POST["email"]; $website = $_POST["website"]; $video = $_POST["video"]; ?> <div id="contact-area"> <form method="post" action="generate.php"><br> <input type="text" name="company" placeholder="Company Name" /><br> <input type="text" name="slogan" placeholder="Slogan" /><br> <input class="color {required:false}" name="colour" placeholder="Company Colour"><br> <input type="text" name="phone" placeholder="Phone Number" /><br> <input type="text" name="email" placeholder="Email Address" /><br> <input type="text" name="website" placeholder="Full Website - Include http://" /><br> <input type="text" name="video" placeholder="Video URL" /><br> <input type="submit" value="Generate QuickLinks" style="background:url(images/submit.png) repeat-x; color:#FFF"/> </form> That's the form. It takes the variables and post's them to the file below. <?php $File = "includes/details.php"; $Handle = fopen($File, 'w'); ?> <?php $File = "includes/details.php"; $Handle = fopen($File, 'w'); $Data = "<div id='logo'> <h1 style='color:#$_POST[colour]'>$_POST[company]</h1> <h2>$_POST[slogan]</h2> </div> <ul data-role='listview' data-inset='true' data-theme='b'> <li style='background-color:#$_POST[colour]'><a href='tel:$_POST[phone]'>Phone Us</a></li> <li style='background-color:#$_POST[colour]'><a href='mailto:$_POST[email]'>Email Us</a></li> <li style='background-color:#$_POST[colour]'><a href='$_POST[website]'>View Full Website</a></li> <li style='background-color:#$_POST[colour]'><a href='$_POST[video]'>Watch Us</a></li> </ul> \n"; fwrite($Handle, $Data); fclose($Handle); ?> and there is what the form turns into. I need there to be a default link put in incase the field is left blank, witch it is sometimes. Thanks in advance guys.

    Read the article

  • Pulling My Hair Out - PHP Forms [migrated]

    - by Joe Turner
    Hello and good morning to all. This is my second post on this subject because the first time, things still didn't work and I have now literally been trying to solve this for about 4/5 days straight... I have a file, called 'edit.php', in this file is a form; <?php $company = $_POST["company"]; $phone = $_POST["phone"]; $colour = $_POST["colour"]; $email = $_POST["email"]; $website = $_POST["website"]; $video = $_POST["video"]; $image = $_POST["image"]; $extension = $_POST["extension"]; ?> <form method="post" action="generate.php"><br> <input type="text" name="company" placeholder="Company Name" /><br> <input type="text" name="slogan" placeholder="Slogan" /><br> <input class="color {required:false}" name="colour" placeholder="Company Colour"><br> <input type="text" name="phone" placeholder="Phone Number" /><br> <input type="text" name="email" placeholder="Email Address" /><br> <input type="text" name="website" placeholder="Full Website - Include http://" /><br> <input type="text" name="video" placeholder="Video URL" /><br> <input type="submit" value="Generate QuickLinks" style="background:url(images/submit.png) repeat-x; color:#FFF"/> </form> Then, when the form is submitted, it creates a file using the variables that have been input. The fields that have been filled in go on to become links, I need to be able to say 'if a field is left blank, then put 'XXX' in as a default value'. Does anyone have any ideas? I really think I have tried everything. I'll put below a snippet from the .php file that generates the links... <?php $File = "includes/details.php"; $Handle = fopen($File, 'w'); ?> <?php $File = "includes/details.php"; $Handle = fopen($File, 'w'); $Data = "<div id='logo'> <img width='270px' src='images/logo.png'/img> <h1 style='color:#$_POST[colour]'>$_POST[company]</h1> <h2>$_POST[slogan]</h2> </div> <ul> <li><a class='full-width button' href='tel:$_POST[phone]'>Phone Us</a></li> <li><a class='full-width button' href='mailto:$_POST[email]'>Email Us</a></li> <li><a class='full-width button' href='$_POST[website]'>View Full Website</a></li> <li><a class='full-width button' href='$_POST[video]'>Watch Us</a></li> </ul> \n"; I really do look forward to any response...

    Read the article

< Previous Page | 3 4 5 6 7 8 9  | Next Page >